ID: 1092310671

View in Genome Browser
Species Human (GRCh38)
Location 12:7348220-7348242
Sequence CTGTGCAAGGGGAAAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 389}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092310666_1092310671 13 Left 1092310666 12:7348184-7348206 CCATTCATTAGGGAGTGTCAATC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1092310671 12:7348220-7348242 CTGTGCAAGGGGAAAGAGCATGG 0: 1
1: 0
2: 3
3: 35
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092310671 Original CRISPR CTGTGCAAGGGGAAAGAGCA TGG Intronic
900170253 1:1264429-1264451 CAGAGCAAGGGGAAAGATGATGG - Intronic
900323448 1:2095968-2095990 CTGTGCCAGGGGCCAGGGCAGGG + Intronic
900908214 1:5575737-5575759 CTGTGCATGGGGACAGAGGTGGG - Intergenic
901311996 1:8276514-8276536 CTGTGCAAGGGGGAAGCTCCGGG - Intergenic
902997081 1:20234521-20234543 CTGTGAAAGGGAAAAGGACATGG + Intergenic
903189268 1:21647708-21647730 CTGGGGTAGGGGAAAGAGCATGG - Intronic
903340690 1:22652566-22652588 CTGAGAACAGGGAAAGAGCAGGG + Intergenic
903555156 1:24187544-24187566 CCGTGCACGGGGGAAGGGCAGGG + Intronic
903704376 1:25274430-25274452 CGGTGCAGGGGTAAAGAACATGG - Intronic
903722864 1:25418885-25418907 CGGTGCAGGGGTAAAGAACATGG + Intronic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
905281957 1:36855032-36855054 CTGTGTCAGGGGCAAGAACAAGG + Intronic
905477784 1:38241020-38241042 CTCTGCACAGGGAAATAGCATGG + Intergenic
905795145 1:40811752-40811774 CTGGGCAGGGAGAAAGAACATGG + Intronic
907239644 1:53074430-53074452 GTGAGCAAGGAGAAAGAACAGGG + Intronic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
908163636 1:61436251-61436273 CTTTGCAAAGGAAAAGAGCCTGG + Intronic
910106475 1:83636448-83636470 CAGAGCAAGGGGATGGAGCAAGG + Intergenic
910969117 1:92836689-92836711 AAGTGCATGGGGAAAGAGGATGG - Intronic
913089746 1:115468476-115468498 CTGTGCAGGGGCAAAGGGAAAGG + Intergenic
913286380 1:117230433-117230455 CTGTAAAATGGGAATGAGCATGG + Intergenic
913296242 1:117323475-117323497 CTATGCATTTGGAAAGAGCAAGG - Intergenic
914041743 1:144056445-144056467 TTTTGCAAGGGGCAAGCGCAGGG + Intergenic
914136348 1:144904041-144904063 TTTTGCAAGGGGCAAGCGCAGGG - Intronic
914326135 1:146618674-146618696 TTGTGGAAGGGGAAAGGGCATGG + Intergenic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
916531582 1:165661408-165661430 CTCTGCAAGAGAAAACAGCAGGG - Intronic
916758130 1:167792529-167792551 CTATGCAAGAGGAAAGTGCAGGG - Intergenic
918003917 1:180524269-180524291 CTTTGCTAGGGGAATGAGCTAGG + Intergenic
919280235 1:195481488-195481510 CTTTGCAGTGGGAAAGAGCCTGG - Intergenic
919345877 1:196377647-196377669 CTTTGCAAGCAGAAAGAGAAGGG + Intronic
919674564 1:200368329-200368351 TTGTGCAGCGGGGAAGAGCACGG - Intergenic
919983832 1:202659181-202659203 CTGTGCATTGGGAAAGGGGAGGG - Intronic
920488611 1:206394700-206394722 TTTTGCAAGGGGCAAGCGCAGGG + Intronic
920703649 1:208236148-208236170 CTGTGGACGGGGAAGGAGCCTGG + Intronic
920968741 1:210723971-210723993 CTGTGGCCGGGGAAAGAGTATGG + Intronic
921377454 1:214489347-214489369 GTGGGCAAGGGGAGAGGGCATGG - Intronic
922184802 1:223264819-223264841 CTGTGGAAGGTGAAAGAAAAAGG + Intronic
922688539 1:227667415-227667437 ATCAGCAGGGGGAAAGAGCAAGG - Intronic
922889277 1:229047803-229047825 CTGTTCAAGAGGAAGGACCAGGG - Intergenic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923603880 1:235425924-235425946 CTGTGCTCAGGGACAGAGCAGGG - Intronic
923800699 1:237205736-237205758 CTCTGCAGGGGGCAAGGGCACGG + Intronic
924279997 1:242426937-242426959 CTGTGGATGGGTAAAAAGCATGG - Intronic
924455008 1:244212366-244212388 CTGGGCAATGGGAGGGAGCAGGG + Intergenic
924948872 1:248864559-248864581 CTGTCCTAGGGGAAAAAGCATGG - Intergenic
1063198305 10:3763408-3763430 CTCTGCAGGGGGACTGAGCAAGG - Intergenic
1063327785 10:5122235-5122257 CTTTGCAAGGGGCAAAGGCAAGG + Intronic
1063819380 10:9817452-9817474 CAGAGCAATGGGACAGAGCAGGG - Intergenic
1064714745 10:18165257-18165279 CTGTGGAAGGGCAGAGAGGAGGG + Intronic
1067189849 10:44059969-44059991 CTGTGAAATGGGAAAGATTAAGG + Intergenic
1068182590 10:53541335-53541357 CTGAGGAAGGGGAAATAACAAGG + Intergenic
1068217203 10:53998121-53998143 ATGGGCAAGAGAAAAGAGCATGG - Intronic
1069589786 10:69634595-69634617 CTTTGCAAGGGGAAAATGAAAGG - Intergenic
1070471672 10:76786538-76786560 CTGTGGAAGGTGAAAAAGAAGGG - Intergenic
1070561106 10:77567101-77567123 CTGACCAAGGAGACAGAGCACGG + Intronic
1070829625 10:79410546-79410568 CTGTGCAAAGGGCTAGACCACGG + Intronic
1071403954 10:85310247-85310269 ATATGCACGGAGAAAGAGCATGG + Intergenic
1072265113 10:93719961-93719983 ATGAGCAAGAGGAAAGACCAAGG + Intergenic
1072323471 10:94273394-94273416 CTGTGAAGGGGGCAGGAGCAGGG + Intronic
1072332185 10:94364569-94364591 GTGTGGAAGGAGACAGAGCAAGG - Intergenic
1072732374 10:97854944-97854966 CCATGAAAGGGGAAAGAGCAGGG + Intronic
1073267088 10:102234334-102234356 CTCTGCCTGTGGAAAGAGCAGGG - Intronic
1073326356 10:102645898-102645920 CTGTGCTAGGCGAAAGGGCCAGG - Intronic
1073644041 10:105281274-105281296 ATGTTCATGGGGTAAGAGCAGGG + Intergenic
1074716247 10:116222104-116222126 CGGTAGAAGGGGAAAGAGCCAGG + Intronic
1075212610 10:120503689-120503711 CTGGGGAAGGGGAAAGAGACAGG - Intronic
1075230018 10:120668230-120668252 CTGTGGAAGTGGACAAAGCAAGG - Intergenic
1075345584 10:121679703-121679725 CGGTGCACTGGGACAGAGCAGGG + Intergenic
1075894640 10:125984276-125984298 CTGTAGCAGGGGAGAGAGCATGG + Intronic
1077121435 11:910731-910753 CCGTGCAAGGAGGAGGAGCAGGG + Intronic
1078192517 11:9103713-9103735 CTCTGCATGGGGACAGTGCATGG - Intronic
1078648163 11:13161941-13161963 TTTTGCAAAGGGAAAGAGCTTGG - Intergenic
1078858478 11:15225904-15225926 CTGAGGCAGGGGAGAGAGCATGG + Intronic
1079401943 11:20112833-20112855 CTTTCCAAGGGGAAGGAGCTGGG - Intronic
1080833607 11:35919233-35919255 CTCTGCCAGGGGAAAGATGATGG - Intergenic
1080928745 11:36785226-36785248 CTGGGGAAGGGGATAGAACAGGG + Intergenic
1081720066 11:45282146-45282168 TTGAGCAAGGAGAAAGAGCCAGG - Intronic
1081761335 11:45578141-45578163 CTGTGAAATGGGAAAAATCATGG + Intergenic
1081865510 11:46357579-46357601 CAGTGCAGGAGGAAAGAACAGGG - Intronic
1082780527 11:57284118-57284140 CAGTGCAAAGGGAAAGTGCGGGG + Intergenic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1085101578 11:73805204-73805226 CTGAGAATGGGGAAGGAGCAAGG - Intronic
1085324011 11:75592898-75592920 CTGTAAAATGGGAAGGAGCAGGG - Intronic
1086138935 11:83472883-83472905 TGGTTCAAGGAGAAAGAGCAAGG - Intronic
1088112587 11:106278902-106278924 CTGTGGAAAGGTAAAGAACAAGG + Intergenic
1088230859 11:107672050-107672072 CTGTGCACGTGCAAAGAGAAAGG + Intergenic
1088422949 11:109668810-109668832 TTGTGCATGGGGAAGGAGCCTGG + Intergenic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089407041 11:118206318-118206340 CTGGAAAAGGGGAAAGAGAAAGG - Intronic
1089700464 11:120241067-120241089 CTGTGGAAGGAGGAACAGCAAGG - Intronic
1091055781 11:132417490-132417512 CTTTGGAAGGGGGAACAGCAGGG + Exonic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092217578 12:6693961-6693983 CTGAGGAGGGGGAAAGGGCAGGG + Exonic
1092217782 12:6694909-6694931 GTGTGCAAGGGGCAGGAGCCAGG + Exonic
1092310671 12:7348220-7348242 CTGTGCAAGGGGAAAGAGCATGG + Intronic
1092612787 12:10189291-10189313 GTCTGAAAGGGGAAAGGGCAGGG + Intronic
1093092466 12:14937080-14937102 ATGGGGAAGGGGCAAGAGCATGG - Intronic
1094150428 12:27276533-27276555 TTGTGCAAGGTGGAAGTGCAAGG + Intronic
1094186817 12:27652409-27652431 CTCTGAAAGGGAAAAGAGAAAGG + Intronic
1094561939 12:31563135-31563157 CTTTGCAAGGTGAAAAAACATGG - Intronic
1095714643 12:45329523-45329545 CTGTGCAAGGGAAGAGTGCCTGG + Intronic
1095941933 12:47733067-47733089 CTCTCCAAGGGCCAAGAGCAAGG + Intergenic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1097450158 12:59728237-59728259 CTGGGCCAGGTGGAAGAGCATGG + Intronic
1098914310 12:76241145-76241167 TTGTTCAAGGGGAAAGACCAAGG + Intergenic
1099877926 12:88432118-88432140 TTGTGCAAGGGCACAAAGCATGG + Intergenic
1102527271 12:113520806-113520828 CTGGGCATTGGAAAAGAGCAAGG - Intergenic
1103023013 12:117551578-117551600 CTGTGCTGGGTGAAAAAGCAGGG + Intronic
1103204406 12:119117258-119117280 CTGAGCAAGGGGCTAGAACAAGG + Intronic
1103263311 12:119608292-119608314 CTTTTCAAGGGAAAAGATCATGG - Intronic
1103522848 12:121547935-121547957 CTCTGAAAGGGGAAAGAGGCCGG - Intronic
1105550327 13:21388785-21388807 CTGTGCACGCGGATAGAGGATGG + Intronic
1105947889 13:25204996-25205018 CTGTGCTAGATGAGAGAGCACGG + Intergenic
1106413448 13:29526607-29526629 CAGGGCAAGTGGAAAGTGCAGGG + Intronic
1106943862 13:34803727-34803749 CTTTGCAGGGGGAAGGAGCCTGG - Intergenic
1107719118 13:43229517-43229539 GTGTGCCAGGGGAAAGAGTTTGG + Intronic
1110101173 13:71605751-71605773 CTCTGCATGGGGAAAGAAAAAGG - Intronic
1111613174 13:90631263-90631285 CTCTGCAAGGGCAAATAACATGG + Intergenic
1111670384 13:91322206-91322228 CAGTGCAAGTGGAAAGAAAAAGG + Intergenic
1112088718 13:96058601-96058623 AAGTGGAAGGTGAAAGAGCAAGG + Intergenic
1112302093 13:98239855-98239877 CTGTGCTAGAGGAGAGAGAAAGG + Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114704408 14:24710861-24710883 CTGTGCAAGGGGGAAGACTCAGG - Intergenic
1116948774 14:50859683-50859705 CTGTGCGAGGGGAAAGCTCCGGG + Intronic
1117370883 14:55077470-55077492 GTGATAAAGGGGAAAGAGCATGG - Intergenic
1118322466 14:64761380-64761402 CTGAACAGGGGGAAAGAGCCAGG + Intronic
1118715185 14:68554752-68554774 CTAGGCATGGGGAAACAGCAGGG - Intronic
1118715374 14:68556174-68556196 CTAGGCATGGGGAAACAGCAGGG + Intronic
1118731729 14:68671460-68671482 ATGAGCAAGGACAAAGAGCAGGG - Intronic
1118904385 14:70012985-70013007 CTGTGCTAGGGGTAAGAACTAGG - Intronic
1119874530 14:78046278-78046300 CTGAGCATGTGGAAAGAGCCTGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121400689 14:93674410-93674432 CTGTGCCAGAGGAATCAGCAGGG + Intronic
1121529066 14:94640013-94640035 CTGTGGAAAGGGCGAGAGCAAGG + Intergenic
1121721023 14:96108659-96108681 CTGTGCATGGGAACAGAGCACGG + Intergenic
1121743403 14:96269386-96269408 CTGGGCACAGGGAAAGAGAAGGG - Intergenic
1121997063 14:98611076-98611098 CTTTGCCAGTGGGAAGAGCAGGG - Intergenic
1122396678 14:101437721-101437743 GTGTGTAAGGGGACAGGGCAGGG - Intergenic
1122457412 14:101865103-101865125 CTGGTTCAGGGGAAAGAGCATGG + Intronic
1122822728 14:104355289-104355311 CTGTGCAAGGTGACAGTGGACGG - Intergenic
1125043519 15:35220583-35220605 CTGTGAAAGGGCAAAGAGGCAGG + Intronic
1125061715 15:35433923-35433945 CTGTGGAAGAGAAAAGAGAAGGG + Intronic
1126320360 15:47415780-47415802 CTTTGCAAGGGCAAAGATTATGG - Intronic
1128253836 15:66182751-66182773 TTTTGCAAGTGGAAAGACCATGG - Intronic
1128386901 15:67156049-67156071 CTGTTCAAAGGGAAAGAGATGGG + Intronic
1129462386 15:75706082-75706104 CTGTGCACAGGGAAGGGGCAGGG + Intronic
1129722469 15:77885349-77885371 CTGTGCACAGGGAAGGGGCAGGG - Intergenic
1130093646 15:80840606-80840628 CCGTGCAGGGGGAAACTGCAGGG + Intronic
1130520764 15:84658934-84658956 CTGTGAGAGGGCAGAGAGCAAGG - Intergenic
1131018021 15:89073966-89073988 CAGTGCTAGGAGAAAGAGAAAGG + Intergenic
1131195701 15:90352824-90352846 CTGTGCATGGGGAAAGGGACGGG + Intronic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1133075479 16:3277285-3277307 CTGTCCAAGGAGAAAGAGGGGGG + Intronic
1134360669 16:13528231-13528253 CTGAGCAAGGGGAAAGGTGAGGG - Intergenic
1135414533 16:22258576-22258598 CTCTGAAAGGGGACGGAGCAGGG - Exonic
1136234154 16:28904159-28904181 ATCTGGAAGGGGAAAGAGAAGGG - Exonic
1136385253 16:29921495-29921517 GTGTCCAAGGTGAAAGAGCTGGG - Intronic
1138279051 16:55759091-55759113 CTGGGGAAGGGGAAAGAGACGGG - Intergenic
1138289489 16:55834590-55834612 CTGGGGAAGGGGAAAGAGACGGG + Intergenic
1139361121 16:66400902-66400924 GTGTGCAAGTGCAACGAGCAGGG + Exonic
1140007432 16:71092272-71092294 TTGTGGAAGGGGAAAGGGCATGG - Intronic
1140242221 16:73213430-73213452 ATGTGCAAGGAGAAAGAGATCGG + Intergenic
1140701455 16:77585446-77585468 CTGTGCAATGTGCAAGAGCTTGG + Intergenic
1140814486 16:78608606-78608628 CTGTGGAAGGGTCAAGTGCAGGG + Intronic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1142110734 16:88329703-88329725 CTGTTCCAGGGGAAAGGGGACGG + Intergenic
1143125454 17:4638838-4638860 CTGGCCAAGGGGTGAGAGCAAGG - Exonic
1143737689 17:8924537-8924559 CTGTGCAAGGGAAAAGATAATGG - Intronic
1144845981 17:18219316-18219338 CTCTGCAGAGGGAAAGAGAAAGG - Intergenic
1145193138 17:20865447-20865469 CTTTGCAAGAGGAAAAAGAAAGG - Exonic
1145403553 17:22567452-22567474 CTTTGCAAGAGGAAAAAGAAGGG - Intergenic
1145714647 17:27008380-27008402 CTGTTGAAGGGGAAACAGCCAGG + Intergenic
1145723364 17:27092385-27092407 CTTTGCAAGAGGAAAAAGAAAGG + Intergenic
1145814958 17:27788930-27788952 TTCTGCAAGGGGAAAAAACAGGG + Exonic
1145846719 17:28044655-28044677 CTGTGGAAGGGAAGAGAGGAAGG - Intronic
1145940807 17:28742605-28742627 CTGGGCTAGGGGAAAGGGTAGGG - Exonic
1146249723 17:31328354-31328376 ATATGCATGTGGAAAGAGCATGG + Intronic
1147586730 17:41657313-41657335 CTATGCATGGGGACAGAGGAGGG - Intergenic
1149795406 17:59514501-59514523 CTGTGCTAGGGGAAAGATGATGG - Intergenic
1150926780 17:69540628-69540650 CTTTGCTAGGGGAACAAGCATGG - Intronic
1152231419 17:79115749-79115771 CTGTGGAAGGAGAGAGAGCAAGG + Intronic
1152279494 17:79376902-79376924 CTGAGCAAGGGAGAAGAGAATGG - Intronic
1152288579 17:79426006-79426028 GTGTGGAGGGGGAGAGAGCAAGG + Intronic
1155269710 18:24128000-24128022 CTGAGCAAGGGAGAAGAGCAGGG - Intronic
1155479692 18:26272082-26272104 CTTTGCAAGGGGGAGGAGCCTGG - Intronic
1155516327 18:26626864-26626886 CTGTGCAATGGGAAATTGCCTGG + Intronic
1156007097 18:32454959-32454981 CTGTCCAAGAGCAGAGAGCAGGG - Intronic
1156043582 18:32852732-32852754 CAGAGCAAGAGGAAATAGCATGG - Intergenic
1158349080 18:56546592-56546614 CTGTTAAAGGGAAAAAAGCAAGG + Intergenic
1158688229 18:59634242-59634264 CTCTGCAAGGGGAAGCAGCAGGG + Intronic
1158744492 18:60183637-60183659 GTGTGCCAGAGGAAACAGCAGGG + Intergenic
1161309014 19:3583699-3583721 CTGGGCATGGGGACAGAGCAGGG + Intergenic
1161389536 19:4014017-4014039 CTTTCCAAGGGGAATAAGCAGGG - Intronic
1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG + Intronic
1162095879 19:8309707-8309729 CTCTGGAAGGGGAAAGGCCACGG - Intronic
1162659372 19:12157008-12157030 CTGTGCAAGACAAAGGAGCAGGG - Intergenic
1164730809 19:30502789-30502811 CTGAGCCACGGGAAAGAGCTTGG + Intronic
1164912869 19:32026649-32026671 ATGGGCAACAGGAAAGAGCAAGG - Intergenic
1166250841 19:41569950-41569972 CTGGGCCAGGGGGAGGAGCAGGG - Intronic
1167646345 19:50707411-50707433 ATGTGGAAGGGGTAAGATCAAGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167752011 19:51387221-51387243 CCGCGCCTGGGGAAAGAGCAGGG - Exonic
1167978743 19:53254908-53254930 CGGCGCAAGGGGCAAGGGCAGGG + Intergenic
1168427828 19:56253122-56253144 CTCTGCAAGGGAAAGGAACAGGG - Intronic
924963720 2:57321-57343 CTGTGCAAGGGTAGGGTGCAGGG - Intergenic
925295574 2:2774255-2774277 GTGTGCAGGGGGAAATGGCATGG + Intergenic
925434410 2:3824726-3824748 CTAGGGAAGGGGCAAGAGCACGG - Intronic
926309801 2:11667282-11667304 TTGTGGAAGGGGAAAGAGGCTGG - Intronic
926667732 2:15543225-15543247 CTGTGAGATGGGAAAGAGCTTGG - Intronic
927104589 2:19812373-19812395 CAGTGTAGGGGGAAACAGCAAGG - Intergenic
927837560 2:26412465-26412487 GTGTGCCAGAGGAGAGAGCAGGG + Intronic
927875539 2:26653033-26653055 CTGTGCAAGGGGTTGGAGCTTGG - Intergenic
927888974 2:26736482-26736504 TTGAACAAGGGCAAAGAGCATGG - Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
929895421 2:45955939-45955961 CTATGAAAGGGGAAAGATAACGG - Intronic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
931117466 2:59180242-59180264 CTCTGCAGGAGGAAAGAACAGGG + Intergenic
932060003 2:68487000-68487022 GTCTGCAAGTGGAAAGAGAAAGG - Intronic
933085130 2:78046223-78046245 CAGTGCAAGGGGGAAATGCAGGG + Intergenic
933610494 2:84429494-84429516 CTGTGCCAGGGGACTGGGCAGGG + Intronic
934097562 2:88620664-88620686 GTGAGCAAGGGCACAGAGCAGGG - Intronic
934521151 2:95020960-95020982 CTGAGGAAGGCGATAGAGCAGGG - Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935199140 2:100840781-100840803 ATGTGCGAAGGGAAAGAGCAAGG + Intronic
936996568 2:118420789-118420811 CTGTGGAAGAGGGAAGAGCATGG + Intergenic
937017637 2:118620260-118620282 GTGTTCAAGGGGCAGGAGCATGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938588524 2:132715184-132715206 ATGTGCAAGAGGAAAAAGCAAGG - Intronic
938597307 2:132801100-132801122 CAGTGGAAGGATAAAGAGCATGG - Intronic
939715827 2:145582740-145582762 CTGTGGAAGAGGAAACAACATGG - Intergenic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
942187000 2:173433625-173433647 CTGCGACAGGGGGAAGAGCAGGG - Intergenic
942636215 2:178009086-178009108 CTGGGAAATGGAAAAGAGCAAGG - Intronic
943046156 2:182864782-182864804 CTGCGCAAGTTGAAAGAGGAAGG + Intronic
943415282 2:187593809-187593831 CTATGCAAGGAGAAAAAGTAGGG + Intergenic
944663582 2:201940772-201940794 CTGTGAAAGATGAAAGGGCAAGG - Intergenic
945158646 2:206865403-206865425 ATGTGCAAGGTGCAGGAGCATGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947697352 2:232202907-232202929 CTGAGCAAGGGGACAGACCTAGG + Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948973436 2:241447510-241447532 CTGTGCACGGTAAAAGTGCAAGG - Intronic
1171400709 20:24871681-24871703 CTGTGCCTGGGGCAGGAGCAGGG - Intergenic
1171561706 20:26132933-26132955 CTTTGCAAGAGGAAAAAGAATGG - Intergenic
1172463564 20:35138034-35138056 CAGTCCAAAGGGAAAGACCAAGG + Intronic
1173066528 20:39718375-39718397 CTGTCCCAGGGCAAAGAACATGG + Intergenic
1173842690 20:46168392-46168414 TTGTGCAAGAGAAAACAGCAAGG - Intergenic
1173907968 20:46642558-46642580 CTGAGCAGGGGGAGAGGGCAAGG - Intronic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174572451 20:51511717-51511739 CAGTACCAGGGGAAAGATCAAGG - Intronic
1175159790 20:56999747-56999769 CTGTGGGAGGGGACAGAACATGG - Intergenic
1177276909 21:18923742-18923764 CTGTGAAAGTGGAATGAGAATGG - Intergenic
1178126404 21:29520230-29520252 TTGGGCAGGAGGAAAGAGCAGGG + Intronic
1178906700 21:36642614-36642636 CAGGGGAAGGGGAAAGAGTATGG + Intergenic
1181477672 22:23178910-23178932 CTGAGACAGGGCAAAGAGCAGGG + Intergenic
1181962189 22:26630187-26630209 CTGTGGTAGGGGAGAGAGCATGG + Intronic
1184074579 22:42168253-42168275 CTGAGACGGGGGAAAGAGCAGGG + Intronic
1184087547 22:42274259-42274281 CTTTGCAAGGGGACAGTGCGTGG - Intronic
1184620545 22:45672704-45672726 CTGTGCAGTGTGGAAGAGCACGG + Intronic
1184846680 22:47092110-47092132 CTGTTCTTGTGGAAAGAGCAGGG - Intronic
1185277042 22:49954291-49954313 CTGCTCACGGAGAAAGAGCAAGG - Intergenic
1185420887 22:50733762-50733784 GTGTGCATGGGGAGGGAGCAGGG - Intergenic
949421536 3:3871644-3871666 CTGGGTCAGGGGAAAGAGCTGGG - Intronic
949467882 3:4362255-4362277 CTGTGTAGAGAGAAAGAGCAAGG + Intronic
950231598 3:11280770-11280792 CTGTGCTGGGGCTAAGAGCAGGG - Intronic
950445070 3:13032364-13032386 CTGTGAAAGTGGACAGCGCAGGG + Intronic
952309568 3:32176125-32176147 CTCTGCAAGGGGACAAAGCCTGG + Intergenic
952889625 3:38031325-38031347 CTGTGCCAGGGGCCAGAGGAGGG - Intergenic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
954989081 3:54823226-54823248 GTGTGTAAGGGGAAAAATCAGGG + Intronic
956051420 3:65252254-65252276 CTGCAGATGGGGAAAGAGCAAGG - Intergenic
956305868 3:67824967-67824989 CTCTGACAGGGGAAAGAGAAGGG + Intergenic
958813808 3:98893835-98893857 CTGTGCAAGGATTAGGAGCAGGG + Intronic
959552096 3:107672961-107672983 CTGTTCAAGATGAAAGAGCTGGG - Intronic
960097936 3:113706043-113706065 GAGTGCAAGGGGAAGAAGCAAGG - Intergenic
960793814 3:121462566-121462588 TTGTGCAGGGGGAAAGTGCAGGG + Intronic
962060797 3:131925211-131925233 GAGTGCAAGGGGGAAGAGAAGGG - Intronic
962160359 3:132992762-132992784 CTGTGGTTTGGGAAAGAGCAGGG + Intergenic
966164186 3:176998524-176998546 CTCTGGAAGTGGAAACAGCAAGG + Intergenic
966886888 3:184381816-184381838 GTGAGAAAGGGGAAGGAGCAAGG + Intronic
966938411 3:184729773-184729795 GTGTGCATGGGGAGAGGGCAAGG - Intergenic
967220701 3:187245785-187245807 CAAGGCAAGGGGAAAGAGAAGGG - Intronic
967942275 3:194775449-194775471 CTGGCCAAAGGCAAAGAGCATGG - Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968231804 3:197008869-197008891 CTGTGCGTGGGGGACGAGCAGGG - Exonic
968287080 3:197515027-197515049 CTGTGCCTTGGGAAGGAGCACGG - Intronic
968786565 4:2626305-2626327 CTGGGCAAGGTGCAAGAGCCTGG + Intronic
968903294 4:3440906-3440928 CTGTGCAGAGGGAGAGAGAATGG - Intergenic
969299245 4:6287810-6287832 CTGTGCAAGGGGACAGAGTGAGG - Intronic
969657097 4:8504726-8504748 TTGTGACAGGGGCAAGAGCAAGG - Intergenic
969861662 4:10040627-10040649 CTAAGCATGGGGAAAGATCAAGG - Intronic
971327243 4:25654743-25654765 CTGTGCAAGGGGAAGGACTCGGG - Intergenic
971520360 4:27541852-27541874 CTGGACAAGGGGCAAGAGCATGG + Intergenic
973019470 4:45184182-45184204 CTGTGCCAGGGGTTAGATCAGGG + Intergenic
973189958 4:47375644-47375666 CATTACAAGGGAAAAGAGCATGG + Intronic
973604285 4:52571204-52571226 CTGGGCAAGGAGAGAGGGCAGGG - Intergenic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
980740009 4:136938293-136938315 CTGGGTAAGTGGAAAGAGAAGGG + Intergenic
981812111 4:148787875-148787897 CTGTGGAAGGCTCAAGAGCAAGG + Intergenic
981866308 4:149423556-149423578 CTTTGCAAGGGAGAGGAGCATGG - Intergenic
983264955 4:165499042-165499064 ATAGGAAAGGGGAAAGAGCAAGG + Intergenic
983912136 4:173251699-173251721 TTGTGCCAGAGGAAAGAACACGG - Intronic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
985150574 4:186943219-186943241 CTGTGCAAGGAGACAGAGCAGGG + Intergenic
985928482 5:3036000-3036022 CTGTCAGAGGGGACAGAGCATGG - Intergenic
986213061 5:5692108-5692130 CTGTCCAAGGATAAAGAACAGGG + Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
987233276 5:15917130-15917152 CTGTTGAGGTGGAAAGAGCATGG - Intronic
988920624 5:35938363-35938385 CAGTGCAAGAGGAAAGAGCTTGG - Intronic
989487851 5:42012727-42012749 ATGTGCAAGGGTTAAGAACAAGG + Intergenic
989510430 5:42280604-42280626 CAGTGAAAAGGAAAAGAGCAGGG + Intergenic
990246384 5:53867410-53867432 CAGAGCAGTGGGAAAGAGCACGG - Intergenic
990444892 5:55885495-55885517 TTGTGCAGGGGGAAGGAGCCTGG - Intronic
991470748 5:66966574-66966596 TGGTGGAAAGGGAAAGAGCATGG + Intronic
992415278 5:76546716-76546738 CAGTGCAAGCGGCAAGACCAAGG - Intronic
992846442 5:80753832-80753854 CAGTGGAAGGAGAAAGAACAGGG + Intronic
993126150 5:83838188-83838210 CGGGGAAAGTGGAAAGAGCACGG - Intergenic
993840903 5:92877149-92877171 CTGGGAAAGGAGGAAGAGCATGG - Intergenic
994117849 5:96081192-96081214 CTGAGCTAGGGGAAAGGACAAGG - Intergenic
996308623 5:122078184-122078206 CTGAGAAAGGGGAAAGGGAAGGG - Exonic
996309535 5:122088901-122088923 CTATGTAAGGGCAAAGAGAAGGG - Intergenic
996616400 5:125446420-125446442 CTGTGCCAAGGGTAGGAGCAGGG + Intergenic
997335597 5:133107034-133107056 CTGTGCAAGGGGCATGACCCAGG - Intergenic
997731773 5:136186248-136186270 CTGAGAAGGGGAAAAGAGCAAGG - Intronic
999112701 5:149136017-149136039 CTGTGCAAGAGAAAAGAACTGGG - Intergenic
999158384 5:149474631-149474653 TTGTCCAAGTGGAAAAAGCAAGG - Intergenic
999250977 5:150182161-150182183 CTGTGCAAGAGAAGAGAGAAGGG - Intronic
999387817 5:151167547-151167569 CTGTGCAAGGTCACACAGCAAGG + Intergenic
999704843 5:154262751-154262773 CAGTGCAATGGGCAAGAGAAGGG + Intronic
1000556463 5:162732478-162732500 TTGTGCAAGGGGGAGGAGCCTGG - Intergenic
1000652229 5:163831565-163831587 TTGTACAAAGGTAAAGAGCATGG - Intergenic
1000880744 5:166694046-166694068 CTGTGCAAGGGAAAATAGATGGG - Intergenic
1001085114 5:168694932-168694954 CTGTGCTGGGAGAAAGTGCATGG - Intronic
1003955514 6:11161870-11161892 CTGTACAGGAGGAAAGAGCCTGG + Intergenic
1005481825 6:26262177-26262199 CCCTGCAAGGGGAAAGAACATGG - Intergenic
1007947652 6:45840433-45840455 CTGTACAAGGGGTGAGGGCAGGG - Intergenic
1008621907 6:53279030-53279052 GTAGCCAAGGGGAAAGAGCATGG + Intronic
1008801300 6:55371884-55371906 CTGTGAAAGGGGAAAAGACATGG - Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1010918732 6:81653821-81653843 CTATGCACAGGGAAAAAGCAGGG + Intronic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1012949665 6:105504533-105504555 CTGTGCAGGGTGAGAGAGAAAGG + Intergenic
1013059070 6:106614263-106614285 CTGAGGAAGGTGAAAGAGCAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014437569 6:121437507-121437529 CGGCTCAAGGGGAAAGGGCAGGG + Intronic
1014883765 6:126754951-126754973 CTGAACAAGAGGAAAGAGAATGG + Intergenic
1015238176 6:130994384-130994406 CTGTGCAACAGGAGAGGGCAGGG + Intronic
1016268009 6:142254674-142254696 CTAAGCAAGAGCAAAGAGCATGG - Intergenic
1016651056 6:146461449-146461471 CTTTGAGAGGAGAAAGAGCAAGG - Intergenic
1016855243 6:148662855-148662877 ATGGGGAAGGGGAAAGATCAAGG - Intergenic
1019405896 7:883929-883951 CCGGGCAAGGGGAAAAAGGACGG - Intronic
1020828129 7:13057916-13057938 CTGAGCAAAGTGAAAGAGAAAGG - Intergenic
1021291312 7:18848479-18848501 GTGTGCATGGAGAGAGAGCAAGG - Intronic
1021430889 7:20557516-20557538 CAGAGCAGGGGGAAAGAACAGGG + Intergenic
1023200349 7:37690419-37690441 CTGTGAAAGGGGAAAGGACAGGG - Intronic
1023466973 7:40466681-40466703 CTGACCAAAGGGAAAAAGCAAGG + Intronic
1025276173 7:57582772-57582794 CTTTGCAAGAGGAAAAAGAAGGG + Intergenic
1026444346 7:70471033-70471055 CTGTCCCAGGGGGAAGAGCCCGG - Intronic
1027385347 7:77654347-77654369 CTGTGGAAAGGAAAAGAGAAGGG - Intergenic
1027401535 7:77813531-77813553 CTGTGAAAGGGAGAAGAGAAAGG + Intronic
1027570221 7:79856891-79856913 CTGTGTTTGGGGAGAGAGCATGG - Intergenic
1027972415 7:85102348-85102370 CTGTGTCAGGGCAAAGACCATGG + Intronic
1028574020 7:92325987-92326009 CTTTGCAACAGGAAAGAGAAAGG + Intronic
1028898226 7:96065689-96065711 CTGTGGGAGAGGAAAGAGCCGGG - Intronic
1029602988 7:101580707-101580729 CTGTGCAAGGGCCCACAGCACGG + Intergenic
1029628924 7:101738229-101738251 CTATGCAAGGAGATACAGCATGG + Intergenic
1030607871 7:111657502-111657524 TTGGGGAAGGGGAAAAAGCAGGG - Intergenic
1031878532 7:127169465-127169487 AAGTGCAAGGGGAAGCAGCAAGG + Intronic
1032203999 7:129845782-129845804 CTGCCCAAGGTCAAAGAGCAAGG - Intronic
1032463456 7:132128520-132128542 ATGAGCAAGGGGAAAGAGAAGGG + Exonic
1032692703 7:134304931-134304953 ATGGGCAAGGGGAAAAAACATGG + Intronic
1033418078 7:141182039-141182061 GTGTGCACTGGGAATGAGCAGGG - Intronic
1033645715 7:143301997-143302019 CTGGGCCTGGGGATAGAGCAGGG - Intronic
1034434081 7:151054883-151054905 GAGGGCAAGGGGAGAGAGCAGGG - Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036117466 8:5973407-5973429 ATGTGGAAGGGAAATGAGCATGG - Intergenic
1038035715 8:23684414-23684436 CTGTGCAACGGGAAAGACTTTGG + Intergenic
1039277129 8:35945616-35945638 CTTTGCAAGTAGGAAGAGCATGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1043383063 8:79723354-79723376 CTGAGTAAGGGGAAATAGAAAGG + Intergenic
1044834772 8:96285396-96285418 GTGGGCCAGGGTAAAGAGCAGGG + Intronic
1044944156 8:97375307-97375329 CAGTGCAAGGGGGAGGACCAAGG + Intergenic
1045076015 8:98569111-98569133 CTGAGCAAGGAAAAAGAGCAAGG + Intronic
1045977542 8:108146751-108146773 GAGTGCAAGGGGTAAGAGGAAGG - Intergenic
1045993977 8:108341663-108341685 CTATCCAAGGTGAAAGAGCTTGG + Intronic
1046061445 8:109144670-109144692 CTGGACAAAGGGAAGGAGCAGGG - Intergenic
1047255805 8:123212684-123212706 ACGTGCCAGGGGAAAGAGAATGG + Intergenic
1047502763 8:125454663-125454685 GTGTAGAAGGGGGAAGAGCATGG + Intergenic
1048012227 8:130467035-130467057 CTGACCCAGGGGAAAGAGGAGGG + Intergenic
1048091530 8:131246287-131246309 CTTTGCTAGGAGAAAGAGAAAGG + Intergenic
1048513707 8:135085968-135085990 CCGTGGAAAGGGCAAGAGCATGG - Intergenic
1049460270 8:142724103-142724125 CCATGCAGGGGGAAAGAGCTAGG - Intergenic
1049663320 8:143830216-143830238 CCCTGCAAGGGCAAAGAGCTGGG + Intergenic
1049688381 8:143948317-143948339 CTGTGCAGTGGGGAAGGGCAGGG + Intronic
1051745401 9:20290645-20290667 CAGGGTGAGGGGAAAGAGCAGGG + Intergenic
1052475935 9:28958923-28958945 ACATGCAAAGGGAAAGAGCAGGG + Intergenic
1052691671 9:31822913-31822935 CTGTGCAAGAGCAAAGAGTATGG - Intergenic
1053163205 9:35827936-35827958 GTGAGGAAGGGGAAAGAGAAGGG + Intronic
1055302635 9:74898286-74898308 CTCAGCAAGGGGAAAAAGAAGGG - Intergenic
1055309271 9:74961673-74961695 CTGAGGGAGGGGCAAGAGCATGG + Intergenic
1057228025 9:93302667-93302689 CTGTGCCCAGGGATAGAGCAGGG + Intronic
1059421307 9:114194222-114194244 CTGTGGAAGGTGTTAGAGCAGGG + Intronic
1059687405 9:116650838-116650860 CTGTGGAAGGGGAAAGAACAGGG - Intronic
1059838464 9:118184363-118184385 AAGTGCAATGGGAAAGAACATGG - Intergenic
1060487019 9:124054290-124054312 CTGTGCAATGGGCTAGTGCATGG + Intergenic
1060570088 9:124630566-124630588 CTATCCTAGGGGGAAGAGCATGG + Intronic
1060825391 9:126684751-126684773 CTGTACCAAGGGAAAGACCACGG - Intronic
1061389591 9:130310088-130310110 CTGGGAAAGGGGAATGGGCAGGG - Intronic
1062436930 9:136550548-136550570 CTGTGCAGAGGGGAACAGCAGGG - Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187216193 X:17279248-17279270 CTGTGAAAAGGGAAAGAACCAGG - Intergenic
1187895832 X:23978690-23978712 TTGTGCCAGGGGAAATTGCATGG - Intergenic
1188485567 X:30677973-30677995 ATCTGCAAGAGGAGAGAGCATGG - Intronic
1188911705 X:35856452-35856474 CAGAGCAAGAGAAAAGAGCAGGG + Intergenic
1189498264 X:41529334-41529356 CTGTGCAAGGGCAAGGAGAAAGG + Intronic
1190480571 X:50872721-50872743 CTGAGAAAGGGGAATGACCAAGG - Intergenic
1190804404 X:53821234-53821256 CTGTGCATGGGGACAGGGCTAGG - Intergenic
1192007391 X:67231727-67231749 CTAGGCAAGGGGCAAGAGCATGG + Intergenic
1192135786 X:68599105-68599127 CTGAGCCAGGGGAAGGAACAGGG - Intergenic
1193918150 X:87392642-87392664 CTGTGGAGGGGGGAAGAGTAAGG + Intergenic
1195909802 X:109877444-109877466 CTATACAAGTGGAAAGAACAGGG - Intergenic
1196420828 X:115519410-115519432 CTGTTCTAGGGGAATAAGCAGGG + Intergenic
1196562966 X:117173028-117173050 TTGTGCAGGGGGAAGGAGCCTGG + Intergenic
1198681091 X:139183137-139183159 GTGTGCAAGTAGACAGAGCAGGG - Intronic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic