ID: 1092333200

View in Genome Browser
Species Human (GRCh38)
Location 12:7604238-7604260
Sequence CTGAAAATACACATGGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092333193_1092333200 5 Left 1092333193 12:7604210-7604232 CCCTTCACCCTGGCATTCCATAA 0: 11
1: 14
2: 154
3: 106
4: 305
Right 1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG No data
1092333194_1092333200 4 Left 1092333194 12:7604211-7604233 CCTTCACCCTGGCATTCCATAAA No data
Right 1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG No data
1092333192_1092333200 10 Left 1092333192 12:7604205-7604227 CCATTCCCTTCACCCTGGCATTC 0: 6
1: 16
2: 14
3: 76
4: 602
Right 1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG No data
1092333195_1092333200 -2 Left 1092333195 12:7604217-7604239 CCCTGGCATTCCATAAAATACCT No data
Right 1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG No data
1092333196_1092333200 -3 Left 1092333196 12:7604218-7604240 CCTGGCATTCCATAAAATACCTG No data
Right 1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092333200 Original CRISPR CTGAAAATACACATGGCCAT TGG Intergenic
No off target data available for this crispr