ID: 1092307267

View in Genome Browser
Species Human (GRCh38)
Location 12:7314209-7314231
Sequence CTGGCTCTTTCTCCAACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092307267_1092307270 10 Left 1092307267 12:7314209-7314231 CCATCAGTTGGAGAAAGAGCCAG 0: 1
1: 0
2: 0
3: 25
4: 194
Right 1092307270 12:7314242-7314264 TAACATAATAAGTTTAGAGTTGG 0: 1
1: 0
2: 0
3: 47
4: 433
1092307267_1092307272 28 Left 1092307267 12:7314209-7314231 CCATCAGTTGGAGAAAGAGCCAG 0: 1
1: 0
2: 0
3: 25
4: 194
Right 1092307272 12:7314260-7314282 GTTGGACATACAAGATTGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 126
1092307267_1092307271 27 Left 1092307267 12:7314209-7314231 CCATCAGTTGGAGAAAGAGCCAG 0: 1
1: 0
2: 0
3: 25
4: 194
Right 1092307271 12:7314259-7314281 AGTTGGACATACAAGATTGAAGG 0: 1
1: 1
2: 2
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092307267 Original CRISPR CTGGCTCTTTCTCCAACTGA TGG (reversed) Intronic
900604706 1:3518808-3518830 CTGGCCCTGTCCCCAACAGAGGG - Intronic
901646152 1:10717862-10717884 CGGACTCTTCCTCCCACTGATGG - Intronic
904306149 1:29591765-29591787 CTGGGTCATTCTCCCACTGCTGG + Intergenic
904480269 1:30788981-30789003 CTTGCTCTTTCCCCATCTAAAGG + Intergenic
905222849 1:36460773-36460795 CTGTCTCTGTCTTCAACAGAAGG - Exonic
906809432 1:48811096-48811118 CTGGCTCTGTCGCCAACAGATGG + Intronic
909873286 1:80771784-80771806 GTAGCTCTTTCTGCAACTAAAGG - Intergenic
913275860 1:117137109-117137131 AGGGCTATTTCTTCAACTGAGGG + Intergenic
914346073 1:146799512-146799534 CTAGCCCTGTCCCCAACTGATGG + Intergenic
915070375 1:153261251-153261273 CTGGCTGTTTCTCCAGCGGTGGG + Exonic
916479352 1:165201239-165201261 CTGGCTCTTCCTCTTGCTGAGGG - Intergenic
916731064 1:167567203-167567225 CAGGCTCTTTCACCAACTCTTGG - Intergenic
918174874 1:182035052-182035074 CTAGCTTTTTCTACAACAGAGGG - Intergenic
919158207 1:193794478-193794500 CTGGCTCTTTCTCAACCTTTAGG - Intergenic
919551241 1:198990650-198990672 TGGGTTCTTCCTCCAACTGATGG + Intergenic
921098704 1:211909981-211910003 CTGTTTCTTTGTGCAACTGAAGG - Intergenic
921490059 1:215764167-215764189 CTGGCTTTATCTCCTAATGAAGG - Intronic
921676102 1:217977917-217977939 CTGCCTCTGTCCCCAAATGAGGG + Intergenic
921851747 1:219939268-219939290 CTGGATCTGTATCCCACTGATGG - Intronic
922188447 1:223296455-223296477 CTGGCTCATGCTCCAGCTGATGG - Intronic
923097653 1:230788376-230788398 CAGGCTCTTCCTCCACCTGCTGG + Intronic
1063012328 10:2036084-2036106 CTGTCTCTTTCTCCAATTGTGGG + Intergenic
1063502981 10:6571418-6571440 CTTGCTCTTTATGAAACTGATGG + Intronic
1065878738 10:30021142-30021164 CTGGCTCTTTCTTCAGCTCATGG + Intronic
1067204389 10:44200678-44200700 CTGGGTCCTTCACCTACTGATGG - Intergenic
1067519593 10:46987321-46987343 CTGTTTCTTTCTCTAACAGACGG + Exonic
1067642654 10:48064518-48064540 CTGTTTCTTTCTCTAACAGACGG - Intergenic
1067669260 10:48304787-48304809 CTTGCACATTCTCCAAGTGATGG - Intergenic
1067942913 10:50670942-50670964 CTTGCTCTTCCTCCCACAGATGG - Intergenic
1069634332 10:69916315-69916337 CTGCCACTTCCTCCATCTGAAGG - Intronic
1069752100 10:70751475-70751497 CAGGCTCTCCCCCCAACTGAGGG + Exonic
1070096795 10:73345392-73345414 TTGGCTCTATCTCCAACTCATGG - Intronic
1071631052 10:87218134-87218156 CTTGCTCTTCCTCCCACAGATGG - Intergenic
1073491338 10:103855326-103855348 CCGGCTCCTTCTCCAGCTGCCGG + Exonic
1073982402 10:109169458-109169480 CTGGCTCTTCTGCCAACTAAAGG + Intergenic
1074899433 10:117803614-117803636 CAGGCTCTTCTTCCACCTGAAGG - Intergenic
1075290342 10:121224499-121224521 CTGGCTCTTGCTCCAAAGGGTGG + Intergenic
1075290346 10:121224518-121224540 GTGGCTCTTTCTCCAAAGGGTGG + Intergenic
1075586205 10:123660051-123660073 CTTTCTATTTCTCCAACTGTGGG + Intergenic
1075842100 10:125513743-125513765 CTGGCTCTTTCTGCAGCTGTGGG - Intergenic
1076158488 10:128222481-128222503 GTGGCTCTTTCTGGAACCGATGG - Intergenic
1077044848 11:540245-540267 ATGGGTCCTTCTCCACCTGATGG - Intronic
1078024571 11:7682504-7682526 CTGGCTCTTAATCAAACTGCAGG - Intergenic
1080645010 11:34181894-34181916 TTGGCTCTGACTCCCACTGAAGG - Intronic
1082797538 11:57388914-57388936 CTGGCTCTTTTTCCCATTGAGGG - Intronic
1084020941 11:66417673-66417695 CTGGGTCTTTCAGCATCTGATGG - Intergenic
1085704801 11:78777284-78777306 CTTGCTCTTCCTCCATCTGTTGG + Intronic
1086497283 11:87417678-87417700 CTAGCTCTTTTTCCAACTAATGG + Intergenic
1088194993 11:107264410-107264432 ATGTCTCCTTCCCCAACTGAGGG + Intergenic
1088722697 11:112608555-112608577 GAGGCTCTTTCTCCAAAGGATGG - Intergenic
1090201725 11:124862476-124862498 CTGACTCTTTCTCCAGCCCAAGG + Intergenic
1091190873 11:133694363-133694385 GTGCCTCTGTTTCCAACTGAAGG + Intergenic
1092307267 12:7314209-7314231 CTGGCTCTTTCTCCAACTGATGG - Intronic
1094047127 12:26179379-26179401 CTGGATCTCACTCAAACTGATGG + Intronic
1095291620 12:40485298-40485320 GTTCCTGTTTCTCCAACTGATGG - Exonic
1095291751 12:40486223-40486245 GTTCCTGTTTCTCCAACTGATGG - Exonic
1098176783 12:67800474-67800496 CTGACTCTTTCTCTCACTAATGG - Intergenic
1099778880 12:87169002-87169024 CTTGCTATTCCTCCAACTAATGG + Intergenic
1100116219 12:91307975-91307997 CTAGCTGTTTCTTCAAATGATGG + Intergenic
1100700271 12:97139903-97139925 CTGGCACTTTCCCCCACTCAAGG - Intergenic
1102013118 12:109631180-109631202 CTCGCTCATTTTCCAGCTGATGG + Intergenic
1105961054 13:25340086-25340108 CTGGAGGTTTCTTCAACTGAAGG - Exonic
1109671759 13:65617521-65617543 CTGCATCTTTCTTCAACTCAAGG - Intergenic
1110122080 13:71894834-71894856 CTGGCCCTGTCTCCAACATAGGG - Intergenic
1111103852 13:83621028-83621050 CTGATTATTTCTCCAACTGCTGG + Intergenic
1113634514 13:111910431-111910453 CTGGCTCTTCCTCCTCCTGATGG - Intergenic
1116475311 14:45332487-45332509 CAGGCTCTATTTCCAACTCAAGG + Intergenic
1117068885 14:52038583-52038605 CTGCCTCTGTTTCCAACTCAAGG + Intronic
1117456833 14:55906238-55906260 CTGGTGCTCTGTCCAACTGAGGG - Intergenic
1117989393 14:61418894-61418916 CTGGCTCTTTGCCTGACTGATGG + Intronic
1119626477 14:76181218-76181240 CTGGATCTCTCTCCCACAGAGGG - Intronic
1122182017 14:99962264-99962286 CGGGCTCTCTCTGGAACTGATGG - Intergenic
1122806716 14:104263449-104263471 TTGGCTCGTTCCCCACCTGAAGG + Intergenic
1124170793 15:27370949-27370971 CCTGCTCCTTCTCAAACTGAAGG + Intronic
1124356943 15:29002757-29002779 GTGGCTGATTCTCGAACTGAAGG - Intronic
1124846347 15:33294981-33295003 CTGCCAGTTTCTCTAACTGAAGG + Intergenic
1126181602 15:45790909-45790931 CTGGCTCCTTCTCGAACTTAAGG + Intergenic
1127667871 15:61166691-61166713 CTGGCTCTCCCTCTAACAGAGGG - Intronic
1129677676 15:77641243-77641265 CTGCCTTCTTCTCCAGCTGATGG + Intronic
1129853046 15:78805782-78805804 CTGGCCATTTCTCCATTTGAAGG - Intronic
1131975898 15:97945665-97945687 CTGGCTCTCTATCAGACTGAAGG + Intergenic
1133094636 16:3434292-3434314 CTGCCAGTTTCTCCCACTGAGGG + Exonic
1135231714 16:20714683-20714705 CTCTCTCTCTCTCCAACCGATGG - Intronic
1139987906 16:70915755-70915777 CTAGCCCTGTCCCCAACTGATGG - Intronic
1140362190 16:74353789-74353811 CTGTTTCTTGCTCTAACTGATGG + Intergenic
1140413087 16:74753217-74753239 CTGGCTCTGTATCTAACTGGCGG - Intronic
1141421663 16:83921589-83921611 CAGGCTCTTTCTCCTTATGATGG - Exonic
1141835183 16:86533895-86533917 CTGGCTCTGTCTCCCAGTGCTGG + Intronic
1142813995 17:2411212-2411234 CTTGCTCTTTCTCCCACTGCTGG - Intronic
1144401070 17:14902513-14902535 CTGCATGGTTCTCCAACTGATGG - Intergenic
1147985727 17:44306949-44306971 TTTGCTCTTTCTCCAAATGAGGG - Intergenic
1152485367 17:80587876-80587898 CTTACTCTCTGTCCAACTGAAGG + Intronic
1154994721 18:21629055-21629077 CTGCCTCTTCCTGCAACTGAAGG - Exonic
1159906562 18:74097639-74097661 CTAGCCCTGTCTCCACCTGATGG + Intronic
1163031942 19:14550511-14550533 CTGGGTCTCTCTCCAACTCAGGG - Intronic
1167606523 19:50483910-50483932 CTGTTTCTTTCTCCACCTGCAGG + Exonic
931529516 2:63198508-63198530 CAGGCTCTTCCTCCAACACAGGG - Intronic
932679787 2:73815164-73815186 CTGGGTATTTCTGCTACTGAAGG - Exonic
935284273 2:101550191-101550213 CAGGGTCTCACTCCAACTGAGGG - Intergenic
935397646 2:102624719-102624741 CTGCATCTTACTCCAACTTAGGG - Intronic
936841979 2:116780326-116780348 AAGCCACTTTCTCCAACTGAAGG - Intergenic
937813843 2:126229221-126229243 CTGTCCCTTTCTCCAGTTGAAGG - Intergenic
937842208 2:126535289-126535311 ATGGGTCTTACTCCAACTCAAGG + Intergenic
938256163 2:129861603-129861625 CTTGCTCATTCTTGAACTGAGGG - Intergenic
938387607 2:130878429-130878451 CTGGCTCTCTGTCCTACAGAAGG - Intronic
938938089 2:136145390-136145412 TTGGCTCTTTCTCCCGCTGAAGG - Intergenic
940192054 2:151051771-151051793 CTGTCTCTTTTTGCATCTGATGG - Intergenic
944297025 2:198077140-198077162 CTGGCTGTCTTTCCCACTGAAGG + Intronic
944381474 2:199115616-199115638 TTGGGTCTTTCTCCAAATGGTGG - Intergenic
946945742 2:224820287-224820309 CTTGCTCTCTCTCCAAAAGACGG + Intronic
947150187 2:227107674-227107696 GTGGCTCTTTCAACAACTGAGGG - Intronic
948699216 2:239750049-239750071 CTGGGGCTTTCTCCATCTGCTGG + Intergenic
1169155256 20:3324114-3324136 CTGGCTCTTTCTTCCACTCCTGG + Intronic
1169417418 20:5429384-5429406 CTGCCTCTTTCTCCCAGTCAGGG + Intergenic
1169532224 20:6497749-6497771 CTAGCTCATCTTCCAACTGACGG - Intergenic
1171411624 20:24951825-24951847 CTGTTTCTTTCTCAATCTGATGG + Intronic
1173625996 20:44473592-44473614 CTGCCTCTTCCCTCAACTGAGGG - Intergenic
1174176767 20:48650306-48650328 CTGGCATTTTGTCCAACTGTGGG - Intronic
1175391535 20:58630763-58630785 CTAGCTCTGTTTCCTACTGAAGG + Intergenic
1175586917 20:60148542-60148564 CTGGCTCATTCTCCAACCCTTGG - Intergenic
1179096129 21:38316170-38316192 CTTTCTCTTTCACCAAATGAGGG - Intergenic
1179409152 21:41148869-41148891 CTGGCTGTTTCTGCAAGTGGGGG + Intergenic
1179978927 21:44886518-44886540 CTAGCTCTTCCTCAAAGTGACGG - Intronic
1181622588 22:24101135-24101157 CTGGCTCCCTCTCCCACTGCTGG - Intronic
1181735643 22:24879440-24879462 CTCCCTCTTTCTCCACCTGCAGG + Exonic
1181971044 22:26690215-26690237 CTGTCTCTTTCTCCACGTGGTGG + Intergenic
1182960797 22:34473091-34473113 CATGCTCTTTGTCCAAGTGATGG - Intergenic
1184329456 22:43817614-43817636 CTGTTTCTTTCTCCACATGAAGG - Intergenic
1184686517 22:46098812-46098834 CTCTTTCTTTCTGCAACTGAGGG + Intronic
951765635 3:26195223-26195245 CAGCCTCCTTCTCCCACTGAAGG - Intergenic
952790853 3:37199603-37199625 CAGGCTCTTTCCCAAACTGCAGG + Intergenic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
954808871 3:53235812-53235834 CTGGCTCTTTCTCTACCACAGGG + Intronic
955015857 3:55068055-55068077 CCTGCTCTGTCTCCCACTGATGG + Intronic
956031767 3:65045343-65045365 TTTGCCCTTTCTTCAACTGATGG + Intergenic
956051421 3:65252255-65252277 CTTGCTCTTTCCCCATCTGCAGG + Intergenic
960162711 3:114367885-114367907 CTGGCTTTTCCTCGAAGTGAAGG + Intronic
960187357 3:114660258-114660280 CTGTATCCTTCTCCAACCGAGGG - Intronic
960453845 3:117845007-117845029 CTCGCTCTTTATGCCACTGAAGG - Intergenic
960811659 3:121632497-121632519 CTGGCTCTTCCTCCACCTGGAGG + Exonic
962677551 3:137768123-137768145 CAGGTTCTTTCTCCAGCTGGGGG - Intergenic
963023587 3:140897160-140897182 CTAACTCTTTCCCCACCTGATGG - Intergenic
963837068 3:150068394-150068416 CTGGCTGTATCCCCTACTGAAGG - Intergenic
964309880 3:155381226-155381248 CTGGCTTTTGCTCCACATGAGGG - Intronic
965160198 3:165123431-165123453 CAGGCTATTGCTGCAACTGAGGG - Intergenic
966759227 3:183401814-183401836 CTTGTTCATTCTCCTACTGATGG + Intronic
969494584 4:7519264-7519286 ATGGCTCTTGTCCCAACTGATGG - Intronic
972644582 4:40955200-40955222 CTGGCTCCTTCTCCTACTTTAGG - Intronic
977200457 4:94108691-94108713 CTGACTCTTTTTCCAACAGAAGG + Intergenic
979476505 4:121164467-121164489 CTGGCAGTTTCTCCCACTGGAGG + Intronic
980069580 4:128229266-128229288 CTTGCTATTTCACCAGCTGAAGG + Intergenic
983970851 4:173872294-173872316 CTTGCTCTATCCCCAACTCATGG - Intergenic
984078743 4:175215967-175215989 CTGGCTCTTGATTCAATTGAAGG + Intergenic
985619487 5:946694-946716 AAGCCTCTTTCTCCAAATGAGGG + Intergenic
987369200 5:17177726-17177748 CTGGCTTTCTCATCAACTGATGG + Intronic
988199101 5:28047898-28047920 CAGGATCTTGCTCCAAGTGACGG + Intergenic
989142621 5:38216971-38216993 CTTGCTCTTTCTCCAGCAAAGGG + Intergenic
989625559 5:43426297-43426319 CTGGCTCTCTCTCTCACTCATGG - Intergenic
990927178 5:61039657-61039679 CTGGCTATCTCACCACCTGAGGG - Intronic
993230230 5:85226268-85226290 GTGGCTCTTCCTCCAACTCTAGG - Intergenic
995256418 5:110051857-110051879 CTGGCTCATTCGCACACTGAAGG - Intergenic
998463029 5:142323528-142323550 CTGCCTCTTTCACCAGCTGCTGG - Intronic
1000697793 5:164410320-164410342 CTTGTTCTTTCTCCAACATATGG - Intergenic
1005347081 6:24901330-24901352 ATGGCTCTTTCCCTCACTGATGG - Intronic
1007670645 6:43550457-43550479 CTGGCTCTTTTTCCTTCTGTGGG + Intronic
1012866796 6:104627439-104627461 CTGGCCCTATCTCCACCTGAGGG - Intergenic
1019927424 7:4202538-4202560 CTGGCGGTCGCTCCAACTGAGGG - Intronic
1022599773 7:31746837-31746859 TTGGCTCTTTCTCCAACTTGTGG - Intergenic
1022719316 7:32928603-32928625 CTGGCTCATGCACCAACTAAAGG - Intergenic
1022738561 7:33099348-33099370 CTGGCTCATGCACCAACTAAAGG - Exonic
1023323232 7:39023865-39023887 CTGGCTCTTTCACCAACCATTGG - Intronic
1024475629 7:49805869-49805891 ATAGCTCTTTCTCCGACAGAAGG + Intronic
1027359989 7:77398386-77398408 TTGACTCTTGCTCTAACTGAGGG + Intronic
1029874694 7:103737885-103737907 CTGTATCATTATCCAACTGATGG + Intronic
1031076817 7:117221058-117221080 GTGGCTCTTTCTCCTCCTGCAGG + Intronic
1032019730 7:128400645-128400667 CTGGCTCCTCATCCCACTGAGGG - Intronic
1033566534 7:142583816-142583838 GTGGCTCTTTCTCCAACCTTAGG - Intergenic
1034011580 7:147534674-147534696 CTAGTTCTTTCTCCACCCGAAGG - Intronic
1034257563 7:149732994-149733016 CTGGCTGTTCCCCAAACTGATGG - Intronic
1034397555 7:150838735-150838757 GGGGCTCTTTCTCCAGCTTAGGG - Intronic
1036931276 8:12958681-12958703 CTGGTTCTTTGTGCTACTGAAGG - Intronic
1037751467 8:21685008-21685030 CTCTCTCTTCCTCCAACTTAAGG + Intergenic
1038776905 8:30539517-30539539 CTGGCTATTTCTTCACCTGAAGG + Intronic
1039479191 8:37859088-37859110 CGCCCTCTTCCTCCAACTGAAGG - Exonic
1041244022 8:55874125-55874147 CTGGCTCCATCACCATCTGATGG + Intergenic
1041411756 8:57563902-57563924 CTGTCCCTTTCTCCCAGTGAAGG + Intergenic
1043642129 8:82467550-82467572 CTTCCTCTTTCTCCATCTTATGG - Intergenic
1045557999 8:103233268-103233290 CCGTCTCTTTCTCCAATTGCTGG - Intergenic
1046121553 8:109854097-109854119 CAAGCTCTTTCTCCAACATAGGG - Intergenic
1047409311 8:124611254-124611276 CTGGCTCTTTCTCCCAATCTTGG - Intronic
1047555198 8:125921656-125921678 CTGGCTTTTCCTCCAAGTAAAGG - Intergenic
1048488583 8:134870991-134871013 CTGCCTCTTTCTCACACTCACGG - Intergenic
1050723219 9:8614999-8615021 CTAATTCTTTCTCCATCTGAGGG + Intronic
1052230888 9:26151152-26151174 GTGAATCTTTCTCCAACTTAGGG + Intergenic
1054736389 9:68754584-68754606 CTGGCTCTTTCTAGAAATTAGGG + Intronic
1054743710 9:68833626-68833648 CTGCCTATTTCTCTAACTCAGGG - Intronic
1054755635 9:68954832-68954854 CTGGCTCTTGCCCCATCTGCTGG + Intronic
1056814181 9:89789714-89789736 CTGGCTGTGTCTCCCACTGAGGG - Intergenic
1058286833 9:103189165-103189187 CTGCCTCTTTCTCGAACTTCAGG + Intergenic
1058548909 9:106092272-106092294 CTTGCCCTTTCGCCAAGTGAAGG - Intergenic
1058775146 9:108275923-108275945 CTGGTCCATTCTCCAACTGTTGG + Intergenic
1060248815 9:121969258-121969280 CTGACTCTGTCACCAACTGGTGG - Intronic
1061195755 9:129106355-129106377 CTGGCTGTTTCCCCAAGGGAAGG - Intronic
1061388284 9:130303198-130303220 CCGGCTCCTTCACCAGCTGATGG - Intronic
1061573422 9:131491656-131491678 CTGGCTCTTTCTACCACACAGGG - Intronic
1061934694 9:133850807-133850829 CAGGCTCTTCCTCAAACAGAGGG + Intronic
1062108245 9:134767289-134767311 CTGGCTCTTTCTCCCTCTTAGGG + Exonic
1062290856 9:135793751-135793773 CTGGCTCTGTCCCCCACAGAGGG - Intergenic
1187090396 X:16089974-16089996 TTTGCTCTCTCGCCAACTGATGG - Intergenic
1187472256 X:19579816-19579838 CTGGCTCTTGCTGCAGCTGGGGG + Intronic
1189603188 X:42648859-42648881 CTGGCCCTTCCCCCACCTGATGG + Intergenic
1190219176 X:48500036-48500058 CTGGCTCTTACTCCTTGTGAAGG - Intergenic
1190335970 X:49261781-49261803 CTGGCTCTCTCCCCAACTGCAGG - Intronic
1191254065 X:58272278-58272300 GTGCCTGTTTCTCCCACTGAAGG - Intergenic
1195208167 X:102624988-102625010 TTGTTTCTTTCCCCAACTGAGGG + Intergenic
1196056444 X:111361181-111361203 CTGCCTCTTTCTCTCACTGGAGG - Intronic
1197172169 X:123446419-123446441 CTGCCTGTTTCTCCACCTGAAGG - Intronic
1198251250 X:134881010-134881032 CTGTCTTTTTCTTCAACTTATGG + Intergenic
1199872428 X:151912079-151912101 CTGGCTCTTTGTTGAAGTGATGG - Intergenic
1201969432 Y:19775174-19775196 GTGGCTCTATCCCCCACTGAAGG + Intergenic