ID: 1092312967

View in Genome Browser
Species Human (GRCh38)
Location 12:7378232-7378254
Sequence TAGGATGCTCACTGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092312967_1092312973 26 Left 1092312967 12:7378232-7378254 CCAGCTCCACAGTGAGCATCCTA 0: 1
1: 1
2: 0
3: 7
4: 186
Right 1092312973 12:7378281-7378303 TTATTCAACAGCATGACTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092312967 Original CRISPR TAGGATGCTCACTGTGGAGC TGG (reversed) Intronic
900439471 1:2646213-2646235 TAGGGTGCTCACCTGGGAGCTGG - Intronic
900520922 1:3105157-3105179 CAGGCTCCTCACTGGGGAGCAGG + Intronic
900721763 1:4180762-4180784 GGGGATGTTCACTGTGGAGGAGG - Intergenic
901656325 1:10771861-10771883 GAGGATGCTGACTGAGGACCCGG + Intronic
901733011 1:11294094-11294116 TTGAATGCTCACTATGGACCAGG + Intronic
902021529 1:13349910-13349932 CAGGATTCTCACTGGGGTGCTGG - Intergenic
902118420 1:14141011-14141033 TAGGATGGTCCCTGTGGCCCTGG + Intergenic
904078606 1:27858106-27858128 TTGGATGTTCTCTGTGGAGAGGG + Intergenic
904379067 1:30099154-30099176 TCGGATGCTCACGATGTAGCAGG + Intergenic
904400506 1:30253667-30253689 TGGGTGGCTCAGTGTGGAGCTGG + Intergenic
905341408 1:37280508-37280530 TAGAATCCTCACTTTGGGGCTGG + Intergenic
905962071 1:42051466-42051488 CAGGATGCTCCCTGAGGATCTGG + Intergenic
906489921 1:46260303-46260325 CAGGATGCTCACTCAGGAGGAGG + Intronic
907496861 1:54851226-54851248 TAGGATTCTCACCGTGGGGCTGG - Exonic
914250264 1:145916484-145916506 TTAGATGCTTACTGTGGCGCAGG - Intronic
915854711 1:159369844-159369866 AAAGATGCTCAATTTGGAGCAGG - Intergenic
917167832 1:172133214-172133236 TAGGATGCTCTCTGTAGGGAAGG + Intronic
918901532 1:190426594-190426616 TAGGATGCTCAGTCTGTAGAAGG + Intronic
922574115 1:226651057-226651079 AAGGCAGCTCACTGTGGAGAAGG + Intronic
923205840 1:231758147-231758169 TAAAAGGTTCACTGTGGAGCTGG - Intronic
923314963 1:232771538-232771560 GAAGATGCTAACTTTGGAGCTGG - Intergenic
923337957 1:232986236-232986258 GAGGAAGCTCAGGGTGGAGCTGG + Exonic
923522156 1:234743646-234743668 TTGGATGCCCACTGTGTACCAGG - Intergenic
1063191040 10:3695328-3695350 TAGAATGCACACTTAGGAGCAGG + Intergenic
1063420751 10:5911029-5911051 TGGCATGGTCACCGTGGAGCTGG - Exonic
1063428914 10:5971644-5971666 CAGGATGCTCACTGTGGAGCTGG + Intronic
1066412171 10:35182709-35182731 TAGGCTGCTCCCTGGGGAGTAGG + Intronic
1070959999 10:80491998-80492020 TGGGAAGCTCACGGTGTAGCAGG + Intronic
1071457907 10:85864876-85864898 TTGTGTGGTCACTGTGGAGCCGG - Intronic
1071871532 10:89800466-89800488 TAGGTTGCCCTCTATGGAGCTGG + Intergenic
1072667938 10:97407998-97408020 TTGCATGCTCACTGTGTACCAGG - Intronic
1072682440 10:97516933-97516955 TCGGATGCTGACTGCGGGGCAGG + Intronic
1074210894 10:111334012-111334034 TAGGATGGCCACTGTGGAGATGG + Intergenic
1074552696 10:114459570-114459592 TACACTGCTCCCTGTGGAGCAGG + Intronic
1075642048 10:124071926-124071948 CAGGAAGCTCTCTGAGGAGCTGG - Intronic
1076214403 10:128681194-128681216 TCGGATGCTCACTCTGAAGAGGG - Intergenic
1080849013 11:36051529-36051551 TTGAATGCTTACTGTGAAGCAGG - Intronic
1081039133 11:38189084-38189106 TAGTATGTTCACTGTTGACCGGG + Intergenic
1081273397 11:41116219-41116241 TAGGATGCATATGGTGGAGCTGG - Intronic
1085474316 11:76780336-76780358 TAGCATGTTCTCTGCGGAGCTGG - Intergenic
1086995993 11:93356042-93356064 TAGGCTGCTCACTGCCAAGCTGG + Intronic
1088559764 11:111101550-111101572 TAGAATGCTCACCGTGCACCAGG - Intergenic
1088734698 11:112719093-112719115 AAGGATACTCACTGGGGAGGTGG + Intergenic
1091075015 11:132607264-132607286 GAGGATGCTCACTGTGCATTTGG + Intronic
1092312967 12:7378232-7378254 TAGGATGCTCACTGTGGAGCTGG - Intronic
1092515204 12:9203905-9203927 TAGGGGCCTCAGTGTGGAGCAGG + Exonic
1094174301 12:27525587-27525609 TAGGATCCTCACTGCTGAGGAGG - Intronic
1095773300 12:45986412-45986434 TAGGATGATAATTGTGGAGATGG - Intronic
1096553565 12:52389922-52389944 CAGGATCCTATCTGTGGAGCAGG + Intergenic
1096572228 12:52530207-52530229 TAGAAAGCTCACTGTGGATTTGG + Intergenic
1096846530 12:54410215-54410237 AAGGATGCCTGCTGTGGAGCAGG + Intronic
1097629659 12:62044615-62044637 TAGGAAGCAAACAGTGGAGCTGG - Intronic
1101590225 12:106118851-106118873 TGGGATGCTCACATTAGAGCCGG - Intronic
1102993935 12:117333886-117333908 CAGGATGCTCACTGTTCAGTTGG + Intronic
1105291265 13:19055248-19055270 TGGGATTCTCACTGAGGAGGAGG - Intergenic
1107750544 13:43561135-43561157 TAGGGTAATCACTGTGAAGCAGG - Intronic
1113371082 13:109726105-109726127 TAGGATTCTGAATGTGGGGCGGG + Intergenic
1116864882 14:50023918-50023940 TAGGATGTTCTCAGTGTAGCAGG + Intergenic
1118703702 14:68460523-68460545 TAGGAAGGCCAGTGTGGAGCAGG - Intronic
1119567815 14:75643728-75643750 TAGTATGGCCACTGTGGAGATGG + Intronic
1119651001 14:76382644-76382666 TGGGATGTTCACTATGGAGTTGG + Intronic
1121311201 14:92936103-92936125 TAAGAAGCTCACTGTCCAGCGGG + Intergenic
1121494758 14:94384548-94384570 TAGAAGGATCACTGTGGGGCAGG - Intronic
1122784751 14:104158522-104158544 TGGGATGCTCCTGGTGGAGCTGG - Intronic
1123118546 14:105905778-105905800 TTGCAGGCTCACTGTGCAGCAGG - Intergenic
1127276445 15:57449490-57449512 TAGGATGCTAACAGTGGTGGAGG - Intronic
1128191239 15:65700601-65700623 TGGGACACACACTGTGGAGCAGG - Exonic
1128371690 15:67044374-67044396 GAGGAGGCTCACCCTGGAGCGGG + Intergenic
1130117003 15:81014157-81014179 TAGGATGCTGGCTGTGCAGCTGG - Intronic
1133796028 16:9047175-9047197 TAGCATGATCATTGTGCAGCTGG + Intergenic
1135990928 16:27218330-27218352 TTGGATGTTCACGGTGGGGCAGG - Intronic
1136541128 16:30928122-30928144 GAGCATGCTCAGTGTGGAGGAGG + Intronic
1137674903 16:50299406-50299428 CAGGATCTTCACTGGGGAGCAGG - Intronic
1138553686 16:57760338-57760360 GAGGGTGCGCTCTGTGGAGCTGG - Exonic
1138756923 16:59498419-59498441 TAGAATGAACACTGTGGTGCTGG - Intergenic
1139264810 16:65628846-65628868 AAGGAGGCTGACTGTGGGGCAGG - Intergenic
1140906893 16:79416735-79416757 TAGGATGCTCTCTGGTCAGCAGG - Intergenic
1142880823 17:2881370-2881392 TGGGATGCTCAGTGTGTAGATGG + Intronic
1142895314 17:2973217-2973239 TAGAATGATCACTCTGGCGCCGG + Intronic
1143789382 17:9281581-9281603 TAGGATACTCACAGTAGAGGTGG - Intronic
1146515841 17:33488786-33488808 TGGGAAGTTCACTGTGGAGGTGG - Intronic
1149563872 17:57628191-57628213 GAGGAGGCTCCCTGGGGAGCTGG + Intronic
1150548544 17:66188131-66188153 TAGGAAACTCATTCTGGAGCAGG - Intronic
1151275542 17:73031238-73031260 TAGAACGATCACTGTGGTGCTGG - Intronic
1151418681 17:73983553-73983575 CAGGGTGCTCACTGTGGTGGAGG + Intergenic
1151960963 17:77405456-77405478 TAGGATGTACACGTTGGAGCCGG + Intronic
1153947424 18:10030079-10030101 TAGGTTGCTGCCCGTGGAGCTGG + Intergenic
1154165045 18:12008563-12008585 CAGGCTGGTCCCTGTGGAGCTGG - Intronic
1157479099 18:48041338-48041360 TAGGCTTCTCACTGGGCAGCTGG + Intronic
1158809713 18:61018266-61018288 TATTATGCTCATTGTGGAGTTGG + Intergenic
1159769051 18:72527180-72527202 GAGGATCCTAAATGTGGAGCAGG + Intergenic
1160754656 19:751139-751161 GAGGCTGCAGACTGTGGAGCCGG + Exonic
1164970870 19:32531572-32531594 AAGGTTGCGCACTGTGGGGCTGG + Intergenic
1165090903 19:33387994-33388016 CATGGTGCTCACCGTGGAGCCGG - Exonic
1165689929 19:37855402-37855424 TAGGAAGCCTGCTGTGGAGCAGG - Intergenic
1168124379 19:54275599-54275621 CAGGGAGCTCACTGTGGATCAGG - Intronic
925783433 2:7405172-7405194 AAGGGTGCTGACTCTGGAGCTGG - Intergenic
925935528 2:8755252-8755274 CAGGATGCTCTCTGAGGAGGGGG - Intronic
926386236 2:12338316-12338338 TTGGATGCTCACTCTCGGGCTGG - Intergenic
926680465 2:15659425-15659447 TAGCATGCTCACTATGAACCAGG - Intergenic
926710815 2:15878875-15878897 TAGGGTGTTCACTAAGGAGCAGG - Intergenic
929176829 2:38986412-38986434 CAGGATGCTAAGTGTGGAACAGG + Intronic
932945770 2:76228521-76228543 TTGGCTGCTCTTTGTGGAGCAGG - Intergenic
933215640 2:79626793-79626815 TAGAATGGTTGCTGTGGAGCTGG + Intronic
933217268 2:79644598-79644620 TAGGATGCTGGCTGTAAAGCTGG - Intronic
939639632 2:144623840-144623862 GAGAATGCTCACTGTGGATGAGG + Intergenic
940106748 2:150109801-150109823 TAAGATGCTCCCTGTCTAGCAGG + Intergenic
940896046 2:159082405-159082427 TAAGATGCTTACTGTGGTTCAGG - Intronic
942136924 2:172935201-172935223 TTGGGGGCTCACAGTGGAGCCGG + Intronic
943405004 2:187470996-187471018 TAGGAACCTCACTGTTGATCTGG - Intronic
943561702 2:189471696-189471718 TAGGATGACTACTGTGTAGCAGG - Intronic
944996778 2:205303166-205303188 TAGGATGCTCCTTGTGGTTCAGG - Intronic
946174561 2:217914423-217914445 CAGGCAGCTCCCTGTGGAGCTGG + Intronic
947649973 2:231778539-231778561 CATAATGCTCACTGTGGATCAGG + Intronic
947994073 2:234512372-234512394 TAGGATGGCCAGTGTGAAGCAGG + Intergenic
948292012 2:236832511-236832533 TTGGAAGCTCCCTGTGGGGCTGG + Intergenic
1169807739 20:9576758-9576780 TAGTATGCTCACAGCAGAGCTGG - Intronic
1172576286 20:36011224-36011246 GAAGGTGCACACTGTGGAGCAGG + Exonic
1173643376 20:44618653-44618675 TGGGCTGCTCACTGTAGGGCAGG - Exonic
1174057608 20:47809530-47809552 GACGATTCTCACTCTGGAGCTGG + Intergenic
1174410948 20:50335118-50335140 TAGGATGGTCAATGAGGAGGAGG + Intergenic
1174732685 20:52933262-52933284 TCGGGTGCTCACTGTGTACCTGG + Intergenic
1174734619 20:52954215-52954237 TAGCATGAGCACTGAGGAGCAGG - Intergenic
1178733901 21:35131529-35131551 AAGCAGGCTTACTGTGGAGCTGG - Intronic
1179130117 21:38628647-38628669 TGGTATGCTCACTGTGGGGAGGG - Intronic
1179885133 21:44310652-44310674 TAGGATGCACCCTCAGGAGCTGG + Intronic
1180932812 22:19605054-19605076 TAGGATGATCCCTGGGGAGTGGG + Intergenic
1181464502 22:23103614-23103636 AAGGTTGCTCTCTGTGGAGTAGG - Intronic
1181826470 22:25520182-25520204 TAGTATGTTCCCTGTGGAACAGG - Intergenic
1184715193 22:46277965-46277987 TGGGATGCTAATTGAGGAGCAGG + Intronic
1185019934 22:48368118-48368140 TAGAATGCTCGCTGTGGCGAGGG - Intergenic
954187818 3:48932647-48932669 CAGGATCATGACTGTGGAGCTGG + Intronic
954369268 3:50161731-50161753 TAGGGTGCTCACAGTCAAGCTGG + Intronic
955836981 3:63066744-63066766 TAGAATGCTTACTGTGCATCAGG - Intergenic
957704677 3:83765088-83765110 GAGAATGCTCAATGTGGAGAAGG - Intergenic
960531220 3:118767511-118767533 TAGGGTCCCCACTGTTGAGCAGG + Intergenic
961631985 3:128307822-128307844 GATGATGCTGACTGTGGAGTTGG + Intronic
963032929 3:140996870-140996892 TAGAATGAACACTGTGGTGCTGG - Intergenic
968344609 3:197991194-197991216 TAGGAGGATCACTTTGGCGCAGG - Intronic
968598881 4:1499794-1499816 ATGGGTGCTGACTGTGGAGCAGG - Intergenic
969221406 4:5761247-5761269 GATCATGCTCCCTGTGGAGCAGG - Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
969466030 4:7357001-7357023 GAGGAGCCTCACTGTAGAGCTGG + Intronic
969913796 4:10470059-10470081 TAGGATGACCCCTGGGGAGCAGG + Intergenic
972345086 4:38185977-38185999 GAGGATGTTCACTGGGGAGACGG + Intergenic
972561491 4:40232723-40232745 TGGGCTGCTCAGTGGGGAGCAGG - Intronic
973329491 4:48897638-48897660 TAGGATGCTTTCTGGGGAGATGG + Intronic
979485836 4:121269391-121269413 TTGACTGCTCACTGTGGACCAGG + Intergenic
980186295 4:129465123-129465145 TAGGATGCCCACAGTGGATTGGG - Intergenic
982103507 4:151991500-151991522 TAGGGTGCTCAGTCTGAAGCTGG + Intergenic
985701314 5:1374800-1374822 TTAGTTGCTCCCTGTGGAGCCGG + Intergenic
987832455 5:23113604-23113626 TTGAATGTTCACTGTGCAGCAGG + Intergenic
988832687 5:35003110-35003132 CAGGGTCCTGACTGTGGAGCTGG + Intronic
990553088 5:56903823-56903845 TAGAATGGTAACTGTGGAGATGG - Intergenic
992562905 5:77969890-77969912 TAGTATGCTCCTTGTAGAGCTGG + Intergenic
997740009 5:136245080-136245102 TAGTATTCTCATTTTGGAGCTGG + Intronic
1000471281 5:161645261-161645283 CAGGATTCTCACTGTTGAACTGG - Intronic
1004758048 6:18634852-18634874 TAGCAAGCTCACTGTGTAGTGGG + Intergenic
1007496068 6:42260990-42261012 TAGGAACCTCACTCTGGAGCCGG - Intronic
1009767540 6:68100501-68100523 TAGAATGATCACTGTGCAGCTGG - Intergenic
1012803219 6:103861366-103861388 CAGGATGCTCATTGTGGGGGAGG - Intergenic
1013376181 6:109517074-109517096 CAGTGTGCTCAATGTGGAGCGGG + Intronic
1013497103 6:110708391-110708413 TAGGATGTGCACTGGAGAGCTGG + Intronic
1015003380 6:128247744-128247766 TAGCATGCTTACTGTGTGGCAGG - Intronic
1018064780 6:160117269-160117291 TGGGCTGCTCAGTGTGGGGCAGG + Intergenic
1018684963 6:166297183-166297205 TAGGATGATAAATGAGGAGCTGG - Intergenic
1022673485 7:32477365-32477387 TGAGATGCTGACTGTGGAGCTGG + Intergenic
1028241257 7:88423848-88423870 AAGGATGGTCACTGTGGAAGTGG + Intergenic
1028555875 7:92124375-92124397 TAGTATGTTCACTATGTAGCAGG + Intronic
1029657368 7:101936169-101936191 GAGGATTCTGACTGTGGAACTGG + Intronic
1031100950 7:117479571-117479593 TAGGAAGCTCTCCGGGGAGCCGG + Intronic
1034354269 7:150439510-150439532 TATGAGGCTGACTGTGGTGCTGG - Intergenic
1035685007 8:1517456-1517478 TGGGAGGCTCTCAGTGGAGCAGG - Intronic
1037064680 8:14563137-14563159 GAGGAAGCACACTGTGGAGGAGG - Intronic
1037794606 8:21981852-21981874 TAGGCTGGTCACTGTGAAGTTGG - Exonic
1039826923 8:41182675-41182697 TCGGGTGGTAACTGTGGAGCTGG - Intergenic
1040392692 8:46963060-46963082 GAGGATTCTCACTGTGGTGTCGG - Intergenic
1040808847 8:51427132-51427154 TGAGATGCTCACTGAAGAGCTGG - Intronic
1040896837 8:52376707-52376729 TTGAATGCTCACTGTGTACCGGG - Intronic
1046974539 8:120259115-120259137 TATGATGCTTTCTGTGGACCTGG - Intronic
1048204333 8:132403403-132403425 TAGGCTGCTCCCTGAAGAGCGGG - Intronic
1050544910 9:6701509-6701531 TAAGGTGTTCACTGTGGAGGTGG + Intergenic
1055641808 9:78324556-78324578 TTGATTGCTCACTGGGGAGCAGG + Intronic
1055749075 9:79484777-79484799 TAGGATGAGTACTGTGGAGTTGG - Intergenic
1056913576 9:90725655-90725677 GAGGGTACTCAGTGTGGAGCAGG - Intergenic
1059999074 9:119942114-119942136 TAAAATGCTTACTTTGGAGCTGG - Intergenic
1061265353 9:129501654-129501676 TAAAAGGCTCACTGTGGAGCGGG + Intergenic
1062651499 9:137580072-137580094 AAGGATGCTCTCTGAGGTGCTGG - Intergenic
1203786916 EBV:133315-133337 TAGGCTGCTCCGCGTGGAGCTGG + Intergenic
1185768191 X:2743410-2743432 TAGGATGCCACCTGTGGTGCAGG - Intergenic
1188309108 X:28595874-28595896 TACTCTGCACACTGTGGAGCTGG - Intronic
1195463951 X:105159027-105159049 TATGGTGCTCACTGTGTACCAGG + Intronic
1199070868 X:143474140-143474162 TAGGATACTAGCAGTGGAGCTGG - Intergenic
1199089800 X:143678333-143678355 TTGGGTGCTGACGGTGGAGCAGG - Intergenic
1200072398 X:153535650-153535672 TAAGATGCGCCCTGTGCAGCGGG - Intronic