ID: 1092344370

View in Genome Browser
Species Human (GRCh38)
Location 12:7703279-7703301
Sequence CATACTGTACACTTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092344366_1092344370 -7 Left 1092344366 12:7703263-7703285 CCACCGCGCCTGGCTCCATACTG No data
Right 1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG No data
1092344360_1092344370 24 Left 1092344360 12:7703232-7703254 CCTCCCAAAGTGCTGAGATTCCA 0: 90
1: 19353
2: 319504
3: 261514
4: 145738
Right 1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG No data
1092344364_1092344370 4 Left 1092344364 12:7703252-7703274 CCAGGCATGAGCCACCGCGCCTG 0: 17
1: 135
2: 673
3: 1159
4: 1810
Right 1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG No data
1092344367_1092344370 -10 Left 1092344367 12:7703266-7703288 CCGCGCCTGGCTCCATACTGTAC No data
Right 1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG No data
1092344363_1092344370 20 Left 1092344363 12:7703236-7703258 CCAAAGTGCTGAGATTCCAGGCA 0: 43
1: 6961
2: 108355
3: 243690
4: 244827
Right 1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG No data
1092344362_1092344370 21 Left 1092344362 12:7703235-7703257 CCCAAAGTGCTGAGATTCCAGGC 0: 66
1: 13723
2: 242785
3: 276612
4: 177439
Right 1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG No data
1092344359_1092344370 30 Left 1092344359 12:7703226-7703248 CCTCGGCCTCCCAAAGTGCTGAG 0: 5533
1: 132266
2: 273114
3: 208814
4: 126129
Right 1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092344370 Original CRISPR CATACTGTACACTTTGATTT TGG Intergenic
No off target data available for this crispr