ID: 1092307259

View in Genome Browser
Species Human (GRCh38)
Location 12:7314140-7314162
Sequence ATGTAGAAGATGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1049
Summary {0: 1, 1: 0, 2: 10, 3: 96, 4: 942}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092307259 Original CRISPR ATGTAGAAGATGAAGGAAGA AGG Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
901056091 1:6449182-6449204 ATGTAGAAGAGGAAGGACCCGGG - Intronic
901284553 1:8066707-8066729 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
901305163 1:8227477-8227499 ATGAAGTAGGTGGAGGAAGATGG + Intergenic
901336828 1:8456669-8456691 ATGGAGAAGATGAAGTCGGAAGG - Intronic
901411550 1:9087829-9087851 AGAGAGAAGAGGAAGGAAGAGGG - Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
901850211 1:12010362-12010384 ATGTAGAAAATGGAGAAATAGGG - Intronic
902079166 1:13809364-13809386 TGGTAGAAGAGGAAGGAAGGCGG + Intronic
902478263 1:16699313-16699335 ATGTAGAAGAGGAAGGACCCGGG + Intergenic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903136814 1:21314624-21314646 ATTTAGATGACAAAGGAAGATGG - Intronic
903296559 1:22347059-22347081 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
903387161 1:22934865-22934887 AAGTGGAAGATGCAGGCAGAAGG - Intergenic
903698501 1:25228161-25228183 GTGCAGAAGATGCAGAAAGATGG - Exonic
903947067 1:26970682-26970704 ATGCAGAGGGTGAGGGAAGAGGG + Intergenic
904083359 1:27886077-27886099 ATCTAGAACCTGAAGGAAGCTGG - Exonic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904531768 1:31174697-31174719 ATGCAGAAGTTGTTGGAAGATGG + Intergenic
905137839 1:35813780-35813802 AGGAAGAGGAAGAAGGAAGAAGG + Intronic
905317318 1:37091586-37091608 ATGTAGGAGGTGAAGGAGAAAGG - Intergenic
905716548 1:40156331-40156353 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
905970189 1:42135979-42136001 TTGTAGAACAGAAAGGAAGAAGG - Intergenic
906142027 1:43539615-43539637 ATGTAGAGGGTGCAGCAAGAGGG + Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
906942397 1:50266718-50266740 ATGTATAAAATGAGGGCAGAGGG + Intergenic
906944333 1:50283002-50283024 ATGTTGAAGATGAGGGCAGAGGG - Intergenic
907152509 1:52302306-52302328 ATGTAGAATATGATGTGAGATGG - Intronic
907378716 1:54066995-54067017 AGGTTGAAGTTAAAGGAAGAGGG + Intronic
907688184 1:56634847-56634869 ATGGAGAATATCAAGGATGAAGG + Intronic
907802337 1:57782301-57782323 ATGAAGAATATGAAAAAAGAGGG + Intronic
907942633 1:59104301-59104323 TTGGAGAAAATGAAGGAAAAAGG + Intergenic
907981269 1:59483888-59483910 AAATAAAAGATGAAGGAAGCAGG + Intronic
908376607 1:63548585-63548607 AAGTGGAAGAAGAAGAAAGAGGG - Intronic
908391416 1:63686913-63686935 ATGAAGAAGTGGATGGAAGAAGG - Intergenic
908670770 1:66544982-66545004 ATGTAGGACAGGAAGGAAGGAGG - Intronic
909166687 1:72235129-72235151 ATGTTGAATATGAAAGAACATGG + Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909420436 1:75458644-75458666 ATGTAAAAAATGAAGGGAAAAGG + Intronic
910082816 1:83361746-83361768 ATTTAGAAGAAGAAATAAGAAGG + Intergenic
910755631 1:90687295-90687317 ATCCAGAAGATGATGGATGAAGG - Intergenic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911167921 1:94741560-94741582 AGTTAGAAGGTGAAGGAAGTAGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911905715 1:103566085-103566107 ATGTAGAAGAGCAAGGAAAATGG - Intronic
912007813 1:104926208-104926230 ATGGAAGAGATGAAGCAAGAGGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG + Intronic
913001849 1:114588533-114588555 ATGTAGAAGATGAGATAACAGGG - Intronic
913692552 1:121293120-121293142 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
913693870 1:121305563-121305585 GTGTGGGAGATGGAGGAAGAGGG - Intronic
913986958 1:143574403-143574425 AGGTAGAAGGTGGAGTAAGATGG + Intergenic
914143694 1:144974503-144974525 GTGTGGGAGATGGAGGAAGAGGG + Intronic
914145004 1:144986974-144986996 ATGGAGAAGTTGTAGAAAGAAGG - Intronic
914582730 1:149033571-149033593 AGGTAGAAGGTGGAGTAAGATGG + Intronic
915236588 1:154487909-154487931 ATGTAAAGGGTGAAGGGAGAAGG - Intronic
915316726 1:155033024-155033046 CTGTAGAACATGCAGGATGAGGG + Intronic
915339631 1:155169546-155169568 ATGGAGAAGATGAAGCTATATGG + Exonic
915623996 1:157103496-157103518 ATGTAGAAAAGGAAGGATGGAGG - Intergenic
915643684 1:157251283-157251305 ATGTTGCAGATGAAGTCAGAAGG - Intergenic
915875918 1:159612158-159612180 ATGAAAAAGATGGAGGAAGAGGG - Intergenic
916346546 1:163798050-163798072 TTGAAGAACAGGAAGGAAGAAGG - Intergenic
916572165 1:166037499-166037521 ATGTGGATAGTGAAGGAAGAGGG + Intergenic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
917195256 1:172457528-172457550 ATGTAGAAAATGAACATAGATGG - Intronic
917238218 1:172917565-172917587 ATCCAAAAGATGAAGGAACAAGG - Intergenic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
917710735 1:177681371-177681393 TTTTAAAAGATGAAGGCAGAGGG + Intergenic
918275316 1:182948471-182948493 ACATTGAAGATGAAGGAAGAGGG + Intronic
918284951 1:183043180-183043202 ATCTAGTAGATTTAGGAAGATGG + Intronic
918930817 1:190854649-190854671 TTTTAGAAAATAAAGGAAGAGGG - Intergenic
919119127 1:193316953-193316975 ATGAAGAAAATAAAGGGAGAGGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919418144 1:197336970-197336992 ATGTTGAATATCAAGGGAGAAGG + Intronic
919491039 1:198205040-198205062 AAGTAGGAGAAGAAGGAAGGGGG - Intronic
919654813 1:200186766-200186788 ATGAATGAAATGAAGGAAGAAGG + Intergenic
919968897 1:202558348-202558370 AAGTAGAAGAGTAAGGGAGAGGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920479871 1:206311477-206311499 ATGGAGAAGTTGTAGAAAGAAGG + Intronic
920481194 1:206323942-206323964 GTGTGGGAGATGGAGGAAGAGGG - Intronic
920567726 1:206988666-206988688 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
920645584 1:207801278-207801300 ATGTTGAAGATCAAGGCTGAGGG - Intergenic
920756216 1:208736436-208736458 ATTTAGAAGGAGTAGGAAGAAGG + Intergenic
921275305 1:213513168-213513190 ACTTTGAAGATGAAGGAGGAGGG + Intergenic
921309130 1:213825382-213825404 AAGTGGAATATAAAGGAAGAGGG + Intergenic
921405205 1:214771566-214771588 ATGTAGAAGTTGCAGGAGAATGG - Intergenic
921555215 1:216590627-216590649 TTGGAGAAAATGAAGGCAGAAGG + Intronic
922561293 1:226571621-226571643 AAGAAGAAGAAGAAGGGAGAAGG - Intronic
922623410 1:227010652-227010674 AGGAAGAAGATGGAGGAATAGGG - Intronic
922848284 1:228708073-228708095 ATGAATAAAATGAAGGGAGAAGG + Intergenic
922871446 1:228905186-228905208 AAGTAGATGAGGAAGGCAGAAGG + Intergenic
923186086 1:231574872-231574894 ATGTGTATGATGAAGTAAGAGGG - Intronic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923765863 1:236891857-236891879 ACAGAGAAGATGAAGGATGATGG + Intronic
924680571 1:246227631-246227653 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1063055309 10:2497726-2497748 AAGTAGAAGATGATGGAAACAGG + Intergenic
1063286166 10:4691345-4691367 TTTTAGAAGATAAAGAAAGATGG + Intergenic
1063485641 10:6417999-6418021 ATCTGGGAGATGACGGAAGAAGG - Intergenic
1063802990 10:9602879-9602901 ACTTAGAAGATGTAGGAAAAAGG - Intergenic
1064281000 10:13951438-13951460 ATATTGAAGATGAAAGAAGTGGG + Intronic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064734285 10:18364657-18364679 AGGCAGGAGATGAAAGAAGAGGG - Intronic
1064884555 10:20096040-20096062 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1064928697 10:20599128-20599150 ATGTAAAAGAGGAAATAAGAGGG - Intergenic
1065256919 10:23879458-23879480 GTGTAGCATATTAAGGAAGAAGG + Intronic
1065372371 10:25001259-25001281 ATATAGAAGAAGAAGAAAAAAGG - Intronic
1065691388 10:28337400-28337422 ATATAAATCATGAAGGAAGAAGG + Intergenic
1065709020 10:28497658-28497680 AGATAGAAAAGGAAGGAAGAAGG + Intergenic
1066205951 10:33189398-33189420 ATGTAAAAGATGACGGAAGAGGG - Intronic
1067196423 10:44123389-44123411 ATGAAGAAGATAAGGAAAGAAGG + Intergenic
1067334851 10:45352363-45352385 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1068027498 10:51665725-51665747 TTTTAAAAAATGAAGGAAGAAGG - Intronic
1068138832 10:52978361-52978383 AGGTAGAAGTTGTGGGAAGAGGG - Intergenic
1068165016 10:53319086-53319108 ATGAAGAGGAAGAAGGAAAAAGG + Intergenic
1068394761 10:56446808-56446830 ATGAAGGAAATGAAGCAAGAAGG - Intergenic
1068660051 10:59614430-59614452 ATGCAGGAGATGCAGGGAGAGGG - Intergenic
1068818336 10:61343889-61343911 GTTTTGAAGATGAAGTAAGAGGG + Intergenic
1070102091 10:73398105-73398127 ATGAAGAGGATAAAGGGAGAAGG + Intronic
1070203738 10:74234256-74234278 ATGTTAAAGAACAAGGAAGAAGG + Intronic
1070342938 10:75514295-75514317 AAGAAGAAGAAGAAGGAAAAAGG - Intronic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070749662 10:78956439-78956461 ATCTGGAAGCTGAGGGAAGAGGG - Intergenic
1071020568 10:81050084-81050106 ATTTAGAAGATGAATGAAAAGGG - Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071877817 10:89861504-89861526 AGGCAGAAGAAGAAAGAAGAAGG - Intergenic
1072085630 10:92076755-92076777 AAGTAGAAGAAGGAAGAAGAAGG + Intronic
1072489132 10:95886631-95886653 ACTTTGAAGATGAAGGAAGGGGG + Intronic
1072837951 10:98736974-98736996 ATTGAGAAGATGAAGGTTGAAGG + Intronic
1073038484 10:100581225-100581247 AGGTTGAAGTTGTAGGAAGAGGG - Intergenic
1073125053 10:101144020-101144042 GTGTAGAAGGTGAGGGAAGGAGG - Intergenic
1073673626 10:105619919-105619941 AAATATATGATGAAGGAAGAAGG + Intergenic
1073866173 10:107806642-107806664 ATGTAGGAAATGAAGGGGGAAGG + Intergenic
1074388556 10:113037130-113037152 TTGTAGAAGATGAAGGAAGCTGG + Intronic
1074866706 10:117548104-117548126 AGGCAGAAGCTGGAGGAAGAAGG + Exonic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1075624856 10:123955252-123955274 ATGTAACAGATGAAGCATGATGG - Intergenic
1076021049 10:127073766-127073788 ATGCAGAAAATGGAGAAAGAGGG + Intronic
1076034512 10:127187934-127187956 GTGAAAAAGATAAAGGAAGAAGG - Intronic
1076348002 10:129793854-129793876 AAGGAAAAGAGGAAGGAAGAGGG - Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1078049321 11:7948032-7948054 AGGCAGAAGATGTGGGAAGATGG + Intergenic
1078168218 11:8909376-8909398 AAAAAGAAGAAGAAGGAAGAAGG + Intronic
1078328061 11:10396568-10396590 ATGTGGCAGATGAAGGAAAGAGG + Intronic
1078592595 11:12657594-12657616 ATATAGAAGTTAAAGGGAGAAGG + Intergenic
1078896892 11:15604789-15604811 ATGTAGAAGAGAATGGCAGATGG - Intergenic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1079766335 11:24397794-24397816 ATGTTAAAGAAGAAGAAAGAGGG + Intergenic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1080172861 11:29327235-29327257 AAGTAAAAGATGAAGGGCGAAGG + Intergenic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080569361 11:33542292-33542314 ATGAAGAGGATGGAGGTAGAGGG - Exonic
1080712549 11:34763563-34763585 ATGAAGGAAATGAAGCAAGAAGG - Intergenic
1080811054 11:35704175-35704197 ATGAAGGAAATGAAGCAAGAAGG + Intronic
1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG + Exonic
1080960805 11:37157640-37157662 AAGGACAAGATGAGGGAAGAAGG - Intergenic
1081231430 11:40590204-40590226 ATGAAGAAAATGAAGCGAGAAGG - Intronic
1081232608 11:40604769-40604791 ATGGATAAAATAAAGGAAGAAGG + Intronic
1081442864 11:43099725-43099747 ATGAATAAAATGAAGCAAGAAGG - Intergenic
1081884118 11:46480103-46480125 AAGTGGAAGAGGAAGGCAGAAGG - Intronic
1082262862 11:50090670-50090692 ATGTGGAAGAGGGAGGCAGAAGG + Intergenic
1082596288 11:55085784-55085806 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1082647280 11:55743279-55743301 ATGTAAAACATGAAGGAGAAAGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082934246 11:58639896-58639918 CTGTAACAGATGAAGGAAGTGGG - Intergenic
1083001808 11:59299109-59299131 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083225672 11:61282969-61282991 ATGGAGATGAGGGAGGAAGAGGG - Intronic
1084523987 11:69684666-69684688 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085807655 11:79651032-79651054 AGGAAGAAGAAGAAGGAAGGAGG - Intergenic
1085807659 11:79651055-79651077 AGGAAGGAGAAGAAGGAAGATGG - Intergenic
1085807669 11:79651112-79651134 AGGAAGAAGAAGAAGAAAGAAGG - Intergenic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086374985 11:86190975-86190997 ATGTATAAGAAGCAGGTAGAAGG - Intergenic
1086589722 11:88498956-88498978 ATATAGAAGATGAAAAAATATGG - Intergenic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1086867831 11:92001685-92001707 GTGGAGAAAATGAAGGAAGGAGG + Intergenic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087004139 11:93452453-93452475 GTGGAGGAGATGAAGGAAGTGGG + Intergenic
1087549220 11:99626120-99626142 CTGTAGAAATTGCAGGAAGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088039861 11:105366867-105366889 AAGTAGAAGCTGTAAGAAGAGGG - Intergenic
1088079194 11:105890075-105890097 ATGTAGAATATAAAAGCAGAAGG + Intronic
1088466745 11:110147803-110147825 ATGATGAAGAAGAAGGAACAAGG - Intronic
1088620081 11:111672592-111672614 CACTAGAAGAGGAAGGAAGATGG + Intronic
1088731004 11:112683276-112683298 ATGAATGAAATGAAGGAAGAAGG - Intergenic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1089531664 11:119133909-119133931 ATGTAGAAGAAAAGGCAAGAGGG - Intronic
1089786688 11:120912426-120912448 ATGTTCAAGAGGGAGGAAGACGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091438530 12:494500-494522 TGGTAGAAAATGGAGGAAGAGGG - Intronic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1091896780 12:4111260-4111282 AAGAAGAAGATGTAGGAAGCTGG + Intergenic
1091961703 12:4701090-4701112 ATGTGGAAGATGAAGAATCACGG + Intronic
1092027704 12:5256851-5256873 AAGTGGACAATGAAGGAAGAAGG + Intergenic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092550217 12:9490302-9490324 AGGTGGAAGGAGAAGGAAGAAGG + Intergenic
1092845355 12:12579889-12579911 GTTTTGAAGATGGAGGAAGAAGG - Intergenic
1093115263 12:15202023-15202045 ATGTTGATTAGGAAGGAAGAAGG - Intronic
1093509773 12:19912728-19912750 ATGAAAAAGATGAAGCTAGAGGG - Intergenic
1093589179 12:20879553-20879575 ATATAGAAGTTGAAACAAGAAGG - Exonic
1093829978 12:23744050-23744072 ATGCTGAAGATGCAGCAAGATGG - Intronic
1093877589 12:24368752-24368774 ATGTAGGATATACAGGAAGAAGG - Intergenic
1093914117 12:24781529-24781551 GCTTTGAAGATGAAGGAAGATGG - Intergenic
1094070293 12:26405146-26405168 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094337138 12:29372379-29372401 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1094521591 12:31196071-31196093 AGGTGGAAGGAGAAGGAAGAAGG - Intergenic
1094522629 12:31208946-31208968 CTGTAGAGGATGAAGGAAGCAGG - Intergenic
1094651662 12:32384709-32384731 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1095158023 12:38882205-38882227 ATATATAAGAGGAAGGCAGAGGG + Intronic
1095301766 12:40592622-40592644 ACTTTGAAGATGAAGAAAGAGGG + Intergenic
1095740688 12:45603495-45603517 AAAAAGAAGAAGAAGGAAGAAGG - Intergenic
1096320617 12:50609475-50609497 CAGTAGATGATGAAGGAACAGGG - Intronic
1096411105 12:51377643-51377665 AGATAGCAGATGAAGGAAGGGGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096949921 12:55457420-55457442 ATTTGAAAGATGTAGGAAGAGGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097200988 12:57278420-57278442 AGGTGGAAGATGCAGGCAGATGG + Intronic
1097302034 12:58029217-58029239 ATCAGGAAAATGAAGGAAGAGGG - Intergenic
1097533240 12:60832650-60832672 ATGCAGAAAATGAAAGAAAAGGG - Intergenic
1097882206 12:64696139-64696161 ATGTAGAAAAGAAAGGGAGAGGG - Exonic
1097937790 12:65272977-65272999 ATGTGGAATGTGAAAGAAGAAGG - Intergenic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1098096600 12:66963480-66963502 ATGAAGAAAAAGAAGGAATAAGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098633597 12:72754371-72754393 TTGTGGAAAATGAAGGTAGAGGG - Intergenic
1098730053 12:74024670-74024692 ATGGAGGAGATGGAGGAAGAGGG + Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099476579 12:83114821-83114843 ATATATAAAATGAATGAAGATGG - Intronic
1099528462 12:83744085-83744107 ATGCAGAAGAGGAAGAAAGCAGG - Intergenic
1099627989 12:85100719-85100741 ATTGAGAGGATGAAGGGAGAAGG + Intronic
1099681074 12:85828561-85828583 ATTTAGAAGATTAAGTAAAATGG - Intronic
1100169942 12:91963057-91963079 AAGAAGAGGATGAAGGAAGAAGG - Intergenic
1100204640 12:92334942-92334964 ATGAGGAAGATTAGGGAAGATGG + Intergenic
1100417838 12:94397005-94397027 ATATAGAAAATGAAGTATGAAGG + Intronic
1100532822 12:95476164-95476186 ATGAAGATGATGAAGGTAAATGG + Exonic
1100826333 12:98478085-98478107 AGGAGGAAGATGTAGGAAGATGG + Intergenic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101318188 12:103649142-103649164 ATCTAGAAGGTCAAGGACGAGGG - Intronic
1101804695 12:108053155-108053177 ATTTAGAAAATGAATCAAGATGG + Intergenic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1102902329 12:116648011-116648033 AGGCAGAGGATGAAGGAGGAAGG - Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103040336 12:117689984-117690006 AAGAAGAAAAGGAAGGAAGATGG + Intronic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103582448 12:121925310-121925332 AAGTAGCAGATGGAGGAAGAAGG - Intronic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1105450342 13:20493660-20493682 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1105637336 13:22228106-22228128 TTGTGGAAGATACAGGAAGAAGG + Intergenic
1105894172 13:24704336-24704358 ATTGAGAAGATGCAGGAATAAGG - Intronic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106007626 13:25785837-25785859 AGGAAGAAGATAAAGGAAGGAGG + Intronic
1106765144 13:32906242-32906264 ATGTAGCAGATGATGGAGAAAGG - Intergenic
1107169819 13:37327501-37327523 ATGTGGAATATGGGGGAAGATGG + Intergenic
1107183356 13:37487718-37487740 AAGTGGAAGATGAAGGAGAAAGG + Intergenic
1107415697 13:40198291-40198313 ATATTGGAGATGGAGGAAGAGGG - Intergenic
1107640408 13:42437309-42437331 ATGTTGCAGATGAAGAAAGAAGG + Intergenic
1107668663 13:42719386-42719408 ATGTAGAACAGGAAGGGAAATGG + Intergenic
1107897114 13:44976269-44976291 ATGCAAAAAATGAAAGAAGAAGG + Intronic
1107898286 13:44987904-44987926 TTGTAGAAGATGGGGGAGGAGGG - Intronic
1108617891 13:52152883-52152905 ATGCATAAGATGATGGAATATGG - Intronic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1109835738 13:67854136-67854158 ATGAGGATTATGAAGGAAGAAGG - Intergenic
1110290235 13:73797357-73797379 AAGAATAAGATGAAGAAAGAAGG - Intronic
1110420731 13:75304787-75304809 ATGTAGAGAAGTAAGGAAGAAGG + Intronic
1110565514 13:76953891-76953913 GTGTAGCAGAGGAAAGAAGATGG + Intronic
1110590091 13:77246478-77246500 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1111388739 13:87562923-87562945 ATGTAGAAGTAGAAGAGAGAAGG + Intergenic
1111621096 13:90726966-90726988 GTGGAGAAGATGGAGGAAAATGG + Intergenic
1111995497 13:95162209-95162231 ATGTGGAAACTAAAGGAAGAAGG - Intronic
1112142499 13:96660908-96660930 AGGTAGAAGAAGTGGGAAGAAGG + Intronic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112827522 13:103408682-103408704 ATGGGGAAGATGCAGGAAAAAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113258607 13:108534782-108534804 AGGAAGAAGAAGAAGAAAGAAGG - Intergenic
1113794064 13:113046574-113046596 TTGTAAAAGATGAAGGAATGAGG - Intronic
1114120480 14:19666188-19666210 AGGAAGAAGATGAAAGAAGAAGG + Intergenic
1114207431 14:20585950-20585972 ATGTAGGAGATCAATGTAGAAGG - Intronic
1114330820 14:21635106-21635128 ATTTGCCAGATGAAGGAAGAGGG + Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115298130 14:31853447-31853469 ATGGAGAAGGTGGAGTAAGAAGG - Intronic
1115485227 14:33903381-33903403 ATGCAAAAGATCAAGTAAGAAGG + Intergenic
1115505183 14:34086931-34086953 ACATAGAAGATGTAGAAAGAGGG - Intronic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1116042880 14:39707134-39707156 ATGTGGATGATGAAAGAAGATGG - Intergenic
1116504934 14:45666155-45666177 ATGTAGAAGGTGGGGCAAGATGG - Intergenic
1116559206 14:46356592-46356614 ATGTTGAAGATAGAGTAAGAAGG + Intergenic
1116809211 14:49523406-49523428 ATGCAGAAGAGGGAGGAAGCTGG - Intergenic
1117022094 14:51581244-51581266 AGGTAGTAGATAAAGAAAGATGG - Intronic
1117431679 14:55671704-55671726 ATTTAGGCCATGAAGGAAGAAGG - Intronic
1117964817 14:61196015-61196037 AAGTAGAAGAGGCAGTAAGAAGG + Intronic
1118667720 14:68088471-68088493 AGGAAGAAGATGAAAAAAGAGGG - Intronic
1119112873 14:71991337-71991359 ATGTGGAAGATGAGGAGAGAGGG - Intronic
1119739206 14:77003230-77003252 ATGTAGGAGATGATGGAATTGGG - Intergenic
1120223489 14:81763426-81763448 ATGTCAGATATGAAGGAAGATGG - Intergenic
1120522554 14:85541524-85541546 AAGTAGAAAATGGAGGAAAATGG + Intronic
1120845310 14:89119962-89119984 TGGTAGAAGATGCAGCAAGATGG + Intergenic
1120860527 14:89251206-89251228 ATGTAGGATATGTGGGAAGAAGG - Intronic
1120904546 14:89608992-89609014 CTGTACAACATGGAGGAAGAAGG + Intronic
1121067200 14:90979286-90979308 AGGAAGAAGTGGAAGGAAGAGGG + Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121878621 14:97478741-97478763 ATGTAGAATAGGAAAGAAAAGGG + Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122756811 14:103987376-103987398 ATTTGGAAGATGAATGAACAAGG - Intronic
1124049340 15:26180432-26180454 ATGGAGTTGATAAAGGAAGAAGG + Intergenic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1125341622 15:38681420-38681442 AGGAAGAGGAAGAAGGAAGAAGG - Intergenic
1125684668 15:41556849-41556871 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1126309807 15:47302704-47302726 GATTTGAAGATGAAGGAAGAAGG + Intronic
1126567419 15:50114552-50114574 AGTGAGAAGAGGAAGGAAGATGG - Intronic
1126657731 15:50998010-50998032 AAGTAGAAGATTAAGGAGTAAGG + Intronic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1127052080 15:55094962-55094984 ATGAAGAAGATGAAGAGGGAGGG - Intergenic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127357354 15:58213224-58213246 ATGTACAAAATGAGGGGAGAGGG - Intronic
1127628715 15:60805401-60805423 ATGTAGGAAATGCAGGGAGAAGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095707 15:64953287-64953309 AAGTAAAAGAAGAAGAAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128341409 15:66825039-66825061 ATCTTGAACAAGAAGGAAGAAGG + Intergenic
1128754568 15:70172611-70172633 ATGGAAAAAATGGAGGAAGAAGG + Intergenic
1129007908 15:72389841-72389863 ATGAAGCAGATGCAGGAAAAGGG - Intergenic
1129180959 15:73875263-73875285 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1129818669 15:78579807-78579829 ATGAAGAAAATGCAGCAAGAAGG - Intronic
1129944280 15:79525494-79525516 AGGAAGGAGATGAAGGAAGAAGG + Intergenic
1130118934 15:81030030-81030052 ATATAAAAGATGGAGGAAGCAGG + Intronic
1130949086 15:88571513-88571535 AAGTTGAAGAGGTAGGAAGAGGG + Intergenic
1131066390 15:89437263-89437285 AGGTAGAAGAAGGAGGAAGAGGG - Intergenic
1131110165 15:89759952-89759974 ATAAAGAAGAAGAAGAAAGATGG + Intergenic
1131302456 15:91211438-91211460 AGGAAGAAGATGGAAGAAGAAGG - Intronic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1131901045 15:97088304-97088326 ATGTAGACAATGAAGGCATAGGG + Intergenic
1131925708 15:97381390-97381412 ATATGGAAGTTGAAGGAACATGG + Intergenic
1131981267 15:97997062-97997084 ATGCAGAAAATAAAGAAAGATGG + Intergenic
1132014759 15:98305730-98305752 AAACAGAAGAGGAAGGAAGAGGG + Intergenic
1132734851 16:1380137-1380159 AAGTGTAAGATGAAGGAAAATGG + Intronic
1133314015 16:4870897-4870919 AGGAAGAAGATGAAGAAAAAGGG + Exonic
1133433166 16:5756197-5756219 ATGTGGAAGATGTAAGAAGGGGG - Intergenic
1133460690 16:5984021-5984043 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1133483189 16:6191992-6192014 ATCTAGTAGATTGAGGAAGAAGG + Intronic
1133826786 16:9285001-9285023 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1133876917 16:9743704-9743726 ATGTAGAAGAAGATGAGAGATGG + Intergenic
1134021184 16:10922619-10922641 ATGAAGAAGCTGAAGCCAGAGGG - Intronic
1134060021 16:11193775-11193797 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1134788955 16:16971160-16971182 ATCTAGAAACTGAAGGAAGATGG - Intergenic
1135232054 16:20717812-20717834 AAGAAGAAGAGGAAGGAAGAAGG + Intronic
1135335348 16:21597119-21597141 TTCTAGTAGATGAAGGAAGGGGG + Intergenic
1136998966 16:35212350-35212372 ATGTATCAGATGGATGAAGATGG + Intergenic
1137819414 16:51429443-51429465 ATTTAGAAGATGAGAGAAGATGG + Intergenic
1138204130 16:55112347-55112369 AAGTAGAAGATGTAGGTAAAAGG + Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138582083 16:57948296-57948318 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1138887651 16:61098901-61098923 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1139459640 16:67111276-67111298 ATGGAGAGGGTGAAGGGAGAAGG - Intronic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1141371036 16:83486575-83486597 ATGTAGAACATGTTGGGAGATGG - Exonic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141863092 16:86731338-86731360 ATATAGAAGATGATGGAATGTGG + Intergenic
1142561299 17:811087-811109 AAGCAGAAGAGGAAGAAAGAAGG + Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143304673 17:5936966-5936988 ATTTAAAAGATGAAAGAAAATGG + Intronic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1143794703 17:9327301-9327323 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1143864702 17:9915742-9915764 ATGGGAAAGATGAAGAAAGATGG + Exonic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1144171536 17:12664126-12664148 ATGTAGAAGAGGGAAGCAGAAGG + Intergenic
1144233317 17:13231115-13231137 ATGAAGAGGGTGCAGGAAGAAGG - Intergenic
1145892270 17:28425580-28425602 ATTCTGAAGATGAAGGAAGCCGG + Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1148188380 17:45661159-45661181 ATATAGAAGATGAAACCAGAGGG - Intergenic
1148221828 17:45868399-45868421 AGGTAGGAGATGAAGTAATAGGG - Intergenic
1148517195 17:48230990-48231012 ATACAGATGATGAAGAAAGAAGG + Intronic
1148668902 17:49395485-49395507 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1149797902 17:59538387-59538409 AGGAAGAGGAAGAAGGAAGAAGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150179595 17:63102751-63102773 ATGTAGAGAATGAAGTATGAGGG + Intronic
1150293046 17:63992906-63992928 ATGTAGGAGGGGAAGGAAGGAGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150855051 17:68744740-68744762 ATGTATGAGATGAAAGAAAAGGG - Intergenic
1150873145 17:68937710-68937732 GTGTTGAAGATGAATGTAGAGGG + Intronic
1150919593 17:69469254-69469276 AAGTGGAAGAGGAAGGTAGAGGG - Intronic
1151030955 17:70738602-70738624 ATGAAGAAGATGAGGGAATGGGG - Intergenic
1151116990 17:71747553-71747575 ATGAAAAAGAGAAAGGAAGAAGG + Intergenic
1151345264 17:73497573-73497595 ATGCAGGAGAGGGAGGAAGATGG - Intronic
1151359107 17:73577934-73577956 ATGCAGAAGAGGACGGCAGAAGG + Intronic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1152053894 17:78006602-78006624 AGAAAGAAGAAGAAGGAAGAAGG - Intronic
1152084062 17:78206652-78206674 AGAAAGAAGATGAAGGAGGAAGG - Intronic
1152412793 17:80137690-80137712 ATGGAGAAAATGAAGTAAGAGGG - Intronic
1152499767 17:80700063-80700085 ATGGAGAAAAGGTAGGAAGAAGG + Intronic
1152984707 18:311213-311235 ATGGAGAATATGGAGGAAGGGGG + Intergenic
1153210085 18:2753073-2753095 ATGCACAACAGGAAGGAAGACGG - Intronic
1153292922 18:3519469-3519491 TTGTTGAAGATGAGGGAATAGGG - Intronic
1153709722 18:7785165-7785187 GTGAAGGATATGAAGGAAGAGGG + Intronic
1153827774 18:8892396-8892418 GTGTGGAAGATGTAGGAAGTAGG + Intergenic
1153902229 18:9627865-9627887 ATGCTGAAGATGAAGAAAGGAGG - Intergenic
1154162470 18:11990434-11990456 ATAGAGAAGATGAAAGCAGAAGG + Intronic
1155878089 18:31111703-31111725 ATGTAGAGGAGGGAGGCAGACGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156306655 18:35884161-35884183 AGGTGGAAGATAAAGGAATAGGG - Intergenic
1156384792 18:36595283-36595305 ATGGAGGAGAGGAAGGGAGAAGG - Intronic
1156634488 18:39011127-39011149 ATGCAGAAGAGGAAGGATCAAGG - Intergenic
1157007360 18:43599583-43599605 ATACAGAAAAAGAAGGAAGAAGG + Intergenic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157967574 18:52225423-52225445 ATGGAGGAGAGGAAGGAAAAAGG - Intergenic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158209056 18:55025798-55025820 GTGAAGAAGATGAAGGAGAAGGG - Intergenic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158767189 18:60466426-60466448 ATATAAAAAATGATGGAAGATGG - Intergenic
1159354395 18:67318926-67318948 ATGTAGGACATGGAGAAAGATGG - Intergenic
1159408801 18:68042412-68042434 ATGTAGCAAATGAAGGAGGCTGG + Intergenic
1159725124 18:71947964-71947986 AAGGAAAAGAGGAAGGAAGAGGG + Intergenic
1159746314 18:72240237-72240259 TTGAAGAAGATGAATGAAGTTGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1160275852 18:77434809-77434831 AGGAAGATGATGAAGGATGAAGG - Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1161601901 19:5189212-5189234 GTGCAGAAGATGAACGTAGATGG - Intronic
1161647591 19:5463400-5463422 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1161934344 19:7362304-7362326 AGGAGGAAGAAGAAGGAAGAAGG + Intronic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162221959 19:9185041-9185063 ATGAAGAAGATGTAGGATAATGG + Intergenic
1162844725 19:13383366-13383388 ATGGGGAAGATGGAGGAAGAAGG + Intronic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1163850223 19:19658678-19658700 TTGGTGAAGATGAAGGGAGAGGG + Intronic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164718720 19:30415366-30415388 AAGAAGGAGAAGAAGGAAGAAGG - Intronic
1165341180 19:35213324-35213346 ATATCAAAGAAGAAGGAAGAGGG + Intergenic
1165603690 19:37080251-37080273 ATTAAGAGGATGGAGGAAGAGGG + Intronic
1166167765 19:41004247-41004269 TTGTAGAAGAAGTTGGAAGAAGG - Intronic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1166900141 19:46054835-46054857 AGTTGGAAGATAAAGGAAGATGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168472475 19:56650734-56650756 ACGTAAAAGGTGAAGGAACAGGG + Intronic
1202712286 1_KI270714v1_random:25141-25163 ATGTAGAAGAGGAAGGACCCGGG + Intergenic
925712891 2:6758669-6758691 ATGTGGAAGAGGGAGGCAGAGGG + Intergenic
926304439 2:11627922-11627944 ATTAATAAGATGAAGGGAGAGGG + Intronic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
926611542 2:14952968-14952990 AGGTAGAGGATGAAGGTAGATGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927863222 2:26573423-26573445 ATATTAAAGATGACGGAAGAAGG + Intronic
928400573 2:30975277-30975299 ATGTCGATGATGAAGCAAGAGGG + Intronic
928588749 2:32791371-32791393 ATGTGGAAGAGGAAGGAAAGGGG + Intronic
929098213 2:38284158-38284180 ATGTAGAAAATGAAGTTGGAAGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929795855 2:45058038-45058060 AGGTTGAAGTTGAGGGAAGAGGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
930203296 2:48564683-48564705 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930511389 2:52349727-52349749 GTGGAGGAGAGGAAGGAAGAAGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930775355 2:55165350-55165372 ATGAAGAAGACGAGGAAAGAGGG + Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932889285 2:75577928-75577950 AGGTAGAAGGTGAATGAAGTTGG + Intergenic
932938189 2:76131030-76131052 ATGAACAAGATGAGAGAAGATGG - Intergenic
933539017 2:83615533-83615555 ATGAAGAAGATAAAGAAAGGAGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
935248155 2:101237253-101237275 AGGAAAAAGAAGAAGGAAGAAGG + Intronic
935544759 2:104389124-104389146 ATGGAGAAGATGAAGAGAAAAGG + Intergenic
935886302 2:107623426-107623448 GTTTTGAAGATAAAGGAAGAGGG + Intergenic
935901568 2:107798763-107798785 ATGGGGAGGATGAAGGAAGCTGG + Intergenic
936756933 2:115725480-115725502 ATGTAGAAGAACAAGCAATATGG - Intronic
936922195 2:117700215-117700237 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
936990921 2:118365182-118365204 ATGTAGAAGTTAATGAAAGAAGG - Intergenic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937499373 2:122461834-122461856 ATGGAGAAAATTAAGGCAGACGG + Intergenic
937992357 2:127671733-127671755 AAGTAGAAGAAAAAGGAAGGAGG + Intronic
939025411 2:137007529-137007551 AAGTACAAGCTGATGGAAGATGG + Intronic
940517523 2:154699166-154699188 ATGAAGAAGAGGAAGGCAGAAGG - Exonic
940556348 2:155233362-155233384 ATGTATAATATGAATGCAGAAGG - Intergenic
941110269 2:161414073-161414095 AAGTTGAAGATGGAGAAAGAAGG + Intergenic
941118701 2:161503522-161503544 ATTTAGAAGATGCAGAAACAAGG - Intronic
941146634 2:161854990-161855012 ATGTGGAAGATGGAGGAGAAAGG + Exonic
941735143 2:168965959-168965981 ATGTGCAAGAGCAAGGAAGAGGG - Intronic
941821654 2:169849872-169849894 ATGCAGGAGAGGAAGGAAGCAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943084237 2:183293646-183293668 TGGTAGAAGAGGAAGAAAGAGGG + Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943728276 2:191274571-191274593 ATTTGGCAGATGAGGGAAGAAGG - Intronic
943902450 2:193457491-193457513 ATCTAGAACCTCAAGGAAGACGG + Intergenic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
944504993 2:200402024-200402046 ATGGGGAAGATGAAGGCACATGG - Intronic
944884079 2:204044706-204044728 ATGGAGAGGATGAGGGAAAAAGG + Intergenic
945230954 2:207589312-207589334 ATGTTGAAGATGGAGAAAGGGGG - Intronic
945581761 2:211603378-211603400 ATATAGAATATAAAGGAAAAAGG + Intronic
945779318 2:214148457-214148479 ATGTAGTGGAACAAGGAAGAAGG - Intronic
946040564 2:216779946-216779968 AAGTAGATTATGAAGGAAGAGGG + Intergenic
946162376 2:217843371-217843393 ATGTAGAAGAGGAGGGGAGTAGG - Intronic
946429846 2:219619702-219619724 ATGCAGTAGATGAGGGAACAAGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946808067 2:223492164-223492186 ATGCAGAAGAGGGAGGCAGAGGG - Intergenic
946992530 2:225351420-225351442 ATGTAGGAAATGAAGAAAAATGG + Intergenic
947105411 2:226663356-226663378 GTTTATAAGATGAAGAAAGAAGG - Intergenic
947343044 2:229159996-229160018 AGGAACAGGATGAAGGAAGAGGG + Intronic
947544069 2:230998585-230998607 ATGTTGGAGATGAAGGATGAGGG + Intronic
947578562 2:231296240-231296262 ATGAAGATGATGAAGTAAGTTGG + Exonic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1168759064 20:336373-336395 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169056928 20:2630116-2630138 ATTTAGAAGAAGAAGGAATTAGG + Intronic
1169151701 20:3294661-3294683 GTGTATATGCTGAAGGAAGATGG - Intronic
1169270340 20:4194477-4194499 ATGTGGAATATGAAAGAAAAAGG - Intergenic
1169451198 20:5713039-5713061 ATCTAGAGGATAATGGAAGAAGG - Intergenic
1169530389 20:6478788-6478810 ATTTAGATGATGAAGGGAAATGG - Intergenic
1169689580 20:8315591-8315613 ATGTATAAAATGAGGGAGGAAGG + Intronic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1169924942 20:10773342-10773364 ATGCAAAAGATGAGGAAAGAGGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173321636 20:41992519-41992541 ATCTGGAAGATGCAGCAAGAAGG - Intergenic
1173433834 20:43015275-43015297 ATGTGGAAGGTGAAGCAAGGAGG - Intronic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1173904007 20:46612870-46612892 ATGCAGAGGATGTGGGAAGATGG - Intronic
1174506183 20:51019112-51019134 ATGTTGACGATGGAGGCAGAGGG + Intronic
1175146917 20:56904034-56904056 AGGAAGAAGATGGAGGTAGAAGG - Intergenic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177103495 21:16924739-16924761 ATGTACAAGATGAAGAAAAGAGG + Intergenic
1177207380 21:18025793-18025815 CCGTGGAAGATGAAGGGAGAAGG - Intronic
1177707339 21:24724365-24724387 ATGTAGAAGATGGAGTTAAATGG + Intergenic
1177844175 21:26269314-26269336 ATGTAGGAGATGGAGGAAAGGGG + Intergenic
1177963362 21:27696877-27696899 ATGAAGAAGATGAAGGAGTTAGG + Intergenic
1178181568 21:30167966-30167988 ATGTAAAAGAAAAAGGAAAAGGG - Intergenic
1178313681 21:31551776-31551798 ATGTGGAGAATGAAGGAAGTAGG + Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179244837 21:39623932-39623954 ATGTAGCAGATACATGAAGAGGG - Intronic
1179334850 21:40441100-40441122 ACATAGAATATGAAGGAAAAGGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181917374 22:26292067-26292089 AGGAAGAAAATGAAGGAGGAAGG + Intronic
1182011213 22:27002211-27002233 ACTTAGAAGAGAAAGGAAGAAGG + Intergenic
1182040845 22:27237863-27237885 ATGTAGAATTTGAGGGGAGAGGG + Intergenic
1182360729 22:29744945-29744967 ATCTGGGAGATGAAGCAAGAAGG - Intronic
1182510023 22:30812588-30812610 ATGTAAAAGATGCACGTAGAGGG - Intronic
1182755894 22:32678604-32678626 AGGAAGAAGAGGAAGAAAGAAGG - Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1183980262 22:41535528-41535550 ATCAAGAAGAGGAAGGAAGCTGG + Intronic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
949436668 3:4037300-4037322 CTATAGAAGTTGAAGGAAGGAGG - Intronic
949929457 3:9067284-9067306 ATTTTTAGGATGAAGGAAGAAGG - Intronic
950012895 3:9735733-9735755 AGGTAAAAGATGAAGGGATATGG + Intronic
950170060 3:10832847-10832869 TTGTAGAAAATGTAGGAAGTAGG + Intronic
950417011 3:12874534-12874556 ACCTAGAAGAGGAATGAAGATGG - Intergenic
950732837 3:14977165-14977187 AAGTAGAAGCTGGAGGCAGATGG - Intronic
950940813 3:16889386-16889408 ATGTAGGAGATATTGGAAGAAGG + Intronic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951093924 3:18606638-18606660 AGGTGGCAGATTAAGGAAGAAGG - Intergenic
951099352 3:18668760-18668782 ATTTTGAAGATGAGGGGAGAGGG - Intergenic
951099366 3:18668848-18668870 AAGTGGAAGAGGAAGGCAGAAGG - Intergenic
951208806 3:19951912-19951934 AAGAAAAAGATGAAAGAAGAAGG + Intronic
951395382 3:22159073-22159095 AGGTAAAAGATGAAGAAACAAGG + Intronic
951721464 3:25702953-25702975 ATGTAGAATATATTGGAAGAAGG + Intergenic
951764559 3:26183274-26183296 ATGTAAAAGATGATGGGAGTTGG - Intergenic
952769395 3:36984028-36984050 AAGTAGAAGATGAACGCAGGAGG + Intergenic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
953550961 3:43902441-43902463 ATTAAGTAGATCAAGGAAGAGGG - Intergenic
953643527 3:44731417-44731439 ATCTAGAAGGTGTAGGAAGTAGG + Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954945995 3:54424839-54424861 ATGCAGACGATGCAGGAATATGG - Intronic
955070463 3:55568517-55568539 ATGTGGAACATGAAGGAAAGAGG - Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
955459323 3:59163402-59163424 ATTTTGAAGATGAAGAAACAGGG - Intergenic
955869668 3:63424172-63424194 ATGTCGAAAATAAAGGAAGCTGG + Intronic
955897061 3:63711694-63711716 ATGTGAAAGATGAAGACAGAAGG - Intergenic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956705730 3:71997442-71997464 ATGAAGAAGAAGAAGAAAGGAGG + Intergenic
957156893 3:76555403-76555425 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957541128 3:81570462-81570484 AGGGAGAAGATGAAGGTTGATGG + Intronic
957932881 3:86904831-86904853 ATGGAAAAAACGAAGGAAGAAGG + Intergenic
958028895 3:88083051-88083073 AGGAAGAAGAGGGAGGAAGAGGG - Intronic
958255887 3:91324414-91324436 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
958620422 3:96551367-96551389 ATGTAGAAGATGCTAGAAGTTGG - Intergenic
958735093 3:97999889-97999911 GTGGAGAAGGTGAAGGAAGGAGG + Intronic
958769369 3:98407988-98408010 ATGAATGAAATGAAGGAAGAAGG + Intergenic
958965947 3:100558398-100558420 TTGTAGAAGATAAAGGCTGATGG - Exonic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959282209 3:104358696-104358718 AGGAAGAACATAAAGGAAGAAGG - Intergenic
959317798 3:104831080-104831102 ATGAACAAGATGAAGAAGGAAGG + Intergenic
959767886 3:110054828-110054850 ATGTAGAAAAGGAAGAGAGATGG + Intergenic
959931154 3:111984417-111984439 GTAAAGAAGATGATGGAAGAAGG + Intronic
960184603 3:114623494-114623516 ATGCAGAAGAATAAAGAAGAGGG + Intronic
960418018 3:117409178-117409200 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
960520385 3:118647667-118647689 AGGTAGAAGAGGAAGAAAGGGGG + Intergenic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
961575440 3:127832135-127832157 TTGTGAAACATGAAGGAAGAAGG + Intergenic
961599239 3:128046345-128046367 ATTTGGAAGATGAAAGAAAAGGG - Intergenic
961817330 3:129557914-129557936 AGGTTGAAGATGAAAGAGGATGG - Intronic
962125895 3:132617398-132617420 ATTGAAAAGATGAAGGAAGGAGG - Intronic
962148015 3:132861615-132861637 ATGGAGAAGAGTAAGGCAGAAGG + Intergenic
962262282 3:133919534-133919556 AGGTAGGAGATGAAGGAAATAGG - Intergenic
962390009 3:134963181-134963203 GTACAGAAGAAGAAGGAAGAAGG - Intronic
962410881 3:135140938-135140960 ATGTGAAAGATGGAGGAAAAAGG + Intronic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
964028306 3:152105038-152105060 ATGGAAAAGAGGAAGGAAAAGGG - Intergenic
964514213 3:157489595-157489617 ATGTAGAAAATTAACGCAGAGGG - Intronic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964696685 3:159516081-159516103 ATGTTTAAGATCCAGGAAGAAGG - Intronic
964708474 3:159646473-159646495 AAGGAGAGGATGAAGGAAGGAGG - Intronic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965190284 3:165519123-165519145 GTGTGGAAAATGATGGAAGATGG - Intergenic
965346148 3:167553259-167553281 ACGGAAAACATGAAGGAAGATGG + Intronic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
966075686 3:175934696-175934718 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
966222281 3:177562764-177562786 ATGTAGAAGATGAGGGAGGGGGG + Intergenic
966240288 3:177748172-177748194 AAGTAGAAGATGCAGCAGGATGG + Intergenic
966472484 3:180306824-180306846 ATGCAGAGGAAGAAGAAAGAGGG - Intergenic
966656201 3:182361243-182361265 AGTGAAAAGATGAAGGAAGAGGG - Intergenic
968330025 3:197860288-197860310 ATTTAGAAGTTGAAGGAGGTTGG - Intronic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
969253105 4:5982866-5982888 ATGAAGAAGGTGAAGAATGAGGG + Intronic
969383809 4:6828759-6828781 AAGTAGAAGATGAAGAAAAGTGG - Intronic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970027996 4:11644376-11644398 ATGAAAAAGAAGAAGAAAGAAGG - Intergenic
970116651 4:12704516-12704538 AAATAGAAGAGCAAGGAAGAAGG + Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970420349 4:15900118-15900140 AGGAAGAAAATGAATGAAGAAGG - Intergenic
970477256 4:16436186-16436208 ATATAGAAGATGGAAGAACAAGG - Intergenic
970696949 4:18689383-18689405 ACGGAGAAATTGAAGGAAGAGGG - Intergenic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971303382 4:25460480-25460502 ATGTAGAAAATGAAAAAGGAGGG - Intergenic
971443388 4:26715284-26715306 ATGTGGAAGTTGAAGGTAGAAGG - Intronic
971473939 4:27055190-27055212 ATTTAGCAGGTGAAGGCAGATGG + Intergenic
971572000 4:28224846-28224868 ATTTAGAAAATGAAGGAGAATGG - Intergenic
971852653 4:32003102-32003124 ATATAGAAGCTTTAGGAAGAGGG + Intergenic
972239611 4:37175862-37175884 ATGTAGAAGGTGAAGAAACATGG - Intergenic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972601676 4:40578524-40578546 AAGTAGAAAATGGAGGCAGAGGG - Intronic
972840060 4:42920208-42920230 AGGTGAAGGATGAAGGAAGAGGG + Intronic
973637764 4:52875661-52875683 AAGTAGAAGAGGAAGAGAGAAGG + Intronic
973956319 4:56066891-56066913 GTCTAGAAGAGGAAAGAAGATGG + Intergenic
974387609 4:61223034-61223056 ATTTAGAAGATGAAGATTGAAGG + Intronic
974529024 4:63082714-63082736 ATGTCCAACATGAAGAAAGAAGG + Intergenic
974792260 4:66707382-66707404 ATTTTGAAGATGGAAGAAGAAGG - Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975257091 4:72250157-72250179 AAGTAGAAGAGGAGGAAAGAAGG - Intergenic
975259551 4:72280712-72280734 ATGAAGAAGATGAGGAAAGATGG - Intergenic
975273486 4:72466265-72466287 ATGTAGAAGAAGAGGCTAGAGGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976247099 4:83015252-83015274 AGGTATAATATAAAGGAAGAAGG + Intergenic
976400708 4:84603449-84603471 TTGTAGAAGAGGAAAGAACATGG + Intronic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
977664943 4:99635450-99635472 AAGTGGAAGATGAAAGTAGAGGG + Intergenic
978235815 4:106458543-106458565 AGGAAGAAGAAGGAGGAAGAAGG + Intergenic
978268538 4:106858987-106859009 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
978303648 4:107297839-107297861 TTGTAGAAGAAGAACAAAGATGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
979041283 4:115799922-115799944 TTGGATAAGATCAAGGAAGAAGG - Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979453077 4:120895556-120895578 ATGAAGAAGATGAGGGCAGAGGG - Intronic
979560688 4:122098205-122098227 ATGTAGAAGAAGCAGGGAGGAGG + Intergenic
979567585 4:122172903-122172925 ATGAAGAAGAGGAAGAAAGCTGG + Intronic
979712994 4:123802847-123802869 GGGAAGAAGAGGAAGGAAGACGG - Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980476192 4:133320573-133320595 ATGTAGAACATTAAGGAAGAAGG - Intergenic
980810891 4:137877846-137877868 AGGATGAAGAAGAAGGAAGATGG + Intergenic
980948892 4:139351894-139351916 ATGAACAAGATGAAAGAAAATGG - Intronic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981408671 4:144401880-144401902 ATGAAGATAATGAAGGAAAAGGG + Intergenic
981818521 4:148859221-148859243 ATGTTGAAAATGAATGATGATGG + Intergenic
981927502 4:150155888-150155910 ATGTAAAGCAGGAAGGAAGAAGG + Intronic
982068895 4:151677944-151677966 ATGAACATCATGAAGGAAGAAGG - Intronic
982460201 4:155660448-155660470 TTGTAGAAAAGGAGGGAAGAAGG - Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
983347460 4:166545214-166545236 ATTTAAAATATAAAGGAAGATGG + Intergenic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
984042516 4:174752951-174752973 ATGGAGAACATGAAGAAACATGG - Intronic
984731070 4:183068808-183068830 ATGCAGGAAATGAAGGAAAATGG + Intergenic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
985210099 4:187583462-187583484 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
985382936 4:189414292-189414314 GTCTAAAAGAGGAAGGAAGAAGG + Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986643376 5:9893156-9893178 TTGTAGGGGAAGAAGGAAGAAGG - Intergenic
986674272 5:10169352-10169374 ATGTGGAAAATGAGGAAAGAGGG - Intergenic
987237618 5:15958760-15958782 ATGTACAAGATGAGGAAACAAGG - Intergenic
988379204 5:30478784-30478806 ATAGAAAAGATGAAGGGAGAGGG - Intergenic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
988683761 5:33507870-33507892 ATGTAGAAGAAGAGAGAAGGAGG - Intergenic
988976123 5:36517264-36517286 ATGTAGAAAAAGAAGTAAGATGG - Intergenic
989125716 5:38050701-38050723 ATGCAGAAGAGGAAGGCAGAAGG + Intergenic
989352988 5:40508997-40509019 ATGAAGAAGAAGAAGAAAAAAGG - Intergenic
989354515 5:40528420-40528442 TAGTAGAGGAGGAAGGAAGATGG - Intergenic
989556850 5:42807174-42807196 ACATAGAAAATTAAGGAAGAGGG - Intronic
990031709 5:51268802-51268824 ATGCAGAATATGAAGAAAGTTGG - Intergenic
990802176 5:59617207-59617229 AGGTTGAAGATGGAGGACGATGG - Intronic
990839169 5:60056369-60056391 ATGTGAATGATGAAGGAAGACGG + Intronic
991012525 5:61898959-61898981 ATGGAGGAAATGAAGGTAGAGGG + Intergenic
991055531 5:62315633-62315655 ATGAAGAAGATAAGGGAGGAGGG + Intronic
991094479 5:62724919-62724941 AGGTAGAAGATGGTGGGAGATGG - Intergenic
991186154 5:63810617-63810639 ATCTGGAAGGTGAAGGAACATGG - Intergenic
991286044 5:64977217-64977239 AAGTAGAAGATGATGAAGGATGG + Exonic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992655041 5:78900728-78900750 ACTTTGAAGGTGAAGGAAGAGGG - Intronic
993174502 5:84466163-84466185 ATGGAGCAGATAAAGGAAGGTGG + Intergenic
993410813 5:87571147-87571169 CTCTAGAAGATGAAAGGAGATGG + Intergenic
993558963 5:89379641-89379663 ATGTATGAGATGAAGACAGAGGG + Intergenic
993698861 5:91094669-91094691 ATGCAGCATATGAAGGAAAATGG + Intronic
994127407 5:96183799-96183821 ATCTAGAAGATTAAAGAACAAGG - Intergenic
994203074 5:97000973-97000995 AAGTAGTAGATGAAGTTAGAGGG + Intronic
994255304 5:97586654-97586676 ATGTAGAAGAACAAAGAAGTTGG + Intergenic
994820503 5:104644782-104644804 AAGTATAAGATGAAGAAAGAGGG - Intergenic
995006272 5:107199769-107199791 ATATATAAAAGGAAGGAAGAGGG + Intergenic
995638763 5:114228020-114228042 ATGATGATGATGAAAGAAGAAGG + Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996177336 5:120375491-120375513 ATGGAAAAAATGAAGCAAGAAGG + Intergenic
996318528 5:122188399-122188421 AAGTAGAAGAAGAAGGCAAAGGG + Intergenic
996417822 5:123229178-123229200 ATGTTGAAGGTTAGGGAAGATGG - Intergenic
996485432 5:124028063-124028085 AAGTAGAAGTTGATGGAAGTGGG - Intergenic
996624149 5:125549660-125549682 ATGTAGAAGAGGTAGAAGGAGGG - Intergenic
996760756 5:126983860-126983882 ATGAAAAAGATGAAGGAAGCTGG - Intronic
997024668 5:130044682-130044704 ATAAAGAAGATGAAGGAGGCGGG + Intronic
997789762 5:136747924-136747946 AAATAGAAGAGGAAGGCAGATGG + Intergenic
997844185 5:137271082-137271104 ATGTCCAGGATGAAGGAGGAGGG + Intronic
998249351 5:140540818-140540840 ATATAGAAGATTAAAGAAGCAGG - Intronic
998628087 5:143868307-143868329 ATATGGAAGATGAAGGAGTAGGG + Intergenic
998651995 5:144131190-144131212 CTTTGGAAAATGAAGGAAGAAGG + Intergenic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999471290 5:151857425-151857447 ATGCAGAAGAGTAAGGAACAGGG - Intronic
999564046 5:152837980-152838002 CTGTAGAAGATGAATAATGAGGG + Intergenic
999833774 5:155347183-155347205 ATGCAGAAGATGGAGGGCGAGGG - Intergenic
999837261 5:155387920-155387942 ATGCAAAAGATTAAGTAAGATGG + Intergenic
1000378956 5:160611762-160611784 ATGGAGAAAACGAAAGAAGACGG - Intronic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1002811315 6:632528-632550 ATGGATAAAATGAAGGAAAAGGG + Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003099232 6:3164409-3164431 AAGAAGGAGATTAAGGAAGATGG + Intergenic
1003347709 6:5286066-5286088 ATTTAGAAGATGAGCGAAAAAGG - Intronic
1003514172 6:6804541-6804563 ATGCAAAAGAAGAAGGGAGAGGG - Intergenic
1003713009 6:8614462-8614484 CTGTTGAAGATGGAGGAAGGTGG + Intergenic
1003781021 6:9426896-9426918 GTGATGAAGATGAAGTAAGATGG + Intergenic
1003953713 6:11142882-11142904 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1004126701 6:12881228-12881250 ATGGTGAATATTAAGGAAGAGGG + Intronic
1004535496 6:16496896-16496918 ATCTGCAAGATGAAGGAGGAGGG - Intronic
1004569088 6:16827542-16827564 ATTTAGAAGGTAGAGGAAGAGGG + Intergenic
1004927904 6:20433123-20433145 ATGAAGAACTTGAAGGAAGCTGG + Intronic
1005356988 6:24994571-24994593 CTGTAGAAGAGCAAAGAAGAAGG + Intronic
1005527658 6:26666954-26666976 GTTTTGAAGATGAAAGAAGAGGG - Intergenic
1006204728 6:32330539-32330561 CTGTAGAAGATCAAGGAACCTGG + Intronic
1006257162 6:32841026-32841048 GTGTACCACATGAAGGAAGATGG - Exonic
1006607362 6:35267792-35267814 ATGTCAAAGATGAGGCAAGATGG + Intronic
1006763959 6:36488413-36488435 ATGGAGAACAGGAGGGAAGATGG - Exonic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007511203 6:42375629-42375651 ACGAAGAACATGAAGGAGGAAGG + Intronic
1007724132 6:43904275-43904297 CTGTAGAAGAACAAGAAAGAAGG - Intergenic
1007994240 6:46289169-46289191 ATGTAGGAGAGGAAGGAAGTTGG - Intronic
1008551041 6:52631018-52631040 ATGGAGAATATGAGGGAATACGG - Intergenic
1008874965 6:56315650-56315672 AGGGAGAGGAGGAAGGAAGAGGG - Intronic
1008931570 6:56945879-56945901 AGGTAAAGGATGAAGGAAGGAGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009339570 6:62537085-62537107 ATAAAGAAGAGGAAGTAAGAAGG - Intergenic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009498243 6:64376991-64377013 ATGCATAAGATCCAGGAAGATGG + Intronic
1009502490 6:64432732-64432754 AGGTAGAACATTAAGGTAGAAGG - Intronic
1009557273 6:65188776-65188798 AAAAAAAAGATGAAGGAAGAGGG + Intronic
1009738453 6:67710434-67710456 ATTCTGAAGATGGAGGAAGAGGG - Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010186677 6:73152331-73152353 AGGTAGAAAATGAAAGAGGAAGG - Intronic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011568061 6:88701143-88701165 AAGAAGAAGAAGAAGGTAGATGG + Intronic
1011962623 6:93109935-93109957 ATGTAGGAGTTAAAGGAACAGGG - Intergenic
1012043831 6:94243622-94243644 ATGTAGAAGATAAATAAAGGTGG - Intergenic
1012089410 6:94873009-94873031 ATGAATAAAATGAAGCAAGAAGG - Intergenic
1012090357 6:94886134-94886156 ATTTAGAAGATAAAAGCAGAGGG - Intergenic
1013175859 6:107675827-107675849 ATGTAGGAGGTGTATGAAGACGG + Intergenic
1013412160 6:109892031-109892053 ATGTACATGATGTAAGAAGAAGG - Intergenic
1013754172 6:113441574-113441596 GTTTTGAAGACGAAGGAAGAGGG - Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014105228 6:117553436-117553458 AAGAAGAAGATAAAGGAAAAAGG - Intronic
1014229699 6:118889555-118889577 TTATAAAACATGAAGGAAGATGG + Intronic
1014450257 6:121573594-121573616 AAGTTGGAGATAAAGGAAGAAGG + Intergenic
1014777743 6:125529814-125529836 ATGAAGAAGATGAAGTCTGAAGG - Intergenic
1014886296 6:126785407-126785429 ATGAAGAGTAGGAAGGAAGAAGG - Intergenic
1015018487 6:128443310-128443332 AAGAAGGAGATGAGGGAAGAGGG + Intronic
1015036325 6:128659386-128659408 ATATAGAAGAGGAAGGCAGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015326981 6:131934176-131934198 ATGTACAAGAGGAAGGAGGTGGG + Intergenic
1015428093 6:133096026-133096048 AAGTACAAGATGAAGGGAGGTGG - Intergenic
1015478025 6:133675319-133675341 AAGGAGGAAATGAAGGAAGAAGG + Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015866686 6:137734175-137734197 AGGTAGCAGATGTAGGAAGAAGG - Intergenic
1016089884 6:139963761-139963783 ATGTGGAAGATGAGGAAAAAGGG - Intergenic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1016927598 6:149367471-149367493 GGGTAGAAGATGAAGTTAGAGGG + Intronic
1017281582 6:152631609-152631631 AGGTAGAAGATGACCAAAGACGG + Intronic
1017647926 6:156556159-156556181 ATGCAGGGGATGAAGGGAGAGGG - Intergenic
1018238915 6:161753609-161753631 ATGTAGGAGATGAAGCAGGGAGG + Intronic
1018451323 6:163910847-163910869 AGGAAGAAGAGGAAGAAAGAAGG - Intergenic
1018451325 6:163910867-163910889 AAGATGAAGATGAAGAAAGAAGG - Intergenic
1018517820 6:164606212-164606234 GATTAGAAGATGAAGGAAGGGGG + Intergenic
1018778046 6:167036472-167036494 AGGTAGATGTTGGAGGAAGAGGG + Intronic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019476410 7:1246770-1246792 ATTTGGGAGAGGAAGGAAGATGG + Intergenic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019484077 7:1280492-1280514 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1019748726 7:2715365-2715387 TTGCAGAAGATGAAGGAAATCGG - Exonic
1019827976 7:3300283-3300305 ATGTAAGAGATGAACGCAGAGGG - Intergenic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020050324 7:5077024-5077046 AGGAAGAAAAGGAAGGAAGAAGG - Intergenic
1020462691 7:8442561-8442583 TTGTAGAAGACGAAGGAAAATGG - Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020661050 7:10982972-10982994 ATGATGAAGATGAGGGAAGCGGG + Exonic
1020769087 7:12365043-12365065 GTGCAAAAGATGAAGAAAGATGG + Intronic
1020951568 7:14685346-14685368 ATGCAGAACGTGAAGGATGATGG - Exonic
1020995728 7:15261607-15261629 ATCTAAAAGATAAAGAAAGAGGG + Intronic
1021022839 7:15625128-15625150 ATATAGTAGATGAAGGAACTAGG - Intronic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1023071268 7:36436592-36436614 ATGGAAAAGATGTAGGAAAATGG - Intronic
1023127011 7:36964713-36964735 ATGTGGAGGAGGAAGGAAGTAGG - Intronic
1023139993 7:37092224-37092246 ATATAGAAGATAAAGAAACAAGG + Intronic
1023214548 7:37847802-37847824 AGGAAGAAGAAGAAGAAAGAAGG + Intronic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1023637189 7:42224264-42224286 ATGTAGAAAAATAAGCAAGATGG - Intronic
1024032257 7:45471409-45471431 AGGAAGAAGAAGAAGAAAGAAGG + Intergenic
1024117088 7:46204793-46204815 AAGTAGAAGATGTAGGAACATGG - Intergenic
1025011923 7:55404307-55404329 ATTTAAAAGAAGAAGAAAGAAGG - Intronic
1025758285 7:64366833-64366855 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1025910589 7:65825438-65825460 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026044765 7:66899383-66899405 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026986320 7:74557230-74557252 ATCTAGCAGATGGAGGAGGATGG - Intronic
1027299651 7:76817952-76817974 ATTTAGAAGAAGAAATAAGAAGG + Intergenic
1027773488 7:82435700-82435722 ATGTAGAAGATGGATTAAGGCGG - Intronic
1027893539 7:84009799-84009821 AAGTAGAAGGGGAAGGAAGAAGG + Intronic
1028199527 7:87944893-87944915 AGGAAGAAGAAGAAGGAAGGAGG - Intronic
1028229484 7:88289296-88289318 ATGGAGAAGAGTAAGAAAGAAGG + Intronic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1028887275 7:95948094-95948116 ATTTAGCAGAGGAAGGAAGCAGG + Intronic
1029027026 7:97427697-97427719 ATGCAGTAGATGAAAGAAGTAGG + Intergenic
1029087027 7:98019788-98019810 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1029906814 7:104100991-104101013 AGGTAGAAGATGACAGAAGTGGG + Intergenic
1029930580 7:104366287-104366309 TTTGAGAAGATGGAGGAAGAGGG + Intronic
1030462405 7:109855904-109855926 AAGAAGAGGAAGAAGGAAGAAGG + Intergenic
1030476783 7:110044097-110044119 AGGGAGAAGATGGAGCAAGATGG - Intergenic
1030717508 7:112827360-112827382 ATTCAAAAGATGAAGGAAGAGGG - Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031316419 7:120262863-120262885 ATGTAAAATATGAAAAAAGATGG - Intergenic
1031494299 7:122427297-122427319 ATGTAGAAAATGAACTAAAATGG + Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032155943 7:129468146-129468168 AAGTAGAATATTAAGGAACAAGG - Intronic
1032644346 7:133805816-133805838 TTTTATAAGTTGAAGGAAGAAGG + Intronic
1032751158 7:134843096-134843118 AGGCCCAAGATGAAGGAAGACGG - Intronic
1032884739 7:136125140-136125162 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1032894228 7:136233141-136233163 GTGTAGAAAAAGAAGGCAGAGGG + Intergenic
1033167544 7:139053555-139053577 AAATCGCAGATGAAGGAAGAAGG - Exonic
1034247973 7:149663338-149663360 AAGTAGAAGAAGCAGTAAGAAGG - Intergenic
1034284672 7:149876742-149876764 ATGTACAAGACATAGGAAGATGG - Intronic
1034358127 7:150470178-150470200 ATGGAGAGGATGCAGGGAGAGGG + Intronic
1034864287 7:154627680-154627702 ATGCGGAAGTTGAAGGATGATGG - Intronic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035113017 7:156500228-156500250 ATTTGGAAGAAGATGGAAGAAGG + Intergenic
1035814165 8:2520990-2521012 TGGTTGAAGAGGAAGGAAGACGG - Intergenic
1035917854 8:3644513-3644535 ATGGGGAAGATGATGAAAGAGGG + Intronic
1036058962 8:5293370-5293392 AAGTAGAAGACCACGGAAGAAGG - Intergenic
1036066362 8:5385395-5385417 GTGTAGTAGAGGAAGGAAGTAGG - Intergenic
1036781389 8:11650281-11650303 ATTTAGACGTTGCAGGAAGAGGG + Intergenic
1037127215 8:15365877-15365899 ATGTAGATGCTGCAGGAAGTGGG - Intergenic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1038008057 8:23450979-23451001 ATTTGGAAGATGAAGGAAGAGGG - Intronic
1038046628 8:23770992-23771014 ATGGGGAGGATGAAGGAAGGGGG + Intergenic
1038666975 8:29546302-29546324 GTGTAGAACATGAAGGCAAATGG + Intergenic
1038712373 8:29959389-29959411 AAAGAGAAGATGAAGGAAGAGGG + Intergenic
1038970937 8:32634372-32634394 ATCAACAAGATGAAGGAAGAAGG - Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040829767 8:51663677-51663699 ATGTAGCAGATGAAGAAATCTGG - Intronic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1041311517 8:56522365-56522387 TTGTAGAAGATGGAGGCAGAAGG + Intergenic
1041846143 8:62331033-62331055 AGGTAGAAGAGGAGGGAGGAAGG - Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042703411 8:71641678-71641700 ATATAGAAGACAAAGGAAGGGGG - Intergenic
1042875066 8:73434176-73434198 GTTTTGAAGATGGAGGAAGAGGG + Intronic
1043147003 8:76672082-76672104 ATTAGGCAGATGAAGGAAGATGG - Intergenic
1043737058 8:83761643-83761665 ATGCAGAAGCTTAAGGAATATGG + Intergenic
1043918587 8:85953741-85953763 ATGCAGCAGATGAAAGAATAAGG - Intergenic
1044094725 8:88048987-88049009 ACGTTGAAGATGGAGGAAGATGG - Intronic
1044429429 8:92091154-92091176 TTGTAGAAGAGGAATGCAGAGGG - Intronic
1044471592 8:92575511-92575533 ATGGAGACAATGAAGGAAGAAGG - Intergenic
1044985521 8:97753283-97753305 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
1045085405 8:98677535-98677557 AGGAGGAAGAGGAAGGAAGAAGG + Intronic
1045332313 8:101166032-101166054 CTATAGAAAAAGAAGGAAGAGGG + Intergenic
1045823252 8:106366903-106366925 ATGTAATACATGAAAGAAGATGG - Intronic
1046093312 8:109528624-109528646 ATGTAGAGTGGGAAGGAAGAAGG - Intronic
1046146629 8:110169980-110170002 ATGCAGTAGATACAGGAAGAAGG - Intergenic
1046187577 8:110743359-110743381 GTGTAAGAGATGAAGCAAGAAGG - Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046744767 8:117864895-117864917 TTGGAGAAGAGGAAGGAAGTAGG - Intronic
1047194178 8:122706431-122706453 ATTTTGATGATGATGGAAGAAGG + Intergenic
1047630747 8:126705218-126705240 ATTAAGAAGAGGAAGAAAGATGG + Intergenic
1048143452 8:131818351-131818373 AAGTAGAAGAAGATGGAAGTCGG - Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1049929760 9:444995-445017 ATGAAGAAGATAATGGAAGAGGG + Intronic
1050079046 9:1895493-1895515 ATGTGGCAGATGAAAGAAAAGGG + Intergenic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050838741 9:10118904-10118926 ATAAAGGAGATGAAGGAAGAGGG + Intronic
1051700907 9:19822932-19822954 AAGGAGAAGAGGAAGGAAGGAGG - Intergenic
1052394904 9:27927257-27927279 ATTTAATAGATGAAGGAGGAAGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052466980 9:28840845-28840867 ATGTATGAGATGAAGGTAAAGGG - Intergenic
1053526222 9:38833275-38833297 ATCTAGAAGATAAAGAAATATGG + Intergenic
1054198448 9:62057699-62057721 ATCTAGAAGATAAAGAAATATGG + Intergenic
1054639905 9:67530662-67530684 ATCTAGAAGATAAAGAAATATGG - Intergenic
1055291720 9:74788581-74788603 ATGCAGAAGATAAAGGTAGATGG + Intronic
1055660105 9:78494735-78494757 AGCTAGAAGAAGGAGGAAGAAGG + Intergenic
1056210790 9:84363290-84363312 ATGTAGGAGAGGAACCAAGAGGG + Intergenic
1056728310 9:89142027-89142049 ATGTACAGGATGAAGGGACATGG - Intronic
1057492122 9:95528527-95528549 AAGTAGAAGATGCAGGAAGTAGG - Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057867936 9:98696195-98696217 ATTTAAAAGATGAAGAAAGGTGG + Intronic
1058946622 9:109863231-109863253 AGGTAGGAGATGAAGGAAGGAGG + Intronic
1058978622 9:110148451-110148473 AAGGAGGAGATGAAAGAAGAAGG + Intronic
1059266115 9:113032616-113032638 GAGCAGAAGATGAAGGAAGGCGG + Intergenic
1059543512 9:115153800-115153822 AGGTAGACAATGCAGGAAGATGG + Intronic
1059761247 9:117339754-117339776 AGGAAGAAGGTGAAGGAAGAAGG + Intronic
1059769369 9:117412732-117412754 ATCTAAAGGATGAAGGGAGAAGG + Intronic
1060404137 9:123364770-123364792 ATGGTGAAGAGGAAGGGAGATGG - Intronic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185814986 X:3146313-3146335 AAAAAGAAGAAGAAGGAAGAGGG - Intergenic
1186034469 X:5406131-5406153 AGGAGGAAGATGAAGGAGGAAGG + Intergenic
1186246509 X:7621917-7621939 ATGTAGCAGATTTATGAAGATGG - Intergenic
1186349252 X:8726853-8726875 CTCTAGAAGATTAAAGAAGAAGG - Intronic
1186443703 X:9607739-9607761 AAGTAGAACATGAAAGAGGATGG + Intronic
1186877993 X:13835855-13835877 ATGTAAAAGTTGAATGAAGTTGG - Intronic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187500384 X:19833764-19833786 AGAGTGAAGATGAAGGAAGAAGG - Intronic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188531286 X:31144241-31144263 ATGTTGAAGAAGATGGACGAGGG - Intronic
1188913567 X:35881036-35881058 ATGTGGAAGATGGAGGAAACAGG - Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189532665 X:41902384-41902406 ACTTTGAAGATGGAGGAAGAGGG - Intronic
1189672093 X:43422343-43422365 ATGCAGAGGATGGAGGGAGAAGG - Intergenic
1189775570 X:44467668-44467690 AAGTAGAAGGTGAAGAAAGGTGG + Intergenic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1189915041 X:45848537-45848559 ATGTAGGAGATGTAGGATGTAGG + Intergenic
1190123415 X:47682757-47682779 AGGAAGAAGAGGAAGGAAGGAGG - Intergenic
1190148913 X:47924561-47924583 TGGTAGAAGATGAATGTAGAAGG - Intronic
1190283088 X:48944213-48944235 ATCAAGCAGATGAAGGAGGATGG - Exonic
1190844403 X:54178410-54178432 ATGTATAAAATGAAGGAAACAGG + Intronic
1190856782 X:54303606-54303628 ATGTAGAAGCTTAAGACAGATGG + Intronic
1191084608 X:56550930-56550952 AGGTTTAAGATGAAGGAAGAAGG - Intergenic
1191190540 X:57662068-57662090 ATCTGGAAGATGAAGGAAAGGGG - Intergenic
1191868891 X:65728716-65728738 AGGTAAAAGATCAAGAAAGAGGG - Intronic
1191896177 X:65995754-65995776 AAGTAGAAGATACAGGAAGCTGG + Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192439461 X:71164102-71164124 ATGAAGACAATGAAGGCAGAGGG - Intronic
1192637691 X:72835169-72835191 ATGTGGAAGCTGAAGGAAACTGG + Intronic
1192644023 X:72885646-72885668 ATGTGGAAGCTGAAGGAAACTGG - Intronic
1192850902 X:74954657-74954679 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193244249 X:79210416-79210438 ATGAATGAGATGAAGCAAGAAGG - Intergenic
1193622280 X:83770298-83770320 CTGTAGGAGAAGAAGAAAGAAGG - Intergenic
1193624716 X:83804021-83804043 ATGGAGATGATGAAGAAAAATGG + Intergenic
1194530401 X:95041003-95041025 ATGTAGAAAATCAAGACAGAAGG + Intergenic
1195112569 X:101662057-101662079 ATGCAGAAGAAGAAAGAAAAGGG - Intergenic
1195238037 X:102921165-102921187 AAATAGAAGGTGAAAGAAGATGG + Intergenic
1195260188 X:103124276-103124298 ATCTAGAAGATCAAAGAAGGGGG + Intergenic
1195475153 X:105277022-105277044 ATTTAGATGATGAAGCAAGTTGG + Intronic
1195530565 X:105950500-105950522 ATGGAGAAAATAAAGGAAAAAGG + Intronic
1196348408 X:114696325-114696347 AAGTAGAGGTGGAAGGAAGAAGG - Intronic
1196392388 X:115221836-115221858 ATGTAGAAGATGAGGGGAAAGGG + Intronic
1196753973 X:119141851-119141873 AGTTAGGAGATGAAGGAAGTAGG + Intronic
1196981616 X:121220659-121220681 GTGAAGAAGATGAAGAATGAGGG - Intergenic
1197903561 X:131399183-131399205 ATGTAAATGCTGAAGGAAAAGGG + Intronic
1198978011 X:142359021-142359043 CAGAAGAAGATGAAAGAAGAAGG - Intergenic
1199073939 X:143509520-143509542 CTGGAGAAGATGAAAGAATAAGG - Intronic
1199680936 X:150224163-150224185 AAGAGGAAGATGAAGGAAGAAGG - Intergenic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1200757015 Y:6999607-6999629 AAGTAGAATATGAAAGAGGATGG + Intronic
1200772137 Y:7136007-7136029 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1200812357 Y:7499272-7499294 ATGATGAGGAAGAAGGAAGAAGG - Intergenic
1201708377 Y:16961858-16961880 ATGTAGATGATGAGGGTTGATGG + Intergenic
1201856297 Y:18548075-18548097 AGGTTGAAGGTGAAGGAGGAGGG - Exonic
1201877024 Y:18772309-18772331 AGGTTGAAGGTGAAGGAGGAGGG + Exonic
1202189981 Y:22231647-22231669 AGAGAGAAGATGGAGGAAGAAGG + Intergenic
1202304706 Y:23456303-23456325 AAGTAGAAGAGTAAGGGAGATGG - Intergenic
1202566104 Y:26214288-26214310 AAGTAGAAGAGTAAGGGAGATGG + Intergenic