ID: 1092302632

View in Genome Browser
Species Human (GRCh38)
Location 12:7266722-7266744
Sequence CTGCATGTTCATATGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092302625_1092302632 21 Left 1092302625 12:7266678-7266700 CCAGGGATGGAGTATGCTCCCTA No data
Right 1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG No data
1092302628_1092302632 2 Left 1092302628 12:7266697-7266719 CCTAAAGGCCCAGCTGATGATCA No data
Right 1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG No data
1092302627_1092302632 3 Left 1092302627 12:7266696-7266718 CCCTAAAGGCCCAGCTGATGATC No data
Right 1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG No data
1092302624_1092302632 30 Left 1092302624 12:7266669-7266691 CCTCACTTGCCAGGGATGGAGTA No data
Right 1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG No data
1092302630_1092302632 -7 Left 1092302630 12:7266706-7266728 CCAGCTGATGATCAAGCTGCATG No data
Right 1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG No data
1092302629_1092302632 -6 Left 1092302629 12:7266705-7266727 CCCAGCTGATGATCAAGCTGCAT No data
Right 1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092302632 Original CRISPR CTGCATGTTCATATGGTCCC TGG Intergenic
No off target data available for this crispr