ID: 1092310905

View in Genome Browser
Species Human (GRCh38)
Location 12:7351509-7351531
Sequence TGGGAATCCCTAATCTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092310905_1092310913 15 Left 1092310905 12:7351509-7351531 CCCTGTCAGATTAGGGATTCCCA 0: 1
1: 0
2: 2
3: 14
4: 107
Right 1092310913 12:7351547-7351569 TAACCTACATTACCTCCTTAAGG 0: 1
1: 0
2: 10
3: 40
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092310905 Original CRISPR TGGGAATCCCTAATCTGACA GGG (reversed) Intronic
902911754 1:19603557-19603579 TGGGAATCCCTAGTGTGACTTGG + Intronic
906911971 1:49962835-49962857 TCTAACTCCCTAATCTGACAAGG + Intronic
907993198 1:59602870-59602892 AGGGAGTTCCTAATCTGACAGGG - Intronic
911894530 1:103414597-103414619 TTGGAATTCTTAATATGACATGG + Intergenic
916555901 1:165894103-165894125 AGGGCATCCCTAATATGGCAGGG - Intronic
920180164 1:204127502-204127524 TGGGAACCCCAAATCCCACAGGG + Exonic
920847693 1:209607515-209607537 TGGGAATCCCCTATCTGAGTGGG + Intronic
921428309 1:215031491-215031513 TGAGTAACCCTAATCTGAAAAGG + Intronic
921780038 1:219151948-219151970 ATGGACTCCCTAATCTCACAAGG - Intergenic
1066130969 10:32393692-32393714 GGGGAATCCCTATGCTGTCAAGG - Intergenic
1069306779 10:66980729-66980751 TGGGAATCGTCAATCTCACAAGG + Intronic
1070435862 10:76392425-76392447 TGAGTATCCCTTATCTGAAATGG + Intronic
1070906742 10:80079459-80079481 TCGGAAGCCCTATTCTGACTTGG - Intronic
1072862253 10:99018675-99018697 TGGGAATGCTCAATATGACAAGG + Intronic
1073319897 10:102608841-102608863 TGTGAATCTCTAATCTGAGATGG + Intronic
1077298057 11:1835196-1835218 TGGGAATCCCACAACTCACAGGG - Exonic
1079084221 11:17433698-17433720 GGGGAATTCCTAATCTGATGGGG + Intronic
1081026691 11:38023509-38023531 TGGGAATCCATTAACTGATATGG - Intergenic
1083044721 11:59723743-59723765 TTGGAATCCCAAATCTCAAAGGG + Intronic
1084308651 11:68302924-68302946 TGGGAATCCATAAACCCACAAGG + Intergenic
1085173967 11:74470829-74470851 TGGGGATCTCTAGTCTGACAGGG + Intergenic
1085377121 11:76074952-76074974 TGGGAACCCCTGTTCTGCCAAGG + Intronic
1086033434 11:82387726-82387748 TGTGAACCACCAATCTGACAAGG + Intergenic
1089925490 11:122253135-122253157 TGAGTATCCCTTATCTGAAATGG - Intergenic
1092310905 12:7351509-7351531 TGGGAATCCCTAATCTGACAGGG - Intronic
1093560951 12:20539118-20539140 TGAGAATCCCTTATCTAAAAGGG + Intronic
1097538973 12:60912096-60912118 TGGGAACCCCAAATCCCACAGGG - Intergenic
1098077499 12:66748445-66748467 TAGTAATCCCTAATCTCACATGG + Intronic
1099531108 12:83782470-83782492 TGAGCATCCCTAATCTGAACAGG - Intergenic
1104134949 12:125928570-125928592 TGTGAATCCCTTATCTAACTTGG - Intergenic
1108344193 13:49528652-49528674 CGGTAATCCCTAATAAGACAGGG - Exonic
1108845907 13:54678284-54678306 TGGGAATTTTTTATCTGACAAGG + Intergenic
1110727215 13:78839386-78839408 TGGGAGACCCTAATCTCAAATGG - Intergenic
1112331379 13:98479487-98479509 TGGGCATCCCTCAGCTGGCAGGG - Intronic
1120708052 14:87764999-87765021 GGGGATTCCTTAATCTAACAAGG + Intergenic
1120887655 14:89464272-89464294 TGGGAGTCCCTAAGCTAACTTGG + Intronic
1125435093 15:39635853-39635875 TGGGACTCCCTAATCTTACTAGG - Intronic
1125807081 15:42502865-42502887 TGGAAGTTCCTAATTTGACAGGG + Intronic
1127098568 15:55537852-55537874 TAGGAAATTCTAATCTGACAAGG - Intergenic
1138157883 16:54722671-54722693 TGGGAATCTGTAATTTGTCAAGG + Intergenic
1140104151 16:71943889-71943911 CTGGAATCCCAAATCTCACAGGG + Intronic
1142703440 17:1678743-1678765 TGGGAATACCTAACCTTACCTGG + Exonic
1146535071 17:33642871-33642893 TGGGAAGCCATGCTCTGACAAGG - Intronic
1147051120 17:37795873-37795895 TGGAAATGCCTCATTTGACAAGG + Intergenic
1147573535 17:41586075-41586097 TAGGAATCACTGATCTCACATGG + Intronic
1148560837 17:48605208-48605230 GGGGAAACCCCAATCTGAGAAGG + Intergenic
1149119034 17:53138542-53138564 AGGGAAATCCTAATGTGACAGGG + Intergenic
1153552856 18:6280624-6280646 TGTGAATTCATTATCTGACATGG + Intronic
1158292094 18:55954167-55954189 TGGGATTCACTATTCTGAAAGGG + Intergenic
1160683851 19:424535-424557 TGGGACTCCTTAGTCTGAGAGGG - Intronic
1163074982 19:14882049-14882071 TAGGAATTCCTAATCAGAGATGG - Intergenic
1165068476 19:33241925-33241947 GGGGAATCCCTGGTCTGTCACGG + Intergenic
1166538670 19:43591987-43592009 TGGGAGTCCAGACTCTGACAGGG - Exonic
926628551 2:15116478-15116500 GGGGGATCCCTAATCCGATAGGG - Intergenic
929432751 2:41902221-41902243 TGGGGATCCCTAGTTTGACAGGG + Intergenic
931226745 2:60338359-60338381 AGGGAATCCCTTCGCTGACACGG + Intergenic
932749399 2:74361792-74361814 TGGGGATACATAATCTGACAAGG + Intronic
934766478 2:96882846-96882868 TGGGAAGCCCTAATGGGAAATGG + Intronic
937745255 2:125404432-125404454 TAGTTATCCCTAATCTGAAAGGG + Intergenic
940940772 2:159558024-159558046 TGGGAAACCCAAATCTTAAATGG + Intronic
941198633 2:162481227-162481249 ATGGAATGCCTAATCTGAAAAGG - Intronic
1170475631 20:16711462-16711484 TGTGAATCCATAAAATGACAAGG - Intergenic
1173376397 20:42487457-42487479 TGGGAATCTGTTATCTTACATGG + Intronic
1174729206 20:52898242-52898264 TGTGAATACCTCATCTAACAAGG + Intergenic
1176899809 21:14426404-14426426 TGCAAATTCCCAATCTGACAAGG + Intergenic
1178361581 21:31952928-31952950 TGGGAATCCCATGTCTGCCACGG + Intronic
1181031030 22:20148992-20149014 TGGGAAACCCTCCTCAGACAGGG + Intronic
1181512296 22:23394410-23394432 TGGGAAACCCTCCTCAGACAGGG - Intergenic
1182670993 22:31995781-31995803 TGGGAAGCCATAGGCTGACATGG + Intergenic
1183309552 22:37101987-37102009 TGGGAACCCCAGGTCTGACACGG - Intronic
1184614855 22:45631117-45631139 TGTGCATCCCTCCTCTGACACGG - Intergenic
952114096 3:30158672-30158694 TGAGAATCCCTAAACTGTGATGG + Intergenic
952246085 3:31594400-31594422 TGGGAATCCCTAATTTAAGCTGG - Intronic
952959181 3:38579165-38579187 TGGGCATCCCTGTCCTGACAGGG - Intronic
953630654 3:44613859-44613881 TGCAAATTCCTAATCTGACAAGG + Intronic
957858591 3:85912853-85912875 TGAGAATCGGTAATCTGAGAGGG + Intronic
959020034 3:101178771-101178793 TTGGAATATCTTATCTGACAAGG - Intergenic
961214262 3:125147513-125147535 TGAGGATTCCTAATCTGACGGGG - Intronic
965817533 3:172652551-172652573 TGGGAATTCCTAAACTCACTGGG + Intronic
970481854 4:16484170-16484192 TGGGAATCACTACTCTATCAGGG + Intergenic
973139661 4:46750865-46750887 GGTGCATCCCTAATCTGAAAGGG - Intronic
976916095 4:90376269-90376291 TGGGATTCACTAATCTGAAAAGG + Intronic
978168495 4:105638450-105638472 TGAGAATAGCTAATCTGACAGGG - Intronic
980122734 4:128744397-128744419 TGTGAATCGCATATCTGACAAGG - Intergenic
987154242 5:15071837-15071859 TGGGAGTCCAAAATCTGACTGGG - Intergenic
988130541 5:27098234-27098256 TGAGATTCCCAAATCTGAAAAGG - Intronic
991497327 5:67239421-67239443 TGGGAACCCCTCCCCTGACAAGG - Intergenic
994208649 5:97063491-97063513 TGGGAATCTCAAAGCTGCCATGG - Intergenic
996249494 5:121311701-121311723 AGGGAATCACTAACCTGAAAAGG + Intergenic
1000700980 5:164449461-164449483 TGCTAATTACTAATCTGACAGGG + Intergenic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1005702300 6:28414258-28414280 AGGGATTCCCTAATCTAAAAGGG + Intergenic
1006980980 6:38147861-38147883 TGCAAATCACTCATCTGACAGGG - Intronic
1007674539 6:43582144-43582166 TGAGTATCCCTTATCTGAAATGG - Intronic
1007749810 6:44064968-44064990 AGGGAACTCCCAATCTGACAGGG + Intergenic
1008722076 6:54366846-54366868 AGGAAATGCCTAATCTCACAGGG + Intronic
1016609159 6:145969060-145969082 TGGGAATCCCCAATCATACTGGG - Intergenic
1017045083 6:150339592-150339614 TGTGCATCCCTAATCTGGGAAGG + Intergenic
1024837378 7:53537968-53537990 TCAAAATCCCTAATCTGACCAGG - Intergenic
1027720080 7:81729650-81729672 TGAGAATCCCAACGCTGACATGG + Exonic
1029868816 7:103665725-103665747 TTTGAATCCCCAAACTGACAAGG - Intronic
1031242200 7:119259959-119259981 TGGTAATACATAATTTGACAAGG - Intergenic
1033471727 7:141656001-141656023 TGAGCATCCCTAATCTGAAAAGG + Intergenic
1035046424 7:155970488-155970510 TGGGAATCCTGACTCTGTCAAGG - Intergenic
1036949657 8:13129017-13129039 TGGTAATCCCTAATAACACAAGG + Intronic
1043191902 8:77235227-77235249 TGAGTATCCCTTATCTGAAATGG - Intergenic
1044979045 8:97696669-97696691 TGGGAATCCATAACCTGAAAGGG - Intronic
1045148064 8:99370288-99370310 TGGGAAAACCTAATTTGATAGGG + Intronic
1048441472 8:134462557-134462579 TGGGGCTCCCCAATCTGGCATGG + Intergenic
1049021879 8:139962744-139962766 TGGGCCTCCCTGAGCTGACAGGG - Intronic
1049331377 8:142055927-142055949 AGGGAATCCCTAACATGGCAGGG - Intergenic
1051447692 9:17158103-17158125 TGGGTATCCCTTATCTGACATGG - Intronic
1053728727 9:41030522-41030544 CTTGAATCCCTAATCAGACAGGG + Intergenic
1054699780 9:68401559-68401581 CTTGAATCCCTAATCAGACAGGG - Intronic
1055331277 9:75186250-75186272 TGGGAATTCCTGATCTGAGTAGG - Intergenic
1056913698 9:90726496-90726518 TGAGAGTCCCTAATCTGCAAAGG + Intergenic
1062193072 9:135257560-135257582 TGGGAGGCACGAATCTGACACGG + Intergenic
1186543709 X:10426809-10426831 TGGGCAGCCCAAATTTGACATGG + Intergenic
1186722761 X:12323330-12323352 AGGGAATCCAGGATCTGACAAGG + Intronic
1189792269 X:44615243-44615265 TGAGAAAACATAATCTGACAAGG - Intergenic
1195953952 X:110308840-110308862 TGAGAATACCTACTCTAACATGG + Intronic
1196435131 X:115667394-115667416 TGGGAATCCATAATAAGACAGGG - Intergenic
1198306860 X:135391998-135392020 TGGGAATCACAAAAATGACACGG - Intergenic
1198383333 X:136104786-136104808 TGGGAATCCCTAGTCTGACTTGG + Intergenic