ID: 1092332944

View in Genome Browser
Species Human (GRCh38)
Location 12:7602301-7602323
Sequence AGCTACAGATCTTCCTACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092332935_1092332944 17 Left 1092332935 12:7602261-7602283 CCCCCTCTGAGTTATTATATGGG No data
Right 1092332944 12:7602301-7602323 AGCTACAGATCTTCCTACTAGGG No data
1092332939_1092332944 14 Left 1092332939 12:7602264-7602286 CCTCTGAGTTATTATATGGGCTC No data
Right 1092332944 12:7602301-7602323 AGCTACAGATCTTCCTACTAGGG No data
1092332942_1092332944 -8 Left 1092332942 12:7602286-7602308 CCTGTGTTTGGGCAGAGCTACAG No data
Right 1092332944 12:7602301-7602323 AGCTACAGATCTTCCTACTAGGG No data
1092332938_1092332944 15 Left 1092332938 12:7602263-7602285 CCCTCTGAGTTATTATATGGGCT No data
Right 1092332944 12:7602301-7602323 AGCTACAGATCTTCCTACTAGGG No data
1092332937_1092332944 16 Left 1092332937 12:7602262-7602284 CCCCTCTGAGTTATTATATGGGC No data
Right 1092332944 12:7602301-7602323 AGCTACAGATCTTCCTACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092332944 Original CRISPR AGCTACAGATCTTCCTACTA GGG Intergenic
No off target data available for this crispr