ID: 1092338706

View in Genome Browser
Species Human (GRCh38)
Location 12:7657013-7657035
Sequence AACACACTAGGACACCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092338706 Original CRISPR AACACACTAGGACACCAAGT GGG (reversed) Intronic
901584568 1:10277584-10277606 AACACTTTAGGAGGCCAAGTGGG - Intronic
901644782 1:10710474-10710496 AGCAAACTAGGCCACCAACTTGG - Intronic
901687090 1:10948975-10948997 AACACAATAGGAGGCCAAGGCGG + Intronic
901689828 1:10965474-10965496 AACACATTGGGACACCGAGGCGG + Intronic
902005838 1:13231269-13231291 AACACTTTAGGAGGCCAAGTCGG + Intergenic
902875280 1:19337342-19337364 AGCACTTTAGGAGACCAAGTTGG - Intergenic
903061035 1:20668989-20669011 CAGACACAAGGACACCAAGAGGG + Intronic
906630403 1:47362413-47362435 AACACTCTGGGAGGCCAAGTCGG - Intronic
908907919 1:69037843-69037865 AACATACTAAGACACCAGTTGGG + Intergenic
908965919 1:69762704-69762726 AACTCACTAGGATCCTAAGTAGG + Intronic
911594778 1:99787575-99787597 AGCACTTTGGGACACCAAGTTGG - Intergenic
912417075 1:109516600-109516622 GAGATACTAGAACACCAAGTAGG + Intergenic
912760008 1:112358422-112358444 ATCACAGTATGAAACCAAGTAGG + Intergenic
915544396 1:156588082-156588104 AACACTTTGGGACACCAAGGCGG - Intergenic
915993633 1:160542373-160542395 AAAACACAAGGAAAGCAAGTTGG + Intronic
916777920 1:167988412-167988434 AGCACTTTGGGACACCAAGTCGG - Intronic
918164385 1:181930592-181930614 AACACACCTGGAGACCAATTAGG - Intergenic
920023333 1:202972553-202972575 AACACTCTAGGAGGCCAAGGCGG - Intergenic
921136260 1:212261825-212261847 AAAACATTTGGCCACCAAGTGGG - Intergenic
921348022 1:214207175-214207197 AACACACAAGGAAAGCAAGAAGG + Intergenic
921420334 1:214939828-214939850 AACACTCTAGGAGGCCAAGGCGG - Intergenic
924721389 1:246626296-246626318 AACACTTTGGGACACCAAGGTGG - Intronic
1064601164 10:16994840-16994862 AACACTTTAGGAGACCAAGGTGG + Intronic
1065799422 10:29337852-29337874 AAAACACTCGGACACAAGGTGGG + Intergenic
1068756150 10:60656111-60656133 AACTCACTAGGAAACCATCTTGG + Intronic
1068833046 10:61520160-61520182 AACCCCCAAGGACACCAAATAGG - Intergenic
1069236742 10:66084907-66084929 AGAACACTAGGACACTAATTAGG + Intronic
1069278277 10:66620171-66620193 CACAAACCAGGACACCCAGTAGG + Intronic
1070063327 10:73007749-73007771 AATAAACTAGGACACTAACTGGG - Exonic
1073427107 10:103461802-103461824 AGCACACTGGGACACCGAGATGG + Intergenic
1073456605 10:103640614-103640636 AACACCCAAGGACACAAAATGGG + Intronic
1074810714 10:117102544-117102566 AAAACACTAGGACAGGAAGCTGG - Intronic
1075871864 10:125777022-125777044 AACACTTTAGGAAACCAAGGTGG + Intergenic
1077538968 11:3137814-3137836 AACACACTGGGACCCCAAGAGGG + Intronic
1079706906 11:23632689-23632711 AACACACTTAGACACCAATTGGG + Intergenic
1080467725 11:32513711-32513733 AACACTTTGGGAGACCAAGTGGG + Intergenic
1082201372 11:49373793-49373815 CAAACAATAGGAAACCAAGTTGG - Intergenic
1084663529 11:70561780-70561802 AACACTTTAGGAGACCAAGATGG - Intronic
1088189966 11:107217523-107217545 AACACATTGGGAGGCCAAGTTGG + Intergenic
1088828147 11:113513140-113513162 CACACACAAGGACACCACCTTGG + Intergenic
1089811173 11:121132977-121132999 AGCACCTTAGGACACCAAGGTGG - Intronic
1092338706 12:7657013-7657035 AACACACTAGGACACCAAGTGGG - Intronic
1092340922 12:7675262-7675284 AATACACTAGGACACCAAGTGGG - Intergenic
1095613028 12:44154318-44154340 AAGAAAGTAGGACACCACGTGGG + Intronic
1099484168 12:83207734-83207756 AACACCCTTGGAAAACAAGTTGG + Intergenic
1099524706 12:83705350-83705372 AACATACTAAGACACCAGCTGGG + Intergenic
1100944331 12:99763454-99763476 AACACACATGGACACAAAGAGGG + Intronic
1101471106 12:104998364-104998386 AACACACAAGGACATAAAGTAGG - Intronic
1101790968 12:107927462-107927484 GACAAACTGGGACAACAAGTTGG + Intergenic
1102613871 12:114135961-114135983 AACACCCTAGGAGGCCAAGTAGG + Intergenic
1103789050 12:123456322-123456344 AGCACACTGGGAGGCCAAGTTGG - Intergenic
1104015592 12:124959774-124959796 AAGGCACTAGGAGACCATGTGGG + Intronic
1104154365 12:126116987-126117009 AATCCACTAAAACACCAAGTAGG + Intergenic
1104299322 12:127549840-127549862 AATACACTTGAACACAAAGTTGG - Intergenic
1106567595 13:30899830-30899852 AACAGACTAAGACACAAAGTTGG - Intergenic
1107178115 13:37423266-37423288 ACCACAATAGGATACCAAGTGGG + Intergenic
1108636742 13:52342808-52342830 AGCACATTAGGAGACCAAGGTGG + Intergenic
1108651307 13:52482749-52482771 AGCACATTAGGAGACCAAGGTGG - Intergenic
1108916105 13:55613938-55613960 AATATACTATGACATCAAGTAGG + Intergenic
1110189831 13:72717584-72717606 AACACTATGGGACACCAAGGTGG - Intronic
1112650817 13:101395583-101395605 AACACACTAAGACAGAAAGGTGG + Intronic
1113712122 13:112473312-112473334 AACACACAGGGACACAAAGACGG + Intergenic
1114917906 14:27289877-27289899 AACAGACTAGCACACTAAATTGG - Intergenic
1116201015 14:41795728-41795750 AAAACACTTGGACACAGAGTGGG + Intronic
1117224395 14:53639684-53639706 AACAGAATAAGACACCAAGAGGG + Intergenic
1117918916 14:60707276-60707298 CAGACACTAGGATACCAGGTAGG + Intergenic
1118096526 14:62543595-62543617 AAAATGCTAGGACAACAAGTTGG - Intergenic
1118557064 14:67035994-67036016 AAAATACTAGGAAACCAAATTGG + Intronic
1119209354 14:72818430-72818452 AGCACACTGGGAGACCAAGACGG + Intronic
1119436841 14:74603043-74603065 AACACAGTAGGACAGCAGGAGGG + Intronic
1119800302 14:77438474-77438496 AGCACACTGGGAGACCAAGTTGG - Intronic
1202842916 14_GL000009v2_random:139979-140001 AACACTTTGGGAGACCAAGTTGG + Intergenic
1125799265 15:42430630-42430652 AACACTTTAGGAGGCCAAGTTGG - Intronic
1126337739 15:47605424-47605446 AACCAACTCGGACACCAACTGGG + Intronic
1126567367 15:50114083-50114105 AAGAAACTAGGAGACCAAGAAGG - Intronic
1129071688 15:72956741-72956763 AACACACTTGGACTCAAACTGGG - Intergenic
1129755688 15:78097762-78097784 AACACACCATGGCTCCAAGTGGG + Intronic
1132260828 15:100423551-100423573 AACACACATGGACACAAAGAGGG + Intronic
1133053220 16:3130617-3130639 AACACTTTAGGAGACCAAGGCGG + Intronic
1134386287 16:13776447-13776469 AACAAACAAGAAAACCAAGTTGG - Intergenic
1134636619 16:15796845-15796867 AGAAAACTAGGAAACCAAGTCGG + Intronic
1135308425 16:21386795-21386817 AGCACTTTGGGACACCAAGTTGG + Intergenic
1135802175 16:25507688-25507710 AACACAGTAGGAAACACAGTAGG - Intergenic
1136305169 16:29365930-29365952 AGCACTTTGGGACACCAAGTTGG + Intergenic
1136600014 16:31278926-31278948 AGAACACTTGGACACCAGGTAGG - Intronic
1140214442 16:72996018-72996040 AACACTTTGGGACACCAAGGCGG + Intronic
1140436191 16:74949070-74949092 AACACTTTGGGACACCAAGGTGG + Intronic
1141523819 16:84598751-84598773 ACCACACAAGGAGACCAAGCAGG + Intronic
1141586422 16:85036635-85036657 AACACATAAGCACACCCAGTAGG - Intronic
1142829801 17:2540147-2540169 AACACTTTAGGAGACCAAGGTGG - Intergenic
1146614704 17:34346329-34346351 AATAAACTAGGACACTAACTGGG - Intergenic
1146963138 17:37001952-37001974 AGCACACTGGGAGGCCAAGTGGG + Intronic
1147007271 17:37413657-37413679 AACACACTGGGAGGCCAAGGTGG - Intronic
1148574074 17:48695931-48695953 AACACTCTGGGAGACCAAGGTGG - Intergenic
1149855223 17:60077030-60077052 AGCACACTATGACACATAGTAGG - Intronic
1150228399 17:63536393-63536415 AGCACTCCAGGACACCAAGGTGG + Intronic
1150345788 17:64403778-64403800 AACAAACTAAGACACCATATAGG + Intronic
1151004343 17:70416607-70416629 ACGACACTATGACACCAAGGAGG + Intergenic
1152839661 17:82558994-82559016 AGCACTCTGGGAGACCAAGTTGG - Intronic
1155451706 18:25970224-25970246 GACAGACTAAGACACCAAGTTGG + Intergenic
1156333079 18:36143642-36143664 AACACTTTAGGATACCAAGGTGG - Intronic
1157210723 18:45739775-45739797 CACACACTTAGACAGCAAGTGGG - Intronic
1159132195 18:64291718-64291740 ATCAAACTGGGACACCCAGTTGG + Intergenic
1159290565 18:66413534-66413556 AGAACACTTGGACACAAAGTGGG + Intergenic
1159573142 18:70143547-70143569 AAAACACAAGGACACAAAGAGGG + Intronic
1160955590 19:1690255-1690277 AACACTTTAGGAGACCGAGTCGG - Intergenic
1162363478 19:10233384-10233406 AGCACTCTAGGACTCCAAGGTGG + Intergenic
1163868563 19:19797195-19797217 AACACACTGGGAGGCCAAGGTGG + Intronic
1163925582 19:20339072-20339094 AACACACTGGGAGATCAAGGTGG + Intergenic
1163931760 19:20400541-20400563 AACACACTGGGAGATCAAGGTGG + Intergenic
1163954725 19:20626469-20626491 AACACACTAGGGGGCCAAGGTGG + Intronic
1163960784 19:20689772-20689794 AACACACTGGGAGATCAAGGTGG - Intronic
1164531660 19:29053161-29053183 AACACACATGGACACAAAGATGG + Intergenic
1164558329 19:29270097-29270119 AACACAATAAGACCCCATGTCGG - Intergenic
1165910386 19:39222472-39222494 AGCACTTTGGGACACCAAGTTGG + Intergenic
1165984115 19:39752358-39752380 AATACAATAGAACACCAGGTAGG + Intergenic
1167121189 19:47517934-47517956 AACACTCTGGGAGACCAAGGCGG + Intergenic
1167549788 19:50152491-50152513 AACAGAGTTGGACACCAACTAGG + Intergenic
1168551628 19:57301172-57301194 AGCACTTTAGGACACCAAGGTGG - Intergenic
928041877 2:27886625-27886647 AGCACTTTGGGACACCAAGTAGG + Intronic
928775412 2:34755280-34755302 AACACACCAGTAAAACAAGTTGG - Intergenic
930581515 2:53217359-53217381 AACACACTAAGCTACCAGGTGGG - Intergenic
930875609 2:56212072-56212094 AACACACTCACACCCCAAGTTGG + Intronic
932802079 2:74749928-74749950 AACACTCCAGGATACCAACTGGG + Intergenic
935798338 2:106667503-106667525 AACACTTTAGGAGACCAAGGAGG - Intergenic
935845695 2:107163474-107163496 AGCACACTGGGACACCATGCAGG - Intergenic
940386918 2:153084815-153084837 AACACACTAGTACAGTAAATTGG + Intergenic
941572005 2:167182236-167182258 AAAACACTAGCCCACCAATTAGG - Intronic
943267546 2:185754153-185754175 AACATAATAGAACACCATGTTGG - Intronic
944734376 2:202548518-202548540 AAAACACTAGGACATAGAGTAGG - Intronic
945156893 2:206848759-206848781 AACACTTTAGGAGACCAAGGCGG + Intergenic
945756373 2:213852269-213852291 AAGAAACTAGGACACTAACTTGG - Intronic
945899786 2:215524792-215524814 AACACTCTAGGAGGCCAAGGTGG + Intergenic
947535425 2:230937502-230937524 ATCACAAGAGCACACCAAGTGGG - Intronic
1170671959 20:18442418-18442440 AACAGACTATAACACCAAATTGG - Intronic
1171321374 20:24247427-24247449 AGAACACAAGGATACCAAGTGGG + Intergenic
1171991017 20:31696426-31696448 AACACACAGGGACACAAAGCTGG + Intronic
1171991923 20:31703288-31703310 AGCACATTGGGACACCAAGGCGG - Intronic
1173667240 20:44771726-44771748 GACACAGTAGGACACATAGTAGG - Intronic
1175630540 20:60531931-60531953 AGCACACTTGGACACAAGGTGGG + Intergenic
1180575027 22:16765538-16765560 AGCACTTTAGGACACCAAGGTGG + Intergenic
951167934 3:19505256-19505278 AAAACACATGGACACCAAGAGGG + Intronic
951730575 3:25806559-25806581 AACACTTTAGAACACCAAGGTGG + Intergenic
952139898 3:30466601-30466623 AACATACTAAGACACCAGCTGGG - Intergenic
953335416 3:42090144-42090166 AGCACAGTAGGGCACCAAGGAGG + Intronic
955913412 3:63881733-63881755 AACACTCTGGGACGCCAAGGCGG - Intronic
957915883 3:86687300-86687322 AATACAATAGAACACCAGGTAGG + Intergenic
958766229 3:98371648-98371670 AACACTCTGGGAGGCCAAGTGGG + Intergenic
960927078 3:122804730-122804752 AACACACTGGGAGGCCAAGGTGG - Intronic
961757913 3:129141277-129141299 AGCACTCTGGGACACCAAGGTGG + Intronic
964456415 3:156872202-156872224 AACAAACTAGAACACCTAGAGGG - Intronic
964962534 3:162445670-162445692 AAAACACTTGGACACAGAGTGGG - Intergenic
965468635 3:169063182-169063204 AACACACTGGGAGGCCAAGGTGG - Intergenic
967944886 3:194796876-194796898 TGCACACAGGGACACCAAGTGGG + Intergenic
971865752 4:32169580-32169602 GAGATAGTAGGACACCAAGTTGG + Intergenic
972959351 4:44433407-44433429 AAGAAACTGGGAAACCAAGTGGG - Intronic
974317231 4:60298105-60298127 AACAAACTAGGAAATAAAGTAGG + Intergenic
974806313 4:66884835-66884857 AACACTTTGGGACACCAAGGTGG + Intergenic
975048988 4:69835889-69835911 AGCACACTGGGACGCCAAGGAGG - Intronic
975613243 4:76221707-76221729 AACACACACGGACACAAAGATGG + Intronic
976575889 4:86670635-86670657 CAAACACTAGGAGACCAATTAGG - Intronic
978887280 4:113779277-113779299 AGCACACTGGGAGACCAAGGCGG - Intergenic
980908108 4:138969194-138969216 AACACACTGGGAGGCCGAGTCGG + Intergenic
980917359 4:139046048-139046070 AACACATTGGGACGCCAAGGTGG + Intronic
984444067 4:179811899-179811921 AATACACATGGACACCAAGATGG - Intergenic
984451886 4:179913072-179913094 AACACTCTAGGAGGCCAAGGCGG - Intergenic
985444218 4:190012098-190012120 AACACACTGAGACACCAGCTGGG + Intergenic
987921266 5:24284456-24284478 AACACTCTGGGAGACCAAGGTGG + Intergenic
988353685 5:30144517-30144539 AGCACTTTAGGAGACCAAGTAGG - Intergenic
989795080 5:45459154-45459176 AACACACTGGGAGGCCAAGGTGG + Intronic
990412573 5:55555731-55555753 AACACTCTAGGAGGCCAAGGTGG + Intergenic
992132611 5:73708392-73708414 AACACACATGGACACAAAGATGG - Intronic
992357974 5:76005149-76005171 ATCACAGGAGGAGACCAAGTGGG + Intergenic
992847363 5:80764608-80764630 AACACACTGGGAGTCCAAGGTGG - Intronic
993223921 5:85140863-85140885 AACACACTGGGATGCCAAGGTGG - Intergenic
993582360 5:89678069-89678091 AATACAGTAGAACACCATGTAGG + Intergenic
996638850 5:125728980-125729002 AACAAACTAAGACATAAAGTTGG + Intergenic
996720462 5:126625347-126625369 AACACTTTAGGAGACCAAGGCGG + Exonic
996934753 5:128935763-128935785 AACACTTTGGGACACCAAGGCGG + Intronic
997299765 5:132794206-132794228 AACACTCTAGGAGACCAAGCTGG - Intronic
998964451 5:147524121-147524143 AACACTTTAGGAGACCAAGGTGG + Intergenic
999403119 5:151282754-151282776 TATACACTAGGACAGCAAATGGG - Intronic
1003002190 6:2346651-2346673 AACACTCTGGGAGACCAAGGTGG - Intergenic
1004227860 6:13803883-13803905 AACACTCTGGGAGACCAAGGCGG + Intronic
1004500555 6:16206197-16206219 AACACTTTGGGACACCAAGGTGG - Intergenic
1005165217 6:22911782-22911804 AACCCAGTAGCACACCAGGTAGG + Intergenic
1005199132 6:23323386-23323408 AATACACATGGACACCAAGAAGG + Intergenic
1005812523 6:29528417-29528439 AGCACACTATGTCACCAAGAGGG - Intergenic
1005985571 6:30872411-30872433 AACACTCTAGGAGGCCAAGTTGG - Intergenic
1007747092 6:44049900-44049922 AGCACACTTGGTGACCAAGTTGG + Intergenic
1008164794 6:48123131-48123153 AATACACTAGGACACAAAGAAGG + Intergenic
1009718852 6:67437778-67437800 AAAACACTAGGCCAACAAATTGG + Intergenic
1010200857 6:73280959-73280981 AACACTTTGGGAGACCAAGTAGG + Intronic
1010299578 6:74244089-74244111 AACATACTAAGACACCAACCGGG - Intergenic
1012620697 6:101340211-101340233 AACAGACTAAGACACCAGCTGGG - Intergenic
1013379374 6:109551913-109551935 AAAACACATGGACACCAAGAGGG - Intronic
1013494489 6:110684771-110684793 AACACACTAGGAGGTAAAGTTGG - Intronic
1013526997 6:110983588-110983610 AACACTCTAGGAGGCCAAGGTGG - Intronic
1014138971 6:117919141-117919163 AACACACTGGGAGTCCAAGGTGG - Intronic
1014228115 6:118871667-118871689 AACACACTGGGAGGCCAAGGCGG + Intronic
1014886170 6:126784266-126784288 AACACAATAGGACATCAGGGAGG + Intergenic
1015170411 6:130246340-130246362 AACACAATAGTATATCAAGTTGG + Intronic
1015549237 6:134394819-134394841 AGCACACTAGGACACGGAGCAGG - Intergenic
1015730078 6:136338505-136338527 AACACTCTAGGAGACCAAGGCGG - Intergenic
1015980416 6:138832722-138832744 AAAACACAAGGACACTAAATGGG - Intronic
1016135278 6:140532890-140532912 AATACAATAGAACACCAGGTAGG + Intergenic
1016710879 6:147170676-147170698 AACTCACTAAGACACCAATATGG + Intergenic
1017994404 6:159520099-159520121 ATCACACTAGTACTCCAAGAAGG - Intergenic
1020963115 7:14830694-14830716 AAGACACTATGACACCATGTGGG + Intronic
1022285594 7:28954328-28954350 AACACAGTAAGACACTCAGTTGG + Exonic
1022853609 7:34293181-34293203 AACAGAGTAAGACACCAAATTGG + Intergenic
1023476565 7:40585619-40585641 AACACTTTAGGAGGCCAAGTGGG - Intronic
1025621057 7:63171284-63171306 AACACTCTGGGACACCAAGGCGG - Intergenic
1025725445 7:64053827-64053849 AACACACTAATACACGGAGTGGG + Intronic
1026533751 7:71222821-71222843 AACACTTTGGGAGACCAAGTTGG + Intronic
1028615711 7:92764382-92764404 AACACTCTAGGAGACCAAGGAGG - Intronic
1029496136 7:100896247-100896269 GACACACTTGGACACCCTGTCGG + Intronic
1031309800 7:120181432-120181454 AAAACACTAGGAAATCAAATTGG + Intergenic
1031330591 7:120458882-120458904 AAGACAGTAGGAGACCAGGTAGG + Intronic
1031494596 7:122431332-122431354 AACATTCTAGGACAATAAGTGGG + Intronic
1032555110 7:132824601-132824623 ACCACGCTCGGCCACCAAGTAGG + Intronic
1033335055 7:140445166-140445188 AACACTTTGGGACACCAAGGTGG + Intergenic
1034966866 7:155396974-155396996 AACACAGCAGGAGACCAAGCAGG - Intergenic
1036288732 8:7468198-7468220 AAAACAATAGGACACCAGGACGG + Intergenic
1036332743 8:7843330-7843352 AAAACAATAGGACACCAGGACGG - Intergenic
1039185708 8:34913844-34913866 ACCACACTAGTACAGCAGGTTGG + Intergenic
1039286510 8:36047452-36047474 AACACTCGAGGACACCAGATAGG - Intergenic
1040938002 8:52800966-52800988 AACACACTGAGACAGCAGGTTGG - Intergenic
1041100835 8:54395348-54395370 AAGACAGTTGGAAACCAAGTAGG - Intergenic
1043039252 8:75240340-75240362 AACACACTCTGACTCCTAGTTGG + Intergenic
1043140778 8:76587489-76587511 AACACAGCAAGACACCAAATAGG - Intergenic
1043333881 8:79149929-79149951 AACAGACTAGGACAAAAAATTGG + Intergenic
1044126247 8:88461191-88461213 AGCACACAAGGACACAAAGAAGG - Intergenic
1046465994 8:114604063-114604085 AACACACTGGGAGGCCAAGGAGG - Intergenic
1048765673 8:137841882-137841904 AACACTTTAGGAGACCAAGGTGG - Intergenic
1050497343 9:6258216-6258238 AAAACACTTGGACACAGAGTGGG - Intergenic
1053012434 9:34641939-34641961 AGCACACTGGGAAACCAAGGCGG - Intronic
1056040324 9:82659002-82659024 AACACACTGGGAACCCAAGGTGG - Intergenic
1057126928 9:92624087-92624109 AACACTTTGGGACACCAGGTGGG + Intronic
1058969319 9:110065472-110065494 CACACTCTGGGACACCAAGGTGG - Intronic
1061745047 9:132733544-132733566 GACGCACAAGGACACCAAATGGG + Intronic
1188181766 X:27065176-27065198 AACACTTTGGGACACCAAGGCGG + Intergenic
1188627217 X:32299400-32299422 AAAGCACTAGGAAATCAAGTTGG - Intronic
1188724126 X:33560381-33560403 AATACACTTGGATACAAAGTTGG - Intergenic
1188788127 X:34374041-34374063 AACATACTGAGACACCAACTGGG + Intergenic
1189114545 X:38329294-38329316 AGCACACTAAGACATCAAATTGG + Intronic
1189890116 X:45592103-45592125 AACATACTAAGACACCAACCAGG - Intergenic
1189906065 X:45760821-45760843 AACAGACTAAGACACCACATGGG - Intergenic
1190193281 X:48294940-48294962 AACACTTTAGGAGACCAAGGTGG + Intergenic
1190659786 X:52643551-52643573 AACACTTTAGGAGACCAAGGTGG + Intergenic
1190666016 X:52696388-52696410 AACACTTTAGGAGACCAAGGTGG + Intronic
1190673402 X:52762022-52762044 AACACTTTAGGAGACCAAGGTGG - Intronic
1190676947 X:52790793-52790815 AACACTTTAGGAGACCAAGGTGG - Intergenic
1191184886 X:57599548-57599570 AACACATTAGGAGGCCAAGGCGG + Intergenic
1192726006 X:73752754-73752776 AACACACTGAGACACAAACTGGG - Intergenic
1192977956 X:76306411-76306433 AGTACAATAGAACACCAAGTGGG - Intergenic
1194048958 X:89044256-89044278 AACACATTGGGAAACCAAGCAGG + Intergenic
1196092615 X:111762207-111762229 AAAACACTAGTACACACAGTTGG - Intergenic
1196573353 X:117289111-117289133 AATACAATAGAACACCAGGTAGG + Intergenic
1196870610 X:120109830-120109852 AACACTTTGGGACACCAAGGTGG - Intronic
1197277879 X:124501046-124501068 AACAATCTAGGGCACTAAGTGGG - Intronic
1197855021 X:130905024-130905046 AGCACTTTGGGACACCAAGTTGG + Intergenic
1197959531 X:131989047-131989069 AACACTCTAGGCAACCAAGGTGG - Intergenic
1198204392 X:134452322-134452344 AACACACTGGGAGGCCAAGGTGG + Intergenic
1198377183 X:136051494-136051516 ATCACTGTAGGACACCAGGTTGG + Intergenic
1198837730 X:140821873-140821895 AATACACAAGGACACAAAGAAGG - Intergenic
1199900773 X:152169831-152169853 AACACACAAAGAAAACAAGTAGG - Intronic
1202330744 Y:23750043-23750065 AACAAACAAGCAAACCAAGTAGG - Intergenic
1202540025 Y:25920018-25920040 AACAAACAAGCAAACCAAGTAGG + Intergenic