ID: 1092354699

View in Genome Browser
Species Human (GRCh38)
Location 12:7784846-7784868
Sequence CTGAGGGTAGGGTGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1345
Summary {0: 1, 1: 1, 2: 12, 3: 109, 4: 1222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092354688_1092354699 3 Left 1092354688 12:7784820-7784842 CCTTTTTACATTGGGTCAAAGGT 0: 1
1: 1
2: 0
3: 12
4: 119
Right 1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG 0: 1
1: 1
2: 12
3: 109
4: 1222
1092354686_1092354699 4 Left 1092354686 12:7784819-7784841 CCCTTTTTACATTGGGTCAAAGG 0: 1
1: 1
2: 1
3: 12
4: 158
Right 1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG 0: 1
1: 1
2: 12
3: 109
4: 1222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092354699 Original CRISPR CTGAGGGTAGGGTGGGAAGG AGG Intergenic
900015081 1:142777-142799 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900016684 1:155599-155621 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900045348 1:501386-501408 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900046945 1:514191-514213 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900067545 1:743116-743138 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900069148 1:755909-755931 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900147945 1:1166547-1166569 CTGAGGGCAGGGGGTGCAGGCGG - Intergenic
900155153 1:1200938-1200960 CTCAGTGGAGGGTGGGGAGGGGG + Intergenic
900292500 1:1929405-1929427 GTGAGGGTAGGGAGGGAGCGAGG + Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900466379 1:2827510-2827532 CTGAGCTTGGGGTGGGAACGGGG - Intergenic
900681722 1:3920268-3920290 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
901055343 1:6446540-6446562 ATGAGGCCAGGGTGGGCAGGTGG + Intronic
901059416 1:6465277-6465299 GGGAGGGCAGGGTGGGAAGCAGG - Intronic
901395582 1:8978725-8978747 CTGAGGGTGGCGTGGGAAGGTGG + Intergenic
901634505 1:10664334-10664356 CTCAGGGGAGGGTGGGCCGGGGG - Intronic
901723678 1:11221993-11222015 ATGAGGGTAGGATTGGGAGGTGG + Intronic
902214381 1:14924874-14924896 CTGGGGGAAGCGTGGGAAAGGGG + Intronic
902352175 1:15864864-15864886 AAGGGGGTAGGGTGGGGAGGTGG + Intronic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902784703 1:18725426-18725448 CTGAGGGGAGGAGGGGCAGGCGG - Intronic
902873116 1:19326023-19326045 CTGAGGGCAGGGAGGTCAGGAGG - Intronic
903002398 1:20275569-20275591 CTGAGGGGAGGAGGGGAAGAGGG + Intergenic
903049256 1:20588848-20588870 CTGAGGGGTGGGTCAGAAGGTGG - Intergenic
903255158 1:22092593-22092615 CTGGGGGTAGGGTGGGGGTGGGG + Exonic
903363486 1:22792115-22792137 CTGAAAGCAGGGTGGGAAGGAGG - Intronic
903707159 1:25294814-25294836 CTCATGTGAGGGTGGGAAGGAGG + Intronic
903720080 1:25398528-25398550 CTCATGTGAGGGTGGGAAGGAGG - Intronic
903949437 1:26987065-26987087 CTGAGAGTGGGGTGGGGAAGGGG - Intergenic
904009694 1:27382726-27382748 CGGAGTGTTGGGTGGGAGGGTGG - Intronic
904482959 1:30805518-30805540 CTGAGGCGGGGGTGGGAAGGGGG + Intergenic
904616548 1:31753169-31753191 CTGAGGTCAGGGCTGGAAGGCGG - Intronic
904831156 1:33307547-33307569 GTGAGGGTGGGGTGGGAGTGGGG - Intronic
904831167 1:33307570-33307592 GTGAGGGTGGGGTGGGAGTGGGG - Intronic
904880762 1:33695108-33695130 GCAAGGGTAGGATGGGAAGGAGG + Intronic
905046226 1:35004692-35004714 CTGAGGCGGGGGTGGGGAGGCGG + Intronic
905251056 1:36648675-36648697 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905352299 1:37356245-37356267 CTGAGGTCAGGTTGGGAAGCGGG - Intergenic
905616571 1:39404919-39404941 CTGACAGAAGGGTGGGAAGAAGG - Intronic
905858500 1:41330656-41330678 CTGAGGGCAGGGCAGGGAGGTGG - Intergenic
905923595 1:41734594-41734616 CGGAGGGCAGTCTGGGAAGGAGG + Intronic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906124594 1:43419957-43419979 CTGAGGTGGGTGTGGGAAGGAGG + Intronic
906197731 1:43939287-43939309 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
906513515 1:46424663-46424685 CAGAGAGAAGGGCGGGAAGGAGG + Intergenic
907552999 1:55319883-55319905 TTCAGGCTAGGGTGGAAAGGAGG + Intergenic
907787594 1:57627823-57627845 CTGAGGGTGGGGTGGGCAACAGG + Intronic
908396957 1:63734299-63734321 CAGAGGGTAGGGGGAGAATGGGG - Intergenic
908926451 1:69260647-69260669 CAGAGGGTGGAGGGGGAAGGAGG + Intergenic
909503270 1:76359050-76359072 CTGAGAGTAGGGTAGGAAGAAGG + Intronic
910118809 1:83761570-83761592 CTGAGGGGTGGGTGGGCAGGGGG - Intergenic
910269776 1:85381489-85381511 CTGGGGGAAGGTTGGGAGGGGGG - Intronic
910681551 1:89870674-89870696 CTGAGGGGAAGGTGGGGAGGGGG - Intronic
910695687 1:90012439-90012461 CTTAGGGTAGGGTTGAAATGGGG + Intronic
910772526 1:90844377-90844399 CTATGGGGAGGGTAGGAAGGAGG - Intergenic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
911553931 1:99319110-99319132 CTGAAGCTTGGTTGGGAAGGTGG - Intergenic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
911669932 1:100596426-100596448 CTGGGGGTGGAGTGGGCAGGGGG - Intergenic
911689623 1:100818208-100818230 AGGGGGGAAGGGTGGGAAGGGGG + Intergenic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
912033314 1:105276913-105276935 AGGAGGGAAGGGTGGGAGGGGGG + Intergenic
912422483 1:109553852-109553874 CGGGGGAAAGGGTGGGAAGGTGG - Intronic
912511734 1:110194556-110194578 CTGAAGGTGGGGTGGAAAGCAGG - Intronic
912552595 1:110493972-110493994 CTGAGTGTGTGCTGGGAAGGGGG - Intergenic
912707614 1:111926609-111926631 CTGAGGCTAGAGTGGGGAAGTGG + Intronic
912746479 1:112249531-112249553 CTGAGGGTGGGGGTGGAGGGTGG - Intergenic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
913262338 1:117010900-117010922 CTGAGGATGTGGTGGGAAAGAGG - Intronic
913283001 1:117203234-117203256 CTGAGGCTGGGGTGGGGAGAAGG + Intronic
913403067 1:118457313-118457335 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
913445235 1:118943967-118943989 CTGAAGGTGGTGTGGGATGGTGG - Intronic
913954958 1:143281136-143281158 ATGAGGGAAGGATGGGAGGGAGG - Intergenic
913963681 1:143357567-143357589 GGAAGGGGAGGGTGGGAAGGGGG - Intergenic
913982481 1:143534305-143534327 ATGAGGGAAGGATGGGAGGGAGG + Intergenic
914058040 1:144183156-144183178 GGAAGGGGAGGGTGGGAAGGGGG - Intergenic
914121105 1:144783209-144783231 GGAAGGGGAGGGTGGGAAGGGGG + Intergenic
914455609 1:147833630-147833652 CTCAGGGGAGGGTGGGAATCTGG - Intergenic
914457123 1:147846429-147846451 CTGATGGAAAGCTGGGAAGGAGG + Intergenic
914827293 1:151145475-151145497 TTGGGGGTTGGGTGGGAAGGAGG - Intronic
914862629 1:151399304-151399326 ATGAAGGTGGGGTGGGGAGGTGG - Intergenic
915463006 1:156081040-156081062 CTGAGTGTAGGAATGGAAGGGGG - Intronic
915480048 1:156178270-156178292 CAGAGGGTAGAGGAGGAAGGTGG - Intergenic
915681574 1:157586478-157586500 GTGGGGGTCGGGTGTGAAGGAGG + Intronic
916437569 1:164791081-164791103 GTGTGGGTAGGGTGGGAAAGAGG - Intronic
916742383 1:167657602-167657624 CAGAGGGGAGGGGAGGAAGGAGG - Intronic
916855868 1:168749019-168749041 TCGAGGGAAGGGTGGGAGGGAGG - Intergenic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
917740154 1:177953850-177953872 CTGAGAGTAGGGTGGGGGTGTGG - Intronic
918146454 1:181760246-181760268 ATGGGGGTAGGGTGGGAAGGAGG - Intronic
919485212 1:198137748-198137770 CGGAGGAAAGGGTGGGAGGGTGG - Intergenic
919775551 1:201191978-201192000 CTGAGGGGTGGGTGGGATGGGGG + Intronic
919924679 1:202186238-202186260 CTGAGAAGGGGGTGGGAAGGGGG - Intergenic
919933336 1:202235800-202235822 CTGAGGCTGGGGTGAGAAGGAGG + Intronic
920442018 1:205987133-205987155 CTGAGGTTGGGGTGGGGAGGAGG - Intronic
920626842 1:207611065-207611087 GTGAGGGTAGGGAGGGGAGGTGG - Intronic
920919238 1:210284511-210284533 CGGATGGGAGGGTGGGAGGGAGG + Intergenic
920998785 1:211021150-211021172 AGGAGGAAAGGGTGGGAAGGGGG + Intronic
921331367 1:214041054-214041076 TTGTGGGGAGGGTGGGAAAGGGG + Exonic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
922025515 1:221744681-221744703 CAGAGGGTTGCCTGGGAAGGCGG + Intergenic
922102148 1:222485889-222485911 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922104509 1:222501301-222501323 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922212351 1:223495848-223495870 TTGAGGGCAGGGTGGGTAGTGGG - Intergenic
922263231 1:223961000-223961022 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922264827 1:223973814-223973836 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922328592 1:224553823-224553845 CTGAGGGTAGTGGGAGAAAGAGG - Intronic
922387334 1:225099948-225099970 TTGAGGCTAGGGTGGGAGAGGGG + Intronic
922889757 1:229052582-229052604 GTGGGGGAAGGGTGGGAGGGGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923996811 1:239504907-239504929 TGGGGGGAAGGGTGGGAAGGGGG + Intronic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
924345071 1:243066009-243066031 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
924346684 1:243078820-243078842 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
924602579 1:245504391-245504413 ATGAAGGGAGGGAGGGAAGGAGG - Intronic
924784512 1:247183128-247183150 CTGAGTGTGGGGTGGGAGGAAGG - Intergenic
924845622 1:247767184-247767206 GGGAGGAAAGGGTGGGAAGGGGG - Intergenic
1062818430 10:516817-516839 CAGGGGGTAGGGTGGGAGGGGGG + Intronic
1062966052 10:1608630-1608652 ATGAAGGGAGGGAGGGAAGGAGG + Intronic
1063049446 10:2430861-2430883 CGGAGGGAAGGGAGGGAGGGAGG + Intergenic
1063124907 10:3129115-3129137 CTGATGTATGGGTGGGAAGGCGG + Intronic
1063709717 10:8465448-8465470 TTGAGGGTAGGGGTGGGAGGAGG + Intergenic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1064225814 10:13483821-13483843 CTGGGGGTACGGGAGGAAGGGGG + Intronic
1064437018 10:15319374-15319396 CAGAGGGAAGGATGGGATGGGGG + Intronic
1064605030 10:17030276-17030298 CCGGGGGTGGGGTGGGAGGGTGG - Intronic
1065198136 10:23286563-23286585 GGGAGGGAAGGGTGGGAAGGAGG + Intronic
1065817530 10:29495601-29495623 CTGAGGGGAGGGAGGGACAGTGG + Intronic
1065955331 10:30688797-30688819 CTGAGGGGAGGGAGGGACAGTGG - Intergenic
1066022661 10:31319163-31319185 CGGAGGGGTGGGGGGGAAGGGGG + Exonic
1066027053 10:31369359-31369381 CAGAGGCTAGGGTAGGAGGGTGG - Intronic
1066381542 10:34906167-34906189 CCGAGGGAAGGCAGGGAAGGCGG - Intergenic
1066598692 10:37080137-37080159 GTGTGTGTTGGGTGGGAAGGTGG + Intergenic
1066696620 10:38084702-38084724 ATGAGGGTGGGGTGGGAGGAGGG + Intergenic
1066729665 10:38426029-38426051 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1067005529 10:42657339-42657361 AAGGGGGGAGGGTGGGAAGGGGG - Intergenic
1067043384 10:42970311-42970333 GTGGGGGTTGGGTGGGAAGGAGG + Intergenic
1067083760 10:43227606-43227628 GTGTGGGTAGGGTGGCCAGGAGG + Intronic
1067327205 10:45280975-45280997 CTGGGGGCAGGGTCGGAGGGGGG - Intergenic
1067428907 10:46229124-46229146 CTAAGAGTAGGTTGGGAGGGTGG - Intergenic
1067456887 10:46425505-46425527 CAGAGGGTAGGGGGAGAACGTGG - Intergenic
1067684371 10:48457950-48457972 GTTGGGGTTGGGTGGGAAGGGGG + Intronic
1067820082 10:49520764-49520786 CTGAGGACAGGGAGGGCAGGTGG - Intronic
1067932083 10:50572322-50572344 GTGAGGGAAGGGTGGTAACGAGG + Intronic
1068106975 10:52630773-52630795 GTGAGGGCACAGTGGGAAGGCGG - Intergenic
1068637449 10:59362924-59362946 CTGGGGGTGGGGTGGGAGTGTGG - Intronic
1068756371 10:60658825-60658847 GGAAGGGTAGGGAGGGAAGGAGG + Intronic
1068807830 10:61219492-61219514 CTAAGGAGAGGGAGGGAAGGAGG - Intergenic
1068830224 10:61485432-61485454 CAGGGGGTAGGGTGAGGAGGAGG + Intergenic
1069581349 10:69569064-69569086 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1069637760 10:69936062-69936084 GTGAGGGAAGGGAGGGAGGGAGG + Intronic
1069883152 10:71606739-71606761 CAGGGGTGAGGGTGGGAAGGTGG + Intronic
1070154059 10:73822750-73822772 CTGAATGGTGGGTGGGAAGGAGG - Intronic
1070572354 10:77649948-77649970 CTGAGGCTGGGGTGGGGGGGTGG + Intergenic
1070751263 10:78965318-78965340 CTGGGGGCAGGGCGGGGAGGAGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071020867 10:81053670-81053692 CTGAGGCTGCGGTGGGATGGCGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071496649 10:86172165-86172187 CAGGGGCTAGGGTGGGATGGGGG - Intronic
1072694497 10:97593127-97593149 CTGAGAGTTGGCTGGGAGGGTGG + Intronic
1072719193 10:97770537-97770559 CTGAGGGGTGGGTGGGAGGAGGG + Intronic
1073075927 10:100825946-100825968 GTGAGGGAAGAGTGGGGAGGTGG + Intronic
1073091110 10:100940720-100940742 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1073214188 10:101827581-101827603 ATGGGGGTGAGGTGGGAAGGTGG + Intronic
1073348472 10:102802009-102802031 TGGGGGGAAGGGTGGGAAGGTGG - Intronic
1073563313 10:104515462-104515484 CTGAGGGTTGGGTGGGAGTGGGG - Intergenic
1073619587 10:105032894-105032916 TAGAGGGTGGGGTGGGAATGTGG + Intronic
1073847307 10:107571831-107571853 CAGGGGTAAGGGTGGGAAGGGGG + Intergenic
1074063021 10:109985094-109985116 TGGAGGAAAGGGTGGGAAGGGGG - Intergenic
1074791102 10:116888485-116888507 CTGACAGTTGGGAGGGAAGGCGG + Intronic
1074810402 10:117099225-117099247 CTCAGGGTGGGGAGGTAAGGAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075497785 10:122941863-122941885 CTGAGGGTGGGGTGGCATGGGGG + Intronic
1075618060 10:123905780-123905802 GTGAGGGTGGGGTGGGAGGCAGG - Intronic
1075635229 10:124026131-124026153 CTGAGGGTAGGGGAGGACTGGGG + Intronic
1075683134 10:124346500-124346522 CTGGAGGGAGAGTGGGAAGGAGG - Intergenic
1076372940 10:129966827-129966849 CTGAGGGTGGGATGGGGTGGGGG - Intergenic
1076378690 10:130010497-130010519 TTCAGGCTATGGTGGGAAGGGGG - Intergenic
1076408609 10:130230505-130230527 GTGAGGGTAGGGTGGGGTTGGGG + Intergenic
1076488551 10:130840396-130840418 GGGATGGTAGGGTGGGGAGGAGG - Intergenic
1076488561 10:130840418-130840440 GGGATGGTAGGGTGGGGAGGAGG - Intergenic
1076488589 10:130840484-130840506 GGGATGGTAGGGTGGGAAAGAGG - Intergenic
1076488604 10:130840528-130840550 GCGATGGTAGGGTGGGGAGGAGG - Intergenic
1076488612 10:130840550-130840572 GGGATGGTAGGGTGGGGAGGAGG - Intergenic
1076574233 10:131453382-131453404 CTGAGGGGAGGGGGTGTAGGCGG + Intergenic
1076732774 10:132446714-132446736 AGGAGGGTGGGGTGGGCAGGAGG + Intronic
1076853171 10:133103010-133103032 CTGAGGGTAGGGTGGTGTGCTGG + Intronic
1076971675 11:137877-137899 ATGAGAGTTGGGAGGGAAGGGGG - Intergenic
1076973274 11:150668-150690 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1077178210 11:1200089-1200111 CTGAGGGTGAGGCGGGAAAGGGG + Intronic
1077385830 11:2269121-2269143 CTGAGGCTGCGGGGGGAAGGTGG + Exonic
1077479048 11:2804460-2804482 ATGAGGGGAGGGAGGGATGGAGG + Intronic
1077853194 11:6095794-6095816 CTGAGGGGCGAGTGGGAAGTGGG + Intergenic
1077921155 11:6642622-6642644 CTGAGGGTGGGGTGGGGTGGGGG + Intronic
1077975795 11:7247247-7247269 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1078148344 11:8737850-8737872 ATGAGGCTAAGGTGGGAAGATGG - Intronic
1078350143 11:10586196-10586218 TTGTGGGTAGGGTGGCAAGTGGG + Intronic
1078658065 11:13260941-13260963 CTGAGGTGAGGGTGGGGTGGAGG - Intergenic
1078797905 11:14611749-14611771 TGGAAGGGAGGGTGGGAAGGAGG - Intronic
1079822527 11:25148423-25148445 TAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1079862603 11:25692835-25692857 CTGAGGGAAAGGGTGGAAGGGGG - Intergenic
1080321876 11:31019480-31019502 GTGGGGGTGGGGTGGGGAGGTGG + Intronic
1080387279 11:31817632-31817654 CTGAGGGAGGGATAGGAAGGGGG - Intronic
1080563452 11:33485774-33485796 CTGGGGTTGGGGTGGGAATGGGG - Intergenic
1080585399 11:33676990-33677012 ATGAGGAAAGGGTGGGAAGGGGG - Intergenic
1080808900 11:35682620-35682642 CAGAGAGTGGGGTGGGGAGGTGG + Intronic
1080893150 11:36427028-36427050 CAGAGGGTGGGTTGGAAAGGTGG - Intronic
1080970145 11:37264412-37264434 GTGAGAGTAGGATGGGAAGATGG + Intergenic
1081091510 11:38872751-38872773 AAGAGGGTAGGGTGGGAGGGAGG - Intergenic
1081154861 11:39677480-39677502 CTGAGCCTAGCGAGGGAAGGAGG + Intergenic
1081537208 11:44004685-44004707 CTGAGGATAGGGCGGGCAGATGG - Intergenic
1081710847 11:45214393-45214415 CTGGGGGCAGGATGGGAGGGTGG - Intronic
1081846765 11:46246364-46246386 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
1081864133 11:46350497-46350519 ATGTGGGTGGGGTGGGGAGGGGG - Intronic
1082038716 11:47667172-47667194 CAGAGGGTATGGTGGGAGTGTGG + Intronic
1082076985 11:47981665-47981687 GTGAGGGTGGGGTGGGGAGGGGG - Intronic
1082262424 11:50087179-50087201 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1082971951 11:59031959-59031981 CCTAGGGTAGTGTGGAAAGGGGG - Intronic
1083068987 11:59956702-59956724 CTCAGGGAAGAGTGGGAAAGGGG - Intergenic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083294900 11:61710005-61710027 CTCAGGGTAGGCTGGGCAAGGGG + Intronic
1083482930 11:62961242-62961264 GTGAGGACATGGTGGGAAGGCGG + Intronic
1083497450 11:63069598-63069620 AGGGGGATAGGGTGGGAAGGGGG - Intergenic
1083609125 11:63996834-63996856 CTGGGGGTGGGATGGAAAGGCGG - Intronic
1083610689 11:64002844-64002866 CTTGGGGTGGGGTGGGAAGAGGG - Intronic
1083994099 11:66263752-66263774 GTGAGGGTTGGGTGGGAGGTGGG + Intronic
1084155241 11:67309603-67309625 CTGATGGCAGAGTGGGCAGGAGG - Intronic
1084220989 11:67679019-67679041 TGGAGGGAAGAGTGGGAAGGGGG + Intronic
1084394302 11:68898746-68898768 CTGAGGGTGGGGAGGGGAAGTGG - Intronic
1084507016 11:69574725-69574747 CTGAGTGGATGGTGGGAGGGAGG - Intergenic
1084566346 11:69931066-69931088 GTTAGGGTGGGGTGGGGAGGTGG + Intergenic
1084855377 11:71981668-71981690 CTGAGGGAAGGCTCTGAAGGAGG + Intronic
1085304219 11:75476087-75476109 CTGAGGCTAAGGTGAGAAGAAGG - Intronic
1085305147 11:75481653-75481675 CTGCGGGAAGGCTGGGAATGTGG - Intronic
1085479098 11:76806962-76806984 GAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1085608831 11:77928075-77928097 CTGAGGTGAGGTTGGGAAGAAGG - Intronic
1085806710 11:79643226-79643248 AGGAAGGAAGGGTGGGAAGGAGG + Intergenic
1085823414 11:79817527-79817549 CAGAGAGCAGCGTGGGAAGGAGG + Intergenic
1086151342 11:83614133-83614155 TTCAGTGTAGGGTGGGGAGGTGG + Intronic
1086597868 11:88595402-88595424 TAGAGGGTAGGAAGGGAAGGAGG - Intronic
1087585996 11:100122209-100122231 GTGATGGTGGGGTGGGGAGGTGG + Intronic
1087829662 11:102805620-102805642 AGGAGGAAAGGGTGGGAAGGGGG + Intergenic
1087906100 11:103699707-103699729 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088796750 11:113271926-113271948 GTGGGGGTAGGGTGGGGAGGTGG - Intronic
1088824697 11:113483820-113483842 CTGAGGGAAGGCTGGGAACATGG - Intergenic
1088842674 11:113639930-113639952 CTTAGGGTAGGATGGGGAGAGGG + Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089029382 11:115308767-115308789 ATGAAGGGAGGGAGGGAAGGAGG - Intronic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089160219 11:116431729-116431751 AGGTGGGTAGGGTGGGATGGGGG - Intergenic
1089238503 11:117053646-117053668 GAGGGGGTAGGGTGGGAGGGGGG - Intronic
1089537230 11:119168442-119168464 CTGAAGGTAGGCTGGGGAGGCGG + Intronic
1089619336 11:119713527-119713549 CTGGGGTAAGGGTGGGGAGGGGG - Intronic
1089850864 11:121495327-121495349 CTGAGGCCAGGGTAGGGAGGGGG - Intronic
1089860551 11:121586681-121586703 CTGGGGGTAGAGTGGGGGGGGGG + Intronic
1089880853 11:121771994-121772016 CTCAGGGTAGGATGGCAAAGTGG + Intergenic
1090244010 11:125202865-125202887 CTGGGGGTAGAGAGGAAAGGTGG - Intronic
1090352836 11:126118506-126118528 TGCAGGGAAGGGTGGGAAGGGGG + Intergenic
1090547687 11:127783165-127783187 CAGTGGGGAGGGTGGGGAGGGGG + Intergenic
1090551687 11:127826791-127826813 CTGGGGGTGGAGTGGGAGGGAGG - Intergenic
1090595614 11:128318191-128318213 CAGGGAGAAGGGTGGGAAGGGGG - Intergenic
1090931547 11:131302011-131302033 TTGTGGGTTGGGTGGGAAAGGGG + Intergenic
1091111125 11:132969100-132969122 CAGGGGGAAGGGTGGGAGGGGGG - Intronic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091235620 11:134020380-134020402 TTGAGGGAAGGGCAGGAAGGAGG - Intergenic
1091268290 11:134287803-134287825 CAGAGGGTGAGGCGGGAAGGAGG + Intronic
1091353518 11:134916184-134916206 AGGAGGGCAGGGTGGGGAGGAGG - Intergenic
1091418959 12:318041-318063 CAGAAGGTAGAGTGGGAAGAAGG - Intronic
1091807514 12:3366600-3366622 ATGAGGGGAGGGGAGGAAGGGGG - Intergenic
1092218933 12:6700212-6700234 CTGCGGGATGGGTGGGATGGGGG - Exonic
1092330084 12:7578752-7578774 AACAGGGTAGGTTGGGAAGGGGG - Intergenic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092367037 12:7884878-7884900 CTGAGGGTAGGGTGGGAAAGAGG + Intronic
1093132001 12:15403178-15403200 CAAAGGGTAGTGTGGCAAGGTGG - Intronic
1093287425 12:17281948-17281970 AGGAGGAAAGGGTGGGAAGGGGG - Intergenic
1093958824 12:25251045-25251067 CTGAGGGCGGTGTGGGAAGAGGG + Intergenic
1094484610 12:30914653-30914675 CTGAGCCTGGGGTGGGAGGGTGG + Intergenic
1095582757 12:43819114-43819136 CGGAGGGGAGGAGGGGAAGGAGG + Intergenic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1095954022 12:47796329-47796351 CAGAGGCCAGGGTGGGCAGGAGG + Intronic
1096036239 12:48473565-48473587 GTGAGGGAAGGGAGGGGAGGAGG + Exonic
1096330504 12:50708084-50708106 CTGAGGGCAGGGTGGCTCGGGGG - Intronic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096499420 12:52055976-52055998 CAGAGTGTGGGGTGGGGAGGGGG - Intronic
1096616141 12:52834524-52834546 CTGGGGGCAGGGGGAGAAGGTGG - Intergenic
1096683132 12:53270099-53270121 CTGGAGGTAGGGTGGGGACGTGG + Intronic
1096807484 12:54149305-54149327 CTGGGGGTTGGCTGGGAAGGGGG + Intergenic
1096862508 12:54539986-54540008 CTGAGGGTGGGAGGAGAAGGGGG + Intronic
1097177993 12:57154413-57154435 CTGAGGCTACAGTGGTAAGGAGG + Intronic
1097232923 12:57523048-57523070 CAGAGGGTAGGGACGGGAGGGGG - Intronic
1097769543 12:63566450-63566472 GTTAGGGTGGGGTGGGAATGTGG - Intronic
1097933289 12:65214815-65214837 TGGAGGGTAGGGTGGGGAGGGGG - Intronic
1098003738 12:65972505-65972527 CTGAAGGAAGGGTGGTGAGGAGG + Intergenic
1098323845 12:69279733-69279755 CTGGGGCTAGGGTGGGAATGGGG - Intergenic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1099014754 12:77331000-77331022 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1099476668 12:83116069-83116091 AGGAGGAAAGGGTGGGAAGGTGG - Intronic
1100153859 12:91773883-91773905 AAAAGGCTAGGGTGGGAAGGTGG + Intergenic
1100202400 12:92313576-92313598 AGGAGGAAAGGGTGGGAAGGGGG - Intergenic
1100456353 12:94755296-94755318 AGGAGGAAAGGGTGGGAAGGGGG + Intergenic
1100691010 12:97038504-97038526 CAGAGGTTGGGGTGGGGAGGGGG - Intergenic
1100691559 12:97043748-97043770 CAGAGGGAAGGGTGGGAGTGGGG + Intergenic
1101348287 12:103905626-103905648 AGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1101442309 12:104712963-104712985 TGGAGGGGAAGGTGGGAAGGGGG - Intronic
1101601691 12:106215362-106215384 CTGAGGTTAGGTGGGGAAGTGGG + Intergenic
1101752792 12:107596745-107596767 AGGAGAGTAGGGAGGGAAGGAGG - Intronic
1102025039 12:109709649-109709671 CTGGGGGTGGGGTGGGAGGCTGG + Intergenic
1102512670 12:113426127-113426149 GTGAGGGTAGGGGGTGAGGGCGG - Intronic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102579701 12:113878561-113878583 CTCAGGGCAGGGTGGTAAGGTGG - Intronic
1102732096 12:115120631-115120653 TTGAGGGTGGGGGGGGAAGAGGG + Intergenic
1102733018 12:115131155-115131177 CAGGGGAAAGGGTGGGAAGGAGG - Intergenic
1102784508 12:115593377-115593399 CAGGGGAAAGGGTGGGAAGGTGG - Intergenic
1102937498 12:116910228-116910250 ACGAGGGGAGGGTGGGAAGGTGG - Intergenic
1103037511 12:117668290-117668312 CCGTGGGTGGGCTGGGAAGGAGG - Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103255819 12:119540540-119540562 TTGAGGGGAGGGAGAGAAGGTGG + Intronic
1103287627 12:119815851-119815873 TTGGGCGTGGGGTGGGAAGGAGG + Intronic
1103946879 12:124531877-124531899 CTGGGAGTGGGGTGGGGAGGTGG - Intronic
1104009127 12:124916649-124916671 ATGAGGGTAGGGTGGGTAATGGG + Intronic
1104072806 12:125361132-125361154 CTGAGGGTGGGCTGGGCAGCGGG - Intronic
1104081058 12:125430918-125430940 CTGAAGGGAGTGTGGGGAGGAGG + Intronic
1104167902 12:126251598-126251620 ATGAGGGAAGGCTGGGAGGGAGG + Intergenic
1104348992 12:128028661-128028683 CTGTGGGCAGGGCGGGAATGTGG + Intergenic
1104675522 12:130709729-130709751 CGCTGGGTTGGGTGGGAAGGGGG - Intronic
1104690162 12:130819311-130819333 AAGAGGGGAGGGTGGGAGGGAGG - Intronic
1104893432 12:132150922-132150944 CAGGGGGTAGGGTGGGAGCGAGG + Intronic
1104899387 12:132180371-132180393 GTGAGGGCACGGTGAGAAGGTGG + Intergenic
1105597737 13:21855328-21855350 CGGGGGGAAGGGTGGGAGGGGGG - Intergenic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1105985730 13:25564856-25564878 TTGGGGGAAGGGTGGGAGGGAGG - Intronic
1106142050 13:27019743-27019765 CTGAGGGAAGCGTGAGAATGTGG + Intergenic
1106232359 13:27830398-27830420 CTGGGGTAAGGGTGGGAAGGGGG + Intergenic
1106251786 13:27987440-27987462 CTGAGGGATGGAGGGGAAGGAGG - Intronic
1106339649 13:28816727-28816749 AAGAGGGGAGGGTGGGCAGGGGG - Intergenic
1106381969 13:29248240-29248262 CTTGGGGAAGGGTGGGAGGGGGG + Intronic
1106583671 13:31038598-31038620 CTGATAGTTGGATGGGAAGGGGG + Intergenic
1106961514 13:35003930-35003952 GTCAGGGTAGGGTGGGAGGAGGG - Intronic
1107251802 13:38372623-38372645 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1107396517 13:40023556-40023578 CATGGGGTAGGGTGGGAATGGGG + Intergenic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1108648588 13:52453997-52454019 CTGAGGGTAGGGGGAGAATTGGG - Intergenic
1109520321 13:63501909-63501931 CTGAGTGTAAGGTGGGAAGGTGG + Intergenic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1109673081 13:65636401-65636423 GTGGGGGTAGGGTGGGGAGGGGG - Intergenic
1110544768 13:76744129-76744151 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1111879954 13:93943824-93943846 CTGAGGACAAGCTGGGAAGGAGG + Intronic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1112441419 13:99427097-99427119 CGGAGGGTAGGGTGGGAGGGAGG + Intergenic
1112441427 13:99427114-99427136 GGGAGGGCAGGGTGGGAGGGAGG + Intergenic
1112879134 13:104084667-104084689 TTGGGGGAAGGGTGGAAAGGGGG - Intergenic
1113002094 13:105652244-105652266 CTGGGGGAAGGGGGGGAATGAGG + Intergenic
1113264416 13:108601684-108601706 CTCAGGGCAGGGTTGGAAGTTGG - Intronic
1113476951 13:110590747-110590769 AGGAGGGCAGGGCGGGAAGGTGG - Intergenic
1113522457 13:110950523-110950545 CTGAGGGCATGGTGGGCATGAGG - Intergenic
1113600250 13:111563375-111563397 GTGAGGGGAGGGAGGGAAAGAGG - Intergenic
1113663055 13:112120161-112120183 ATGAGGGAAGGGTGGGAGGCAGG + Intergenic
1114454504 14:22846247-22846269 CTGAGGGCTGAGTGGGAGGGCGG + Exonic
1114523509 14:23352997-23353019 CCCAGGGGAGGGAGGGAAGGGGG + Intergenic
1115258994 14:31433797-31433819 CTGAAGGTAGGGAGGAAATGGGG + Intronic
1115350180 14:32385555-32385577 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1115707207 14:36011577-36011599 GTGTGGAAAGGGTGGGAAGGGGG - Intergenic
1116031417 14:39577217-39577239 GTTAGGGTAGGGGGTGAAGGGGG - Intergenic
1116232028 14:42229486-42229508 TGGAGGGTGGGGTGGGATGGTGG + Intergenic
1116330575 14:43592489-43592511 GTGGGGGGAGGGTGGGAAGTGGG - Intergenic
1116809549 14:49525903-49525925 CTGAGGAGAGGATGGGAAGCAGG + Intergenic
1116844600 14:49853482-49853504 ATGGGGGTGGGGTGGGAGGGGGG + Intergenic
1117440031 14:55750965-55750987 CAGAGGCTGGGGTGGGAGGGGGG - Intergenic
1117457441 14:55912279-55912301 CAGAGGGCATGGTGGGGAGGGGG + Intergenic
1117773835 14:59162049-59162071 CTGAGCATGGGGTGGGAGGGTGG + Intergenic
1117812449 14:59562573-59562595 CTGATGGAGGGGTAGGAAGGTGG + Intronic
1118476313 14:66120710-66120732 CAGAGGGGTGGGTGGGATGGGGG + Intergenic
1118479886 14:66153712-66153734 TTGAGGGTGGGGTGGGGTGGGGG + Intergenic
1118785747 14:69044138-69044160 CTGAGGGGAGGAGGGGAAAGAGG + Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1120723296 14:87910742-87910764 CTGAGGGTAGAGGAGGGAGGAGG - Intronic
1121099780 14:91242507-91242529 CTGATGGAAGGGTGGGTGGGTGG + Intronic
1121104055 14:91269468-91269490 CTGAGGGTGGGGTGGGAATCTGG - Intergenic
1121516079 14:94550825-94550847 TTGAGGGAAAGGTGGGAGGGGGG - Intergenic
1122096511 14:99376608-99376630 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1122126329 14:99580465-99580487 GTGAGGGGAGGGGGGGAAGGGGG + Intronic
1122128460 14:99591662-99591684 CGGTGGGGAGGGTGGGGAGGTGG + Intronic
1122234404 14:100323665-100323687 CTGAGGGCAGGCTGGGGATGGGG + Intronic
1122418759 14:101562720-101562742 CTGAGGGCACGCTGGGGAGGGGG - Exonic
1122542434 14:102505789-102505811 CTGGGGGCAGGGTGGGCAGCAGG + Exonic
1122572751 14:102718575-102718597 CTGAGGGTTGGGTGGGAGGGTGG + Intronic
1122741642 14:103875083-103875105 CAGATGGAAGGGTGGGTAGGTGG + Intergenic
1122769807 14:104092945-104092967 AGGAGGGTGGGGAGGGAAGGTGG - Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1123503625 15:20915489-20915511 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123560872 15:21489163-21489185 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123597111 15:21926454-21926476 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123767398 15:23495161-23495183 GTGGGGGTAGGGTGGGAGGGAGG + Intergenic
1124477204 15:30045297-30045319 TGGCGGTTAGGGTGGGAAGGGGG + Intergenic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1125270668 15:37935413-37935435 CTTGGGGTAGGGTGCGGAGGTGG - Intronic
1125576204 15:40757315-40757337 CTGTGGAGGGGGTGGGAAGGTGG - Intergenic
1125792027 15:42374225-42374247 CTGAGGGTGCAGTGGGAAAGAGG + Intronic
1126405162 15:48315695-48315717 TTAAGGGTGGGGTGGGGAGGGGG + Intergenic
1126663352 15:51053585-51053607 CTGAGGGCAAGGTGGGGAGAAGG - Intergenic
1127369826 15:58329403-58329425 CTGAGGGTAGGAAGAGTAGGAGG + Intronic
1127707590 15:61562453-61562475 TTGAGGGTTGGGTGGGAGGGAGG + Intergenic
1127761705 15:62146180-62146202 GTGAGGGTAGGGAAGGAGGGTGG - Intergenic
1128261856 15:66238212-66238234 CTCAGGGTGGGTTGGGGAGGGGG - Intronic
1128308749 15:66617466-66617488 ATGAGGGCTGGGTGGGCAGGAGG - Intronic
1128443023 15:67731170-67731192 CAGAGGGTAAAGTGGGGAGGAGG + Intronic
1128515390 15:68338861-68338883 CAGAGGGGAGGGCGGCAAGGGGG - Intronic
1128614129 15:69096264-69096286 CTCAGGGGAGGCTGGGAGGGAGG - Intergenic
1128645559 15:69376398-69376420 CTAAGGCTAGAGTGGGAAGACGG + Intronic
1128655735 15:69460659-69460681 CAGAGGCTAAGGTGGGAAGATGG - Intergenic
1128849299 15:70935847-70935869 ATAAGGGTGTGGTGGGAAGGTGG - Intronic
1129227380 15:74177957-74177979 ATGAGGGGAGAGTGGGCAGGGGG - Intergenic
1129334040 15:74842002-74842024 CTGGGGGAGGGGTGGGATGGTGG + Intronic
1129643526 15:77408385-77408407 CAGGGGGAAGGGTGGGAGGGGGG + Intronic
1129709698 15:77814314-77814336 CTGAGGGCACGGTGGGAAGTGGG - Intronic
1129814769 15:78541658-78541680 CCGGGGGTAGGGTGGGAAAAGGG - Intronic
1129850349 15:78790160-78790182 CGGAGGTTAGGGGAGGAAGGTGG + Intronic
1129888736 15:79057123-79057145 CTGAGGGTTGGGGGTGATGGTGG - Intronic
1130071885 15:80654441-80654463 CTGAGTGTTGTGAGGGAAGGAGG - Intergenic
1130141219 15:81227945-81227967 CTGGGGGTAGTAGGGGAAGGAGG + Intronic
1130427032 15:83811691-83811713 CTTGGGGTAGAGTAGGAAGGAGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130931165 15:88429154-88429176 CTGCAGGTAGGGTGGGTATGTGG - Intergenic
1131114159 15:89784008-89784030 CTGAGAGGAGGGGGAGAAGGCGG - Intergenic
1131184419 15:90262869-90262891 ATGAGGGTAGAGTGGGCAGGAGG + Intronic
1132145248 15:99425587-99425609 TAGAGGGCAAGGTGGGAAGGAGG + Intergenic
1132243125 15:100276046-100276068 CTGGTGGGAGGGTGGGAGGGAGG + Intronic
1132424908 15:101707688-101707710 CTGGGGGCAGGGCGGGAATGGGG + Intronic
1202969217 15_KI270727v1_random:216327-216349 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1132531216 16:450841-450863 CTAAGGGTGGGGTGGGGTGGGGG - Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133196578 16:4175083-4175105 CTAGGAGTAGGGTGGGGAGGAGG + Intergenic
1133320302 16:4909379-4909401 CTGAGGGTGGGGAGGTCAGGAGG - Intronic
1133324799 16:4936295-4936317 CAGAGGGTGGGGAGGTAAGGGGG + Intronic
1133335703 16:5005413-5005435 GTGACGGTGGGGTGGGAATGGGG + Intronic
1133696251 16:8265826-8265848 AAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1134111761 16:11519355-11519377 ATGAGTGGAGGGTGGGGAGGGGG + Intronic
1134128107 16:11630198-11630220 CTGAGGCTAGGAGGGGAAGTTGG - Intronic
1134288619 16:12884247-12884269 GGGTGGGAAGGGTGGGAAGGGGG + Intergenic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1135063067 16:19287280-19287302 GTGAGGGTACAGTGAGAAGGCGG - Intronic
1135117084 16:19732931-19732953 CTGAGGGGAGTGTGGGCAGCAGG + Intronic
1135150874 16:20004678-20004700 CTGAGGGTCGGGGGAGCAGGGGG - Intergenic
1135232169 16:20719013-20719035 CTGAGAGTAGAGTGGGAGGCTGG - Intronic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1136143608 16:28302452-28302474 CTCTGGGCAGGGTGTGAAGGGGG + Intronic
1136169813 16:28482199-28482221 CTGAGGTTAGGGTTGGGGGGAGG + Intronic
1136247692 16:28984975-28984997 TGGCGGGTGGGGTGGGAAGGGGG + Intronic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136416639 16:30108265-30108287 CTGGGGGTGGGGTGGGGACGTGG + Intronic
1136540918 16:30927340-30927362 GTGTGGGGAGGCTGGGAAGGAGG + Exonic
1136597605 16:31262310-31262332 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1137889641 16:52145560-52145582 CTGGGGGTGGGGCGGGAAGTAGG + Intergenic
1138044338 16:53705136-53705158 TTGAGGGAAGGGAGAGAAGGTGG - Intronic
1138476145 16:57271716-57271738 CAGAGGGCAGGATGGGAACGGGG - Intronic
1138635979 16:58338781-58338803 GTTGGGGAAGGGTGGGAAGGAGG - Intronic
1138695586 16:58810011-58810033 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1138736758 16:59259873-59259895 TTGTGGGTGGGGTGGGATGGGGG + Intergenic
1138938950 16:61766134-61766156 AAGGGGGTAGGGTGGGAGGGAGG - Intronic
1139061257 16:63254418-63254440 CGGGGGGAAGGGTGGGAGGGGGG + Intergenic
1139495839 16:67316827-67316849 GTGGGGGTTGGGTGGGCAGGTGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1139782604 16:69364298-69364320 CTCAGGGAAGGGAGGGAGGGAGG - Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140620238 16:76720880-76720902 TTGCGGGAAGAGTGGGAAGGGGG + Intergenic
1140811683 16:78584969-78584991 CTGAGGGTTGGGTGCCAAAGAGG + Intronic
1140914621 16:79482969-79482991 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1140914716 16:79483205-79483227 GGGAGGGGAGGGAGGGAAGGAGG - Intergenic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141540168 16:84713946-84713968 CTGGGGGTTGGCTGGGAAGGTGG + Intronic
1141604383 16:85144574-85144596 CTGGGGGTAGGGAAGGGAGGAGG + Intergenic
1141611958 16:85186953-85186975 CTGAGGGGCTGGTGGGAAAGAGG - Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141693672 16:85610301-85610323 GGGAGTGGAGGGTGGGAAGGAGG + Intergenic
1141774780 16:86116000-86116022 CTGAGGCCAGGGTGGGGAGGGGG - Intergenic
1141778231 16:86138680-86138702 GTGAGGACACGGTGGGAAGGTGG - Intergenic
1141881812 16:86865312-86865334 CAGGGGGTTGGGTGGGAAGGCGG - Intergenic
1142012767 16:87725170-87725192 CGGAGGGGAGGGTGGGCAGCGGG + Intronic
1142224826 16:88872279-88872301 GAGAGGGTGGGGTGGGATGGAGG + Intergenic
1142368010 16:89660438-89660460 CAGAGGGTGGGGGAGGAAGGTGG + Intronic
1142446977 16:90146858-90146880 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1142448573 16:90159645-90159667 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1142458912 17:75644-75666 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1142460515 17:88473-88495 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1142562346 17:817898-817920 CTGGGTGAAGGCTGGGAAGGAGG + Intronic
1142623371 17:1178792-1178814 CTCAGGGAAGGGTGGGGAGAAGG + Intronic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1142888845 17:2929974-2929996 CAGAGGGAAGGGTGAGCAGGTGG - Intronic
1142992195 17:3739011-3739033 ATGAGGGAAGGGGAGGAAGGGGG - Intronic
1143173359 17:4942954-4942976 CTGAAGGAAGAATGGGAAGGAGG - Intronic
1143365443 17:6405494-6405516 CATAGGGTAGGGAGGGCAGGTGG + Intronic
1143389634 17:6552634-6552656 CTATGGGTAGGGGTGGAAGGTGG - Intronic
1143520493 17:7441595-7441617 CTGGCTGCAGGGTGGGAAGGGGG + Intronic
1143545260 17:7591622-7591644 CTGGGGGTAGGGTGGACAAGAGG + Exonic
1143614595 17:8042345-8042367 TGGAGGGTAGAGAGGGAAGGTGG - Intronic
1143665902 17:8359928-8359950 GTGGGGGTAGAGTGGGGAGGAGG + Intergenic
1143723248 17:8828439-8828461 CAGAGGCCAGGGTGGGACGGAGG - Intronic
1144572367 17:16407812-16407834 CAGAGGTGAGGGTGGGAGGGAGG + Intergenic
1144576377 17:16432323-16432345 CTGAGTGTGGGGTGGGGTGGGGG - Intronic
1144622005 17:16823865-16823887 CTGATGGGAGGGTGGGGTGGGGG - Intergenic
1144781989 17:17812986-17813008 CTGAGACTAGGGTGGGGAGAGGG - Intronic
1144884419 17:18448849-18448871 CTGACGGGAGGGTGGGGTGGGGG + Intergenic
1145105434 17:20111616-20111638 CTAGGGGCAGGGTGGGAATGAGG + Intronic
1145147810 17:20495528-20495550 CTGAGGGGAGGGTGGGGTGGGGG - Intergenic
1145252276 17:21303160-21303182 CTGGCGGTGGGGTGGGGAGGAGG - Intronic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1145759754 17:27419417-27419439 CTGAGGGCAGTGGTGGAAGGGGG + Intergenic
1145781983 17:27569419-27569441 CTGGGGGTTAGGTGGGGAGGTGG + Intronic
1145859390 17:28195146-28195168 CTGGGGGGAGGGTAGGGAGGAGG + Exonic
1146086417 17:29833944-29833966 GGGAGGGTAGGAAGGGAAGGAGG - Intronic
1146393710 17:32444851-32444873 CTCAGCGTAGGGTGGGAGAGTGG + Intronic
1146741403 17:35287053-35287075 GGGAGGAAAGGGTGGGAAGGGGG - Intergenic
1146833700 17:36092374-36092396 CAGAGGGTGGGGTGAGAAGGAGG - Intergenic
1147153742 17:38532914-38532936 GTGAGGGGAAGGCGGGAAGGGGG + Exonic
1147182213 17:38693569-38693591 GTGGGTGTGGGGTGGGAAGGGGG + Intergenic
1147360393 17:39926659-39926681 AAGAGGGTGGGGCGGGAAGGAGG - Exonic
1147573976 17:41588199-41588221 CTGATGGGAGGGTGGGGTGGGGG - Intergenic
1147979094 17:44263689-44263711 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
1148075297 17:44932209-44932231 GGGAGGGTGGGGTGGCAAGGGGG + Intronic
1148128652 17:45249358-45249380 CTGAGGGTAGAGGGGACAGGTGG + Intergenic
1148155775 17:45424662-45424684 GTGGGGGAAGGGTGGGAGGGGGG + Intronic
1148382504 17:47210062-47210084 GTGAGGGCAGGGTGGGAAGGAGG + Intronic
1148508733 17:48149621-48149643 CCGAGGGTAGGGTGAAAAGCAGG - Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148751668 17:49948890-49948912 CTGAGGGAGGAGTGGGAGGGAGG + Intergenic
1148897202 17:50845845-50845867 GAGAGGGCAGGGTGGGCAGGTGG + Intergenic
1148996164 17:51711834-51711856 CTGGGGGTGAGGTGGGAATGTGG + Intronic
1149022644 17:51987370-51987392 TTGGGGAAAGGGTGGGAAGGGGG + Intronic
1149028408 17:52056437-52056459 CTGAGGCTGGGCTGGGAAAGAGG + Intronic
1149422864 17:56527926-56527948 CTGGGGGGAGGGAGGGATGGAGG + Intergenic
1149557227 17:57582150-57582172 CTGGAGGTAGGGTGGGAACAGGG - Intronic
1149659351 17:58326279-58326301 CTGAGGGTGGTGAGGAAAGGAGG - Exonic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1150045538 17:61909551-61909573 ATGTTGGGAGGGTGGGAAGGGGG - Intronic
1150281355 17:63931226-63931248 ATCAGGCAAGGGTGGGAAGGCGG + Intronic
1150387465 17:64773329-64773351 GTGGGGGAAGGGTGGGAGGGGGG + Intergenic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1150623012 17:66822580-66822602 GTGAGGGGAGGTTGGGCAGGTGG - Intergenic
1151129918 17:71886104-71886126 TTGGGGGTAGAGTGGGAGGGTGG + Intergenic
1151155397 17:72120806-72120828 CGGACGGTAGGGTGGGGGGGCGG - Intergenic
1151240539 17:72754288-72754310 CTTGGGAAAGGGTGGGAAGGGGG + Intronic
1151260557 17:72912660-72912682 CTGAGGGTACGGGGGTGAGGAGG + Intronic
1151432271 17:74071574-74071596 CAGAAGGTGGGATGGGAAGGTGG - Intergenic
1151591590 17:75047714-75047736 CTGCGAGTAGTGTGGGAGGGAGG - Intronic
1151767229 17:76138776-76138798 CTTAGGGTAGGGTGGGGCTGAGG + Intronic
1151887783 17:76933314-76933336 CAGAGGGTAGAGGGGGCAGGCGG - Intronic
1152068510 17:78124216-78124238 CTGAGGGTCGGGTGGGGCGTGGG - Intronic
1152078375 17:78171938-78171960 CGGCGGTTAGCGTGGGAAGGGGG + Exonic
1152201200 17:78947395-78947417 CCGAGGGCAGAGTGGGGAGGAGG + Intergenic
1152280121 17:79380188-79380210 CTGGGGGAGGGGTGGCAAGGGGG - Intronic
1152454066 17:80402751-80402773 CCAAGGGGAGGGTGTGAAGGCGG - Intergenic
1152494388 17:80660829-80660851 CTGAGAGAAGGGTGGGGAGATGG - Intronic
1152585206 17:81186220-81186242 CTGGGAGTGGGGTGGGAAGGGGG - Intergenic
1153571830 18:6481355-6481377 AGGAGGGTAGGATGGGGAGGGGG - Intergenic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154332329 18:13440256-13440278 AGGAGGGAAGGGTAGGAAGGAGG - Intronic
1154338187 18:13482384-13482406 CTGTGGGGAAGGTGGGACGGTGG - Intronic
1154982014 18:21510357-21510379 CTGAGGGGAGGGAGGGAATGGGG - Intronic
1155032650 18:21997612-21997634 ATGTGTGTAGGGTCGGAAGGAGG - Intergenic
1155208392 18:23580286-23580308 CTGGGGGTAGGGGAGGCAGGAGG - Intronic
1155518088 18:26642873-26642895 CTGCGGGGAGGGTGGGAGGGCGG + Intronic
1155937812 18:31772373-31772395 CCGGGGGAAGGCTGGGAAGGGGG + Intergenic
1156009825 18:32483789-32483811 GTGAGAGGAGGGAGGGAAGGGGG + Intergenic
1156126452 18:33911135-33911157 CAGAGGGTGGGGTGGGGGGGAGG - Intronic
1156183532 18:34635025-34635047 CAGAGGTTAGGGTGGGGAGTGGG - Intronic
1157091322 18:44640492-44640514 TTGAGAGTAGGGTGGGAGGGAGG - Intergenic
1157239674 18:45997632-45997654 GGGAGGGGAGGGAGGGAAGGGGG - Intronic
1157300730 18:46477314-46477336 CTGGGGGTAGGGTGGGGAGCAGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157576678 18:48748355-48748377 ATGAAGGGAGGGAGGGAAGGAGG + Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157792704 18:50546692-50546714 GTGAGGGGAGGGTTGGAAGGTGG + Intergenic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1159991175 18:74910397-74910419 ATGAGGGTGGGGTGGGGAGCTGG - Intronic
1160229833 18:77039424-77039446 CTGAGGCTAGAGGGGTAAGGTGG + Intronic
1160411092 18:78675949-78675971 CTGAGTGAACGGTGGGCAGGTGG - Intergenic
1160648631 19:208157-208179 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1160650230 19:220973-220995 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1160818347 19:1046568-1046590 CTGAGGGTCTGGTGGGGGGGGGG + Intronic
1161031052 19:2057882-2057904 CTGAGGGTGTGGTGGGTCGGGGG + Intergenic
1161153977 19:2722832-2722854 CTGGGGTCAGGGTGGGAGGGAGG - Intronic
1161290355 19:3490776-3490798 GTGAGGGGAGCGTGGGAGGGAGG - Intergenic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161605359 19:5211921-5211943 CTGTGGGCGGGGTGGGGAGGAGG - Intronic
1161663265 19:5560151-5560173 CTGAGAGGAGGGGGAGAAGGAGG - Intergenic
1161842393 19:6690595-6690617 GGTAGGGTAGGGTGGGAAGATGG + Intronic
1161849396 19:6730903-6730925 CTACGGGCAGGGTGGGCAGGGGG - Intronic
1161967005 19:7554538-7554560 TGGATGCTAGGGTGGGAAGGGGG - Exonic
1162084779 19:8241964-8241986 CTGAGGGAAGGGAGGAAATGAGG - Intronic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162333055 19:10042224-10042246 CTGAGAGTGGAGAGGGAAGGAGG - Intergenic
1162870216 19:13580858-13580880 GGGAGGCTAAGGTGGGAAGGTGG - Intronic
1163025755 19:14510802-14510824 CGGATGGTAGGGTGGGAGGGAGG + Intergenic
1163079090 19:14923752-14923774 AGGAGGAAAGGGTGGGAAGGGGG - Intergenic
1163123745 19:15233130-15233152 CTGACGGTAGGCCGGGGAGGGGG + Intronic
1163471504 19:17500072-17500094 CTGAATGCAGGCTGGGAAGGTGG + Intronic
1165008441 19:32824997-32825019 GTGAAGCTAGGGTGCGAAGGAGG - Intronic
1165339950 19:35204231-35204253 CTGAGGGGAGGCTAGGAAGAGGG + Intergenic
1165729444 19:38135361-38135383 CTCCGGGCAGGGTAGGAAGGTGG - Intronic
1165741189 19:38206257-38206279 CTGAGGGGAAGGAGCGAAGGCGG - Exonic
1165987505 19:39783026-39783048 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1166012284 19:39951359-39951381 CTAAGGGCAGGGTGGGAAGCAGG - Intergenic
1166040369 19:40198610-40198632 GTGAGGGCAGAGTGGGAGGGAGG + Intronic
1166235361 19:41451793-41451815 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166336944 19:42114052-42114074 CTGAGGGAAGCTGGGGAAGGAGG + Intronic
1166482428 19:43185433-43185455 CTGAGGGCAGTGTGGGGGGGGGG - Intronic
1166688392 19:44809219-44809241 CTGAGGGCAAGGTGGGACTGGGG + Intronic
1166948082 19:46409243-46409265 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1166970573 19:46564502-46564524 GTGAGGGTAGGGGGAGAGGGAGG + Intronic
1167272015 19:48511299-48511321 CTGGGGGCTGGGTGGGGAGGGGG - Intronic
1167468146 19:49660983-49661005 CTGATGGGAGGGAGGGAGGGAGG - Intronic
1167492728 19:49801660-49801682 AGGAGGGGAGGGCGGGAAGGGGG - Intronic
1167603544 19:50467903-50467925 CAGAGGGAGGGGTGGCAAGGTGG - Intronic
1167608264 19:50493244-50493266 CTGAGGCTCGGGCGGGAAAGAGG - Intergenic
1167616289 19:50535984-50536006 CTGCGGGTGGGGTGGGAGAGTGG + Intronic
1167959542 19:53095085-53095107 AAGAGGGTGGGGTGGGAGGGTGG - Intronic
1168302676 19:55415300-55415322 TGGAGGGTAGGAGGGGAAGGAGG - Intergenic
1168398007 19:56065351-56065373 CTGAGGGTGGGATGGGTGGGCGG + Intergenic
1168399436 19:56076297-56076319 CTGAGGCAAAGGTGGGAATGGGG + Intergenic
1168418427 19:56184361-56184383 CTCATGATTGGGTGGGAAGGTGG - Intronic
1168570006 19:57458803-57458825 CTGAGGCTAGGAGGAGAAGGAGG - Intronic
1202697524 1_KI270712v1_random:135824-135846 GGAAGGGGAGGGTGGGAAGGGGG - Intergenic
925199201 2:1952758-1952780 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
925203531 2:1988151-1988173 CTGGCGGGAGGGTGGGAATGTGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925347795 2:3183011-3183033 GTGAGGGGTGGGTGGGTAGGTGG - Intergenic
925357357 2:3251300-3251322 CTAAAGGGAGGGTGGGAAGAGGG + Intronic
925919686 2:8630537-8630559 CTGAGGGGCGGGGGGGCAGGGGG + Intergenic
926151342 2:10427195-10427217 CTGTGGGAAGGGTGGGGACGAGG + Exonic
926310096 2:11669096-11669118 CTGGAGGTAGGGTGGGGACGGGG - Intronic
926434117 2:12821343-12821365 CTGAGGATGAGGTGTGAAGGTGG + Intergenic
926940586 2:18132031-18132053 CTGAGGGGGAGGTGGGAATGGGG + Intronic
927381970 2:22489606-22489628 TTGAGGGTAGAGGGGGGAGGAGG + Intergenic
927499765 2:23574943-23574965 CTGAGGAATGGGTGGGAGGGTGG + Intronic
927994927 2:27477959-27477981 TTGAGGGTAGGGTGGGGAATAGG - Intronic
928086310 2:28348345-28348367 CAGAGGGGAGAGTGGGGAGGAGG + Intergenic
929421329 2:41792729-41792751 CTAAGGGTTGGGTGGGTAGGGGG - Intergenic
929545963 2:42855404-42855426 CTCTGGGTAGGGTGTGAATGGGG - Intergenic
929641909 2:43589677-43589699 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
929713858 2:44291636-44291658 CTGGGGGTAAGGTGGGGAGGAGG - Intronic
929918480 2:46155475-46155497 CTGAGTGCAGGGTGGGAAGTGGG - Intronic
930221403 2:48750085-48750107 GTGAGGGTAGGCTAGGGAGGTGG + Intronic
930312232 2:49755903-49755925 AGGAGGGAAGGGTGGAAAGGAGG + Intergenic
930312238 2:49755920-49755942 AGGAGGGAAGGGTGGAAAGGAGG + Intergenic
930367527 2:50459455-50459477 TTGAGGGTGGAGTGGGAAGAGGG - Intronic
930775372 2:55165439-55165461 CAAAGGGTTGGGTGGGAATGAGG + Intergenic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
930814815 2:55584493-55584515 TTGGGGAAAGGGTGGGAAGGGGG - Intronic
931744930 2:65283497-65283519 CTGAGGGTGGGGTGAGGAGGGGG + Intergenic
932217427 2:69976006-69976028 CTGGGGGTGGGGTGGGGAAGGGG - Intergenic
932424523 2:71620658-71620680 CTGGGGGTAGGGGGGTTAGGAGG + Intronic
932488813 2:72105305-72105327 CTGTGGGGAGGCTGGGAAGCAGG - Intergenic
932691985 2:73921158-73921180 CTGTGGGTGGGGTGGGATGGAGG + Intergenic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932890581 2:75593045-75593067 GAGAAGGAAGGGTGGGAAGGTGG - Intergenic
933229854 2:79793978-79794000 GGGAGGAAAGGGTGGGAAGGGGG + Intronic
933834338 2:86233023-86233045 CTGAGGGTAGGGAGGGATCCTGG - Intronic
934076303 2:88431511-88431533 CTGGGAGAAGAGTGGGAAGGAGG - Intergenic
934767042 2:96885476-96885498 CTGAGGACAGGGAGGGAATGTGG + Intronic
934880447 2:97972449-97972471 GGGAGGGGAGGGAGGGAAGGCGG + Intronic
935077005 2:99755236-99755258 ATGAAGGTAGGGAGGGCAGGAGG - Intronic
935077145 2:99756188-99756210 ATGAAGGTAGGGAGGGCAGGAGG - Intronic
935204192 2:100883386-100883408 CTGACTGGAGGGTGGGAATGAGG + Intronic
935326914 2:101945920-101945942 ATGGGGGTAGGGTGGGGAGCTGG - Intergenic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
935985412 2:108667732-108667754 CTGAGGGTGAGGTGGGAGTGGGG - Intronic
936137841 2:109911381-109911403 CTGAGGGTGAGGTGGGAGTGGGG - Intergenic
936206856 2:110460104-110460126 CTGAGGGTGAGGTGGGAGTGGGG + Intronic
936333931 2:111572928-111572950 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936333943 2:111572961-111572983 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936454879 2:112665408-112665430 TTGAGGGAAGGGAGGGTAGGGGG + Intergenic
936808741 2:116370246-116370268 ATGAGGGCAGAGTGTGAAGGGGG + Intergenic
936836425 2:116715805-116715827 CAGAGGGTGGGAAGGGAAGGAGG + Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937387973 2:121454318-121454340 GGGAGAGCAGGGTGGGAAGGAGG - Intronic
937815950 2:126251132-126251154 CTGTAGGGAGGATGGGAAGGTGG + Intergenic
937907700 2:127060434-127060456 GTGCGTGTTGGGTGGGAAGGCGG - Intronic
938143261 2:128813195-128813217 CTGGGGGTGAGGTGGGAGGGAGG - Intergenic
938170529 2:129071606-129071628 GTGAGGGTGGGGTGGAAAAGAGG - Intergenic
939087295 2:137736770-137736792 CAGAGGAAAGGGTAGGAAGGGGG + Intergenic
939358180 2:141131982-141132004 CTGGGGCAAGAGTGGGAAGGGGG - Intronic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
939586775 2:144015440-144015462 GTGAGGGGAGGGTGGGTATGGGG - Intronic
940349358 2:152664778-152664800 CTGAGGATTGGGTTGGAAGCAGG - Intronic
940550677 2:155152122-155152144 CTGGGGTGAGGGTGGCAAGGCGG + Intergenic
940652843 2:156454681-156454703 CAGAGGGCAGAGTGGGAGGGAGG + Intronic
941225146 2:162838829-162838851 GTGGGGGTGGGGTGGGAAGGGGG + Intergenic
941318072 2:164019589-164019611 TTGAGGGAAGAGTGGGAGGGGGG - Intergenic
941399648 2:165014977-165014999 TTGAGGGTAGGGGGGCAAAGAGG + Intergenic
941758329 2:169212764-169212786 TTGGGGGAAGGGTGGGAGGGGGG + Intronic
941820447 2:169839355-169839377 CAGAGGGAAGGGTAGAAAGGAGG + Intronic
941859781 2:170267143-170267165 CTGGGGGTAGGGTGGGAATTGGG + Intronic
942003520 2:171675042-171675064 CTGAGAACAGGGTGGGGAGGTGG - Intergenic
942101513 2:172588857-172588879 CTGAGTGAAGGATGAGAAGGAGG - Intronic
942325464 2:174772637-174772659 ATGAAGGAAGGGTGGGAAGCAGG - Intergenic
942425122 2:175852003-175852025 CGGAGGGTAGGAGGAGAAGGAGG + Intergenic
942457953 2:176150885-176150907 CTGGGGGTGGGCTGGGATGGTGG - Intergenic
942970387 2:181951081-181951103 CTGAAGGTGGGGTGGGGATGTGG - Intergenic
943499242 2:188666161-188666183 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
943662531 2:190574776-190574798 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
944551807 2:200851044-200851066 CTTGGGGAAGGGTGGGAGGGAGG - Intergenic
944777918 2:202987981-202988003 GTGATGGTGGGGTGGCAAGGAGG - Intronic
944822444 2:203444080-203444102 GTGAGGGGAGGGAGGAAAGGAGG + Exonic
944845098 2:203660126-203660148 GTGGGGGTGGGGTGGGAATGGGG + Intergenic
945240808 2:207675223-207675245 ATGAGGGTAGGGGCTGAAGGTGG + Intergenic
945254491 2:207792274-207792296 GTGGGGGGAGGGGGGGAAGGGGG - Intergenic
945556384 2:211281523-211281545 CAGAGGGTACAGTGAGAAGGTGG - Intergenic
945622696 2:212160854-212160876 CTGAGGGTAGGTTGGGGAAGGGG + Intronic
946178271 2:217935163-217935185 CTGAAGGCAGGGTGAGGAGGGGG + Intronic
946325035 2:218980750-218980772 GTGAGGGTTGGGTGGAAGGGTGG + Intergenic
946429157 2:219615403-219615425 ATGAGGGCAGGGTGGGAAATGGG + Intronic
946879347 2:224161612-224161634 CTGAGGATAGGAGGGGAATGGGG + Intergenic
947291928 2:228585337-228585359 TTGAGGGCAGGATGGGAAAGTGG - Intergenic
947523608 2:230865801-230865823 CAGGGCGTGGGGTGGGAAGGGGG - Intronic
948100299 2:235367598-235367620 GTGAGGGGAGGGTGAGGAGGTGG - Intergenic
948269851 2:236665937-236665959 CCGAGGGCGTGGTGGGAAGGGGG - Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948609810 2:239159637-239159659 CTTAGTGTAGGGTGTGAATGGGG - Intronic
948646912 2:239411136-239411158 ATGAGGGAAGGTAGGGAAGGTGG - Intergenic
948667177 2:239543865-239543887 TTGAGGGTGTGGTGGGGAGGTGG - Intergenic
948729123 2:239952284-239952306 CTGAAGGCAGAGTGGGGAGGGGG + Intronic
948892556 2:240914600-240914622 CTGAGTGAGGGGTGGGATGGAGG - Intergenic
1168797906 20:623856-623878 CTGGGGGTAGGGGGAGGAGGTGG - Intergenic
1168901008 20:1364972-1364994 CAGAGGGTAGGGTGGGGTGGTGG + Intronic
1168949797 20:1789272-1789294 CTGGGGGTGGGGTGGGGAAGAGG + Intergenic
1169880071 20:10337496-10337518 CTGAGAGGAAGGTGGAAAGGAGG - Intergenic
1170075070 20:12410299-12410321 AGGAGGGGAGGGTGGGAATGGGG + Intergenic
1170477032 20:16725807-16725829 CAGAGGCTGAGGTGGGAAGGTGG - Intergenic
1170763454 20:19271822-19271844 TGGAGGGAAGGGTGGGAATGGGG + Intronic
1170848664 20:19983819-19983841 ATGAGGTTAGGGTGGGAGGGAGG - Intronic
1170870542 20:20201971-20201993 CTCACAGTAGGGTGGGAGGGAGG - Intronic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1171205214 20:23273803-23273825 CAGAGGGTCTGGTGGGATGGAGG + Intergenic
1171347593 20:24477801-24477823 CTGAGGCTGGGGTGCGATGGAGG + Intronic
1172482132 20:35277493-35277515 CTGGGTGTAGGCTGGGAAGCAGG + Intergenic
1172620647 20:36316325-36316347 CTGCGGGTGGGGTGTGATGGGGG - Intronic
1172649528 20:36493035-36493057 CTGTGGGTAGGGTGGGGATGGGG - Intronic
1172784286 20:37456261-37456283 CTGAGGTTAGGATGGGGAAGGGG + Intergenic
1172917334 20:38452890-38452912 CTGAGGGTAGGGTCGGGCGAGGG - Intergenic
1173177767 20:40777448-40777470 GTGGGGGTGGGGTGGGAGGGTGG - Intergenic
1173219090 20:41116576-41116598 TTGAAGTTGGGGTGGGAAGGGGG - Intronic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173904177 20:46613793-46613815 CTCAGGGCAGAGGGGGAAGGAGG + Intronic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174036781 20:47673484-47673506 CAGAGGGTTGGGGGGGATGGTGG - Intronic
1174267307 20:49341130-49341152 GAGAGGGAAGGGGGGGAAGGGGG - Intergenic
1174656590 20:52177028-52177050 GGGAGGGTAGGGTGGGATGTGGG - Intronic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175283493 20:57820987-57821009 CAGAGGGCAGGGGTGGAAGGGGG + Intergenic
1175544032 20:59766524-59766546 CTGAGGGGTGGTTGTGAAGGAGG + Intronic
1175572692 20:60036379-60036401 CTGGGGGAAGGGTGGCAATGGGG - Intergenic
1175645310 20:60665931-60665953 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1175696468 20:61106488-61106510 CTCAGGGAAGGGTGGAAGGGGGG - Intergenic
1175739898 20:61413130-61413152 CTGAGGCTGGGATGGGAAGGGGG - Intronic
1175961032 20:62636438-62636460 GTGCGGGTAGGGAGGGGAGGTGG + Intergenic
1176026069 20:62986267-62986289 CTGAGGATGAGGTGGGATGGAGG + Intergenic
1176041926 20:63070251-63070273 GGGAGGGTGGGGTGGGGAGGAGG - Intergenic
1176083795 20:63286749-63286771 CCCAGGCTAGGGTGGGAGGGAGG + Intronic
1176220876 20:63968945-63968967 GTGAGGGTTGAGTGGGCAGGTGG + Intronic
1177617738 21:23545942-23545964 TAGAGGGGAGGGTAGGAAGGGGG + Intergenic
1178793892 21:35725295-35725317 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1178822086 21:35984466-35984488 GTGGGGGTGGGGTGGGGAGGAGG + Intronic
1178955412 21:37017469-37017491 CAGAGGGTGGGGTGGGAGAGTGG + Intronic
1179296511 21:40067720-40067742 ATGAGGGGAGGGAGGGAATGAGG - Intronic
1179644428 21:42766954-42766976 CTGGGGGTGGGGTGGGAGTGGGG - Intronic
1179682349 21:43032309-43032331 CGGAGGGTGGTGAGGGAAGGAGG - Exonic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179874896 21:44262502-44262524 CTCAGGGCAGGGTGGGTGGGTGG + Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1181002284 22:19993495-19993517 CTGGGGGAAGGCTAGGAAGGGGG + Intronic
1181377282 22:22469528-22469550 AGGAGGAAAGGGTGGGAAGGAGG + Intergenic
1181494408 22:23279945-23279967 GTGAGGGTACAGTGGGAGGGTGG - Intronic
1181562573 22:23714465-23714487 CACAGGGTGGGGCGGGAAGGTGG + Intergenic
1181736085 22:24882664-24882686 CAGAGGGTAGGAAGGGAAGGAGG - Intronic
1181961553 22:26625451-26625473 CAGAGGGTAGAGTGTGCAGGAGG - Intronic
1182007671 22:26974841-26974863 TGGAGGGAGGGGTGGGAAGGTGG + Intergenic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182150855 22:28026176-28026198 TTGAGGGCAGAGGGGGAAGGGGG + Intronic
1182556979 22:31134416-31134438 CTGAGGGTGGGGTAGGCAGATGG + Exonic
1182727084 22:32456447-32456469 ATGAGGGAAGGGAGGGAGGGAGG - Intronic
1183109365 22:35637714-35637736 CTTAGGGTGGGGTGGGAGGATGG - Intronic
1183165464 22:36144233-36144255 CTGGGAGTAGGGTGAGAAGAGGG - Intronic
1183201471 22:36387998-36388020 CCGAGGGCGGGGCGGGAAGGCGG - Exonic
1183349152 22:37325036-37325058 CGGCAGGGAGGGTGGGAAGGGGG - Intergenic
1183478513 22:38050307-38050329 CTGAGGGAGGGGTGGGGATGGGG + Intergenic
1183513296 22:38248498-38248520 CTAAAGGAAGGGTGGGAGGGAGG - Intronic
1183522466 22:38303374-38303396 CTTGGGGGAGGCTGGGAAGGGGG + Intronic
1183715283 22:39529716-39529738 CTGAGCATAGGGTGGGAGGCTGG - Intronic
1183732359 22:39625830-39625852 CTGGGGGTGGGGTGGGGCGGGGG - Intronic
1183785856 22:40028735-40028757 CTGCCTGTAGGGAGGGAAGGGGG - Intronic
1184120104 22:42444530-42444552 CTGAGGGATTGGTGGGGAGGGGG + Intergenic
1184275042 22:43405227-43405249 CTGAGGGTGGGGAGGGCCGGAGG + Intergenic
1184645985 22:45895776-45895798 CTGAGGTCAGGCAGGGAAGGTGG + Intergenic
1184657528 22:45949329-45949351 CGGAGGGCAGGGTGGGTGGGCGG - Intronic
1184690568 22:46115490-46115512 TGGAGGGTAGGGAGGGAAGTGGG - Intergenic
1184862981 22:47186763-47186785 TGGAGGGTTGTGTGGGAAGGTGG + Intergenic
1184971012 22:48019810-48019832 ATGAGGCCAAGGTGGGAAGGTGG + Intergenic
1185195079 22:49464351-49464373 CTGGGGGCAGGGTGGGGAGTGGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185272539 22:49935710-49935732 CGGAGGGGAGGGTGGGGATGTGG + Intergenic
1203322947 22_KI270737v1_random:86267-86289 ATGAGGGAAGGGAGGGAGGGAGG - Intergenic
949607349 3:5668289-5668311 GAGAGGGGAGGGTGGGAAGAGGG + Intergenic
950195369 3:11005708-11005730 GAGAGAGGAGGGTGGGAAGGAGG - Intronic
950989344 3:17415841-17415863 GTGAGGTGAGGGTGGGAAGAAGG - Intronic
951508277 3:23473578-23473600 GTGGGGAAAGGGTGGGAAGGGGG - Intronic
951745253 3:25971044-25971066 GTGAGGACAGGGTGAGAAGGTGG + Intergenic
951829922 3:26915048-26915070 CTGAGGGAAGGCTGGGGAGAAGG + Intergenic
952819480 3:37473472-37473494 CTGGGGGTGCTGTGGGAAGGGGG + Intronic
952955471 3:38554636-38554658 TAGAGGGTAGAGTGGGAGGGTGG - Intronic
953056577 3:39392255-39392277 GTGAGGATAGGGTGGGTGGGAGG + Intronic
953087033 3:39679472-39679494 CAGAGGGTGCGGTGGGGAGGAGG - Intergenic
953289745 3:41649465-41649487 CTGAGCGTAGGGGTGGCAGGGGG - Intronic
953391662 3:42537370-42537392 GGGAGGGTGGGGTGGCAAGGGGG - Exonic
953636618 3:44670161-44670183 CTGAGGGCAGGTGGGGAAGAGGG + Intergenic
953669295 3:44949025-44949047 CTGAGAGTGGGGTGGAAATGAGG + Intronic
953726021 3:45399785-45399807 TTGGGGGAAGGGTGGAAAGGGGG - Intronic
954290803 3:49649015-49649037 CAGAGGCTAGGCTGGGCAGGTGG - Intronic
954418997 3:50408708-50408730 GTGAGAGGAGGGTGGGCAGGCGG + Intronic
954456072 3:50600516-50600538 GTGGGGGTAGTGGGGGAAGGGGG + Intergenic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954805596 3:53218180-53218202 TGGATGGTATGGTGGGAAGGGGG - Intergenic
955182223 3:56683114-56683136 CTGAGGCCACGGGGGGAAGGGGG - Intronic
955219436 3:57011560-57011582 CTGTGGGTGGCGGGGGAAGGTGG - Intronic
955443062 3:58977893-58977915 CTGAAAGAAGTGTGGGAAGGAGG + Intronic
955740523 3:62086380-62086402 CTGGGGTTAGGGTGGGAATTTGG - Intronic
957315445 3:78570240-78570262 GTGAGGGTGGGGTGGGTGGGGGG + Intergenic
957442783 3:80272132-80272154 CTGAAGGAAGGGAGGGAGGGAGG + Intergenic
958014303 3:87920245-87920267 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
958018084 3:87966153-87966175 CTGAGGTTAGAGTGAGAAGACGG - Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959788984 3:110333900-110333922 CAGAGTGGAGGGTGGGAAGAGGG + Intergenic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960517070 3:118614170-118614192 AGGAGGAAAGGGTGGGAAGGGGG + Intergenic
960583730 3:119301908-119301930 CAGACGCCAGGGTGGGAAGGCGG - Intronic
960602563 3:119472100-119472122 CTGAAGGCAGGGTGGTAAGCAGG + Intronic
960609838 3:119545499-119545521 CTGAGGGGAGAGGGGGAAAGGGG - Intronic
960965128 3:123099447-123099469 CTGAGGGGTGAGTGGGGAGGAGG - Intronic
961247928 3:125472924-125472946 CTGGGGCTGGGGTGGGATGGTGG - Intronic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
961794997 3:129402990-129403012 CTCAGGGTTGGAGGGGAAGGGGG - Intronic
961943557 3:130661859-130661881 CTGAGTGTTGGGTAGGAAGTCGG - Exonic
962177043 3:133166189-133166211 TGGAGGGTAGGGTTGGGAGGAGG + Intronic
962276185 3:134015430-134015452 CTGGGGGTGGGGTGGGAGGGGGG + Intronic
962373930 3:134844644-134844666 CTCAGGGGAGGGTGAGGAGGAGG + Intronic
962423613 3:135249654-135249676 GTGAGGGTGGGATGGGGAGGTGG + Intronic
964835135 3:160929863-160929885 CTGAAGGAGAGGTGGGAAGGTGG - Intronic
964985266 3:162731168-162731190 CTCGGGGAAGGGTGGGAGGGGGG - Intergenic
965603162 3:170474429-170474451 GTGAAGGTAGAGTGTGAAGGTGG - Intronic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
966192528 3:177284440-177284462 AAGAGGGAAGGGTGGGAGGGAGG - Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966318743 3:178677517-178677539 CTGAGGGCAGCAGGGGAAGGTGG - Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966889389 3:184395606-184395628 CTGAGGGAAGGTGGGGAAGAGGG + Intronic
967054754 3:185822835-185822857 CTGGGGGTAGGGGCGGGAGGTGG + Intronic
967331651 3:188296172-188296194 CTGGGGGAAGGATGAGAAGGAGG + Intronic
967446878 3:189577654-189577676 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
967717896 3:192784113-192784135 CTGCGGGTTGGGTGGCAAAGAGG + Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
967948281 3:194821051-194821073 CAGAGGGTGGGGTGGGGTGGGGG + Intergenic
967967459 3:194973465-194973487 CTGTGGGTGGGGTGGGATGGGGG - Intergenic
968173667 3:196530053-196530075 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
968367616 3:198199156-198199178 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
968369218 3:198211958-198211980 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
968517673 4:1021693-1021715 CTGATGGTTGGGTGGGAATTAGG + Intronic
968721261 4:2207244-2207266 AGGAGGAAAGGGTGGGAAGGGGG + Intronic
969342389 4:6550309-6550331 CTGAGGGCACTGTGGGGAGGGGG - Intronic
969409996 4:7021876-7021898 CTGAGGGCAGCAGGGGAAGGTGG + Intronic
969517595 4:7656297-7656319 CTGAGGGCAGGGTGGGGGGCGGG - Intronic
969545560 4:7824748-7824770 CTGAGGGAACGGGAGGAAGGGGG + Intronic
969882642 4:10187790-10187812 CTGAGGGGACAGTTGGAAGGTGG + Intergenic
970079060 4:12259454-12259476 CGGAGGGTAGATGGGGAAGGAGG + Intergenic
970538933 4:17058347-17058369 CTGAGGGAAGAGTTGGAAAGTGG + Intergenic
970813994 4:20131424-20131446 GTGAGGATGGAGTGGGAAGGTGG + Intergenic
970950556 4:21750472-21750494 CTGATGCTAGGTTGGGAATGAGG + Intronic
971028033 4:22607651-22607673 CACAGGGTAGGGTGGGGTGGGGG + Intergenic
971059881 4:22955597-22955619 CTGATGGGAGGGTGGGAAAGTGG + Intergenic
971185767 4:24374402-24374424 CAGAGGGTGGGGGTGGAAGGAGG + Intergenic
971400289 4:26269775-26269797 TTGAGGGAAGGGAGTGAAGGGGG + Intronic
971670899 4:29555947-29555969 CAGAGAGTGGGTTGGGAAGGGGG + Intergenic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
973173477 4:47174855-47174877 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
973792102 4:54387486-54387508 TTGGGGAAAGGGTGGGAAGGGGG - Intergenic
974468601 4:62290673-62290695 CTGGGGGTAGAGTGGGAGGTAGG + Intergenic
974519069 4:62957508-62957530 CTGAAAGTAGGGTGGGGTGGAGG + Intergenic
975016197 4:69424082-69424104 CAGATGGGAGGGTGGGAGGGGGG - Intergenic
976157659 4:82164567-82164589 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
976664073 4:87571604-87571626 CTGAGGAAAGGGTGAGAGGGGGG - Intergenic
976726273 4:88218592-88218614 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
976897349 4:90128007-90128029 TTGCGGGCGGGGTGGGAAGGAGG + Intronic
976984115 4:91271412-91271434 AGGAGGAAAGGGTGGGAAGGGGG - Intronic
977287485 4:95126682-95126704 ATGGCGGTAGGATGGGAAGGAGG + Intronic
977521425 4:98089199-98089221 CAGAGGGTAAGGTTGGGAGGGGG - Intronic
977570269 4:98621778-98621800 CTGCGGGGGGGGTGGGAATGAGG - Intronic
977631903 4:99252376-99252398 GGGAGGGTAGTTTGGGAAGGAGG + Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978199394 4:106007652-106007674 CAGAGGGAATGGTGGGAGGGAGG - Intergenic
978243804 4:106548836-106548858 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
978624515 4:110669430-110669452 TTTAGGGGAGGGTGGGAAAGTGG - Intergenic
978826873 4:113035188-113035210 CTGCAGGTGGGTTGGGAAGGGGG + Intronic
979223907 4:118263794-118263816 CTGGGAGTAGAGTGGGAAGGTGG - Intergenic
979256031 4:118608868-118608890 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
979257643 4:118621686-118621708 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
979330704 4:119418876-119418898 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
979332313 4:119431669-119431691 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
979709663 4:123764100-123764122 AGGAGGAAAGGGTGGGAAGGGGG - Intergenic
979813891 4:125074244-125074266 AGGGGGATAGGGTGGGAAGGGGG + Intergenic
980194762 4:129574197-129574219 ATGAGGAAAGGGTGGGAAGGAGG - Intergenic
980524077 4:133966801-133966823 TTGGGGGTAGGGTGGGAGTGGGG + Intergenic
980980684 4:139652238-139652260 CTGAGAGTTGGGAGGGCAGGAGG + Intergenic
981117928 4:141013972-141013994 CTCAGGGGAGGGAGGGAATGGGG - Intronic
981361520 4:143851077-143851099 CAGAGGGTAGGGTGTGGGGGAGG + Intergenic
981372265 4:143972071-143972093 CAGAGGGTAGGGTGTGGGGGAGG + Intergenic
981381343 4:144075270-144075292 CAGAGGGTAGGGTGTGGGGGAGG + Intergenic
981567694 4:146117781-146117803 CTCAGGGAAGGGGGAGAAGGAGG + Intergenic
982468894 4:155762227-155762249 CAGAGGGTAGGGAGGGGAGGAGG - Intronic
982485210 4:155957952-155957974 CGGCGGGAAGGGTGGGAGGGGGG + Intergenic
983203692 4:164889166-164889188 GTGAGGGTGGGGTGGGAGTGGGG + Intronic
983763230 4:171440441-171440463 CTGAGTGTAGGGGCAGAAGGGGG - Intergenic
983929134 4:173434120-173434142 ATGGGGCCAGGGTGGGAAGGTGG + Intergenic
984873605 4:184348605-184348627 CAGGGGGTGGGGTGGGGAGGCGG - Intergenic
984910285 4:184668045-184668067 GTGAGGATAGAGTGGGAAGAGGG - Intronic
985073723 4:186192080-186192102 CTGATCGGAGGGTGGGAACGGGG - Intronic
985434413 4:189915268-189915290 CTCAGGGTAGGCAGGTAAGGTGG - Intergenic
985697074 5:1346655-1346677 ATGGGGGTAGGGTGGTAGGGAGG - Intergenic
985730341 5:1543945-1543967 CTGAGGCGAGGGTGGGGAGATGG - Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985946727 5:3191029-3191051 CTGAGGGTCCTGTGGGCAGGAGG - Intergenic
986106800 5:4667494-4667516 AGGTGGGTAGGGTGGGAAAGGGG + Intergenic
986233230 5:5885670-5885692 ATGAGGGTAAGGGTGGAAGGGGG + Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
987049170 5:14135279-14135301 CTGAGGGCAAGCCGGGAAGGGGG - Intergenic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987348133 5:16996998-16997020 CTCGGGAAAGGGTGGGAAGGGGG + Intergenic
987762590 5:22184995-22185017 GAGAGGGTAGGGTGGGAGAGGGG - Intronic
988868029 5:35356739-35356761 GTGAGGGTAGGGTGAAAAAGTGG - Intergenic
988939886 5:36133357-36133379 TAGAGGGGAGGGTGGGAAGTGGG + Intronic
988992597 5:36686042-36686064 CTGCAGGCAGGGTGGGGAGGAGG - Intronic
989142298 5:38213663-38213685 GCGCGTGTAGGGTGGGAAGGGGG + Intergenic
989683312 5:44055176-44055198 CTGAGACTAGGGTGGTTAGGGGG + Intergenic
989690287 5:44135403-44135425 CTGGGGAAAGAGTGGGAAGGGGG - Intergenic
989697717 5:44223157-44223179 ATGAGGGGAGGGAGGGAGGGAGG + Intergenic
990241455 5:53820207-53820229 CTGAGGGGAGGAAGGGAGGGAGG + Intergenic
990324505 5:54661495-54661517 GTGAAGGTGGGGTGGGTAGGGGG + Intergenic
990358310 5:54992928-54992950 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
990700453 5:58469597-58469619 CAGGGGGTCGGGGGGGAAGGTGG - Intergenic
991897381 5:71418380-71418402 GAGAGGGTAGGGTGGGAGAGGGG - Intergenic
992052509 5:72954559-72954581 CTAAGGGTGCGGGGGGAAGGGGG + Intergenic
992135115 5:73736840-73736862 GTGAGGGGAGGGAGGGAGGGAGG + Intronic
992187680 5:74259888-74259910 CTGAGGGTAGGGAATGGAGGTGG - Intergenic
992209992 5:74469424-74469446 CTGAGGGTGGGATGGGGAGTGGG - Intergenic
992413648 5:76532470-76532492 CTGAGGATTGGGTGGGTGGGGGG + Intronic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
992636272 5:78728593-78728615 CTGGGGGTGAGGTGGGAAGTTGG - Intronic
994535972 5:101029800-101029822 GAGAGGGGAGGGTGGGAGGGAGG + Intergenic
994615200 5:102095684-102095706 CCTGGGGCAGGGTGGGAAGGAGG - Intergenic
994703721 5:103172482-103172504 GTGGGGGTAGAGTGGGAAAGAGG - Intronic
994708218 5:103231949-103231971 ATAAGGGTACAGTGGGAAGGTGG + Intergenic
994732087 5:103504459-103504481 CTGAGGATAGGGAGGTGAGGGGG - Intergenic
995173243 5:109142132-109142154 GTGAAGATAGAGTGGGAAGGAGG + Intronic
995296282 5:110527082-110527104 CCGAGGATAGGGAGGGATGGGGG + Intronic
996136313 5:119846549-119846571 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
996410522 5:123153945-123153967 TTGAGGGAAGGGAGGGTAGGGGG + Intronic
996608597 5:125352644-125352666 TTGGGGGGAGGGTGGGGAGGGGG - Intergenic
996697566 5:126415513-126415535 AGGAAGGAAGGGTGGGAAGGAGG + Intronic
996815114 5:127565869-127565891 CTGAGGGGAGGGGAGGATGGTGG - Intergenic
996959077 5:129222461-129222483 CTCAGGGCAGGGCGGGGAGGGGG - Intergenic
997266130 5:132496380-132496402 CTGGGGGTAGGGGTGGAAGTGGG - Intergenic
997419500 5:133754967-133754989 TTGAAGGAAGGGTGGGAAGTGGG - Intergenic
997554363 5:134782619-134782641 CTGAGCCTGGGGTGGGAACGGGG - Intronic
997643895 5:135467499-135467521 CAGAGGGTAGGGTGGGGAGGAGG + Intergenic
997812771 5:136988405-136988427 CTGGAGGTAAGGTGGGATGGAGG - Exonic
998107279 5:139476555-139476577 CTGGGGCTTGGGTAGGAAGGGGG - Intronic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998371077 5:141661896-141661918 CTCAGGGGGAGGTGGGAAGGGGG - Intronic
998400158 5:141844529-141844551 TTGAGGGTTGGGGGGTAAGGAGG + Intergenic
998585896 5:143427351-143427373 CTGATAGTAGGGTGGGCTGGGGG + Intronic
998959149 5:147466420-147466442 GTGAGGGTGGGCTGGAAAGGAGG - Intronic
999005037 5:147966579-147966601 CTGAAGGTAGGCTGTGATGGTGG + Intergenic
999188216 5:149728575-149728597 ATGAGTGTAGGGTGGGAGGAGGG + Intergenic
999367603 5:151033340-151033362 AAGAGTGCAGGGTGGGAAGGAGG - Intronic
999467601 5:151822420-151822442 CTGAGGGCTGGGAGGAAAGGAGG - Intergenic
999698949 5:154210488-154210510 CTGAGGGTTGGGGTAGAAGGGGG - Intronic
999768263 5:154756349-154756371 CTGAGTGTACGGTGGGGGGGAGG - Intronic
1000200852 5:159009347-159009369 TTGAGGGTAGGTTTTGAAGGAGG - Intronic
1000235930 5:159360561-159360583 CAGAGGGAAGAGTGGGAGGGAGG + Intergenic
1000438106 5:161238471-161238493 CTGAGGCAAGGGTGGCAAGTTGG + Intergenic
1000840502 5:166212111-166212133 CTGTTGGTAGAGTGGGGAGGTGG - Intergenic
1000990443 5:167906558-167906580 CTGAGGCCAGAGTGGGTAGGAGG - Intronic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001929912 5:175665474-175665496 CTGAGGCTGGAGTGGGCAGGAGG + Intronic
1001966569 5:175913992-175914014 CAGAGGGTAGTGAGGGGAGGGGG - Intergenic
1002027005 5:176402576-176402598 CTCATGGCAGGGAGGGAAGGGGG - Intronic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002250378 5:177925212-177925234 CAGAGGGTAGTGAGGGGAGGGGG + Intergenic
1002483944 5:179522389-179522411 CTAAGGGTGGGGTGGGCAGTGGG - Intergenic
1002500619 5:179645092-179645114 CTAAGGGTGGGGTGGGCAGTGGG + Intergenic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1002726839 5:181304385-181304407 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1002728496 5:181317543-181317565 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1002841978 6:914071-914093 CAGAGGCCAGGATGGGAAGGGGG - Intergenic
1003521362 6:6861269-6861291 TTGAGGCAAGGCTGGGAAGGAGG - Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003563251 6:7201508-7201530 CAGTGGGGAGGGTGGGATGGGGG - Intronic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1003872204 6:10412419-10412441 GAGAGGGGAGGGAGGGAAGGAGG + Intronic
1004076545 6:12348906-12348928 TTGAGTGTAGGCTGGGATGGGGG + Intergenic
1004396039 6:15247442-15247464 TTGAGGGGAGGGAGGAAAGGGGG + Intronic
1004541996 6:16559967-16559989 GTGATGGTGGGGTGGGGAGGCGG - Intronic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1005839938 6:29737735-29737757 TGGAGCGGAGGGTGGGAAGGAGG - Intronic
1005987017 6:30881946-30881968 CTGAGGCCAGGGAGCGAAGGAGG - Intronic
1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG + Intergenic
1006530403 6:34647498-34647520 TTGCGGATAGGATGGGAAGGAGG + Intronic
1006817918 6:36865628-36865650 ATGAGATTAGGATGGGAAGGAGG - Intronic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1007186774 6:39978427-39978449 ATGAAGGTAGGGAGGTAAGGAGG + Intergenic
1007389773 6:41544355-41544377 CTGAGGGTGGGGTGAGAACTAGG - Intergenic
1007406978 6:41640815-41640837 CTCAGGGGTGGGTGGGGAGGAGG - Intronic
1007411986 6:41669771-41669793 CTTGGGAAAGGGTGGGAAGGGGG - Intergenic
1007601271 6:43083193-43083215 CTGAGGTTAGGGAGAGCAGGAGG - Intronic
1007713094 6:43837169-43837191 CTGAGGGTAGGTTGGGGGAGTGG + Intergenic
1007760599 6:44131360-44131382 CTGAGGGGAGGAGGGGAAGATGG - Intronic
1007801852 6:44401246-44401268 CTGAGTGTTTGGTGGGAAGTAGG + Intronic
1008018359 6:46547105-46547127 CAGAGGGTGGGGTGGGTAGGAGG + Intergenic
1008267389 6:49445505-49445527 CTGTGGATAGGGTGGGCAGTGGG - Intronic
1008318755 6:50080612-50080634 CAGAGGGTTGGGGTGGAAGGAGG - Intergenic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008541375 6:52549242-52549264 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
1009243110 6:61203266-61203288 AGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1009384183 6:63068961-63068983 CTCAGGGGAGGGTGTGAATGAGG - Intergenic
1009560828 6:65240427-65240449 GAGAGGGTTGGGAGGGAAGGAGG - Intronic
1009798964 6:68508670-68508692 CAGGGGGAAGGGTAGGAAGGGGG - Intergenic
1011153645 6:84303929-84303951 CAGAGGCTAGGGTGGGAAGTTGG + Intergenic
1011196756 6:84788478-84788500 ATGGGGAAAGGGTGGGAAGGGGG + Intergenic
1011653001 6:89524297-89524319 CTCAGGGGAAGGTGGGAGGGGGG - Intronic
1011698132 6:89931308-89931330 CTTAGGGAAAGGTGGGGAGGAGG + Exonic
1012027777 6:94019901-94019923 TTGGGGAAAGGGTGGGAAGGGGG - Intergenic
1012083873 6:94797823-94797845 CTTGGGAAAGGGTGGGAAGGGGG - Intergenic
1012314333 6:97767201-97767223 CAGGGGGCAGGGTGGGGAGGGGG - Intergenic
1012438001 6:99235392-99235414 CTGAGGGCAGGGCGGCAAAGTGG - Intergenic
1013123275 6:107159310-107159332 CGGAAGGGAGGGAGGGAAGGAGG + Intronic
1013456253 6:110332075-110332097 CAGAGGGTAGGCTGGGAGGCAGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013739111 6:113262718-113262740 GAGAGGGTAGGAAGGGAAGGGGG + Intergenic
1014015886 6:116529452-116529474 CTAACTGTAGGGTGGGAAGCAGG - Intronic
1014022306 6:116605222-116605244 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1015089003 6:129331384-129331406 CTGAGGGTAAGGATGGGAGGGGG - Intronic
1015148682 6:130015973-130015995 AGGAGGGTGGGATGGGAAGGTGG + Intronic
1015342689 6:132119751-132119773 CGGAGGTGAGGCTGGGAAGGTGG + Intergenic
1015767756 6:136737235-136737257 GAGACGGGAGGGTGGGAAGGGGG + Intronic
1015841770 6:137484755-137484777 GTGAGGGGAGGGTGGGAGTGGGG + Intergenic
1016312753 6:142751912-142751934 CTGAGGGTTGGGTGTGGAAGGGG - Exonic
1016586248 6:145689966-145689988 CTGATGGTCGGGTGGGAAGGAGG - Intronic
1017318612 6:153062267-153062289 CTGGGGGTAGGGAGGAGAGGTGG - Intronic
1018168259 6:161121161-161121183 CAGGGGAAAGGGTGGGAAGGCGG - Intergenic
1018690227 6:166338668-166338690 CTGGGGAGAGGGTGGGGAGGCGG + Intronic
1018891442 6:167986017-167986039 GGGAGGCTGGGGTGGGAAGGAGG - Intergenic
1018906799 6:168080273-168080295 CTGAGCGGAGGGAGGGAGGGAGG - Intronic
1018973715 6:168547406-168547428 CGAAGGGTAGGGTAGGATGGAGG + Intronic
1019324091 7:429552-429574 CTGAGGGTTGGGGGTGCAGGAGG - Intergenic
1019416707 7:931012-931034 AGGAGGGTAGGGAGGGACGGAGG + Intronic
1019557207 7:1638527-1638549 CTGAGAGGAGGGAGGGAGGGAGG + Intergenic
1020899537 7:13988542-13988564 GTGGGGGTGGGGTGGGGAGGAGG - Intronic
1021788677 7:24178256-24178278 CAGAGGGTTGGGTGGGGAGGAGG + Intergenic
1022367362 7:29736351-29736373 GTTAGGGTGGGGTGGGAATGTGG + Intergenic
1023558164 7:41444894-41444916 CTGGGGGTGGGGTGGGGAGTTGG + Intergenic
1023669875 7:42564337-42564359 CGGAGGAAAAGGTGGGAAGGTGG + Intergenic
1023939894 7:44762742-44762764 CTGAGGGCAGGGTGAGCTGGGGG - Intronic
1024030654 7:45456968-45456990 TTGAGGGTGGGGTTGGAAGTGGG - Intergenic
1024071732 7:45791998-45792020 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1024175075 7:46831269-46831291 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
1024458031 7:49631138-49631160 CTGAGTGTAGGCTGGCAATGGGG + Intergenic
1024518865 7:50285154-50285176 GGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1024525254 7:50343158-50343180 GGGAGGGTGGGGAGGGAAGGAGG - Intronic
1024600221 7:50974034-50974056 CTGAGGGTAGGATGGCACGGTGG + Intergenic
1024650769 7:51401433-51401455 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1024665080 7:51538089-51538111 CAGGGGGAAGGGTGGGAGGGAGG - Intergenic
1024969930 7:55059627-55059649 GTTTGGGGAGGGTGGGAAGGAGG - Intronic
1025054890 7:55757013-55757035 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025132963 7:56387239-56387261 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025184599 7:56847662-56847684 ATGAGAATGGGGTGGGAAGGGGG - Intergenic
1025227436 7:57177660-57177682 CACAGGGTGGGATGGGAAGGTGG + Intergenic
1025321606 7:58100272-58100294 ATGAGGGAAGGAAGGGAAGGAGG + Intergenic
1025687330 7:63729306-63729328 ATGAGAATGGGGTGGGAAGGGGG + Intergenic
1025844072 7:65179735-65179757 CTGAGGTGAGGTTGGGAAGAAGG + Intergenic
1025894400 7:65686044-65686066 CTGAGGTGAGGTTGGGAAGAAGG + Intergenic
1025909515 7:65817104-65817126 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1025911028 7:65828827-65828849 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1025928847 7:65979673-65979695 CACAGGGTGGGGCGGGAAGGTGG + Intronic
1026179785 7:68028789-68028811 CGGAGGGAAGGGAGGGAGGGAGG - Intergenic
1026307176 7:69152319-69152341 CAGAGGGGAGAGTGAGAAGGGGG + Intergenic
1026577279 7:71582811-71582833 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
1026969081 7:74457093-74457115 GTGAGGCTGGGGTGGGAGGGTGG - Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027133106 7:75605350-75605372 CTGAGGGCCGGGGGGGATGGAGG + Intronic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1028104775 7:86864170-86864192 CGGGGGGAAGGGTGGGAAGGAGG - Intronic
1028163081 7:87507978-87508000 ATTAGTGTAGGGAGGGAAGGGGG + Intronic
1028234792 7:88347604-88347626 CTGAGGGTCTGGTGGTAAGTTGG + Intergenic
1028239062 7:88397459-88397481 GTGAGGATAGAGTGAGAAGGTGG + Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028748002 7:94349375-94349397 CGGGGGGTAGGGTGGGTAGAGGG + Intergenic
1028784051 7:94772283-94772305 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1028855134 7:95583061-95583083 CGGGGGCTGGGGTGGGAAGGAGG - Intergenic
1029053657 7:97717046-97717068 GCGGGGGAAGGGTGGGAAGGGGG + Intergenic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1029551492 7:101239234-101239256 GGGAGGGGAGGGTGGGGAGGAGG + Intergenic
1029824931 7:103181224-103181246 GTTAGGGTGGGGTGGGAATGTGG - Intergenic
1030321978 7:108178905-108178927 CTGAGGAGAGGGTGGAAATGAGG - Intronic
1030728639 7:112957130-112957152 CTCAGGGTGGGGTGGGGTGGGGG + Intergenic
1031384715 7:121134452-121134474 GGGAGGGTAGGAAGGGAAGGAGG + Intronic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1031567346 7:123317133-123317155 AGGAGGGGAGGGTGGGAGGGTGG + Intergenic
1031681481 7:124680628-124680650 GAGAGGATAGAGTGGGAAGGGGG - Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1031970748 7:128063184-128063206 CTGAGGGATGGGTGGTGAGGAGG + Intronic
1032048349 7:128629604-128629626 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1032049950 7:128642427-128642449 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1032201366 7:129825328-129825350 CGGGGGGCAGGGTGGGAAGAGGG - Intergenic
1032242432 7:130174390-130174412 TTGAGGGTAGGGGTGGAGGGTGG + Intronic
1032455533 7:132070670-132070692 CGGAGGGGAGGGTGGGCGGGGGG - Intergenic
1032511829 7:132478908-132478930 CTGAGGCTTTGGTGGCAAGGAGG - Intronic
1033226594 7:139567863-139567885 CTGAGGGCAGGGTGGGGTGTGGG - Exonic
1033363140 7:140652054-140652076 GTGAGTGTGGGGTGGGAAGAGGG + Intronic
1033488049 7:141811125-141811147 CTGAAAATAGAGTGGGAAGGTGG - Intergenic
1033918568 7:146358860-146358882 ATGAGGCTGGAGTGGGAAGGAGG + Intronic
1034049201 7:147964165-147964187 ATGAGGACACGGTGGGAAGGTGG + Intronic
1034203525 7:149296705-149296727 CTGGGGGTTGAGTGGGGAGGAGG - Intronic
1034277210 7:149829206-149829228 CTGAGGGGACTGTGGGAAGAGGG - Intergenic
1034286360 7:149885579-149885601 CTGAGGTTAGGGAGCCAAGGCGG - Intergenic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034313495 7:150110443-150110465 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313514 7:150110512-150110534 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313532 7:150110581-150110603 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034339031 7:150340697-150340719 CTGGGGGGAGGGTGGGGAGCGGG + Exonic
1034381978 7:150705150-150705172 GAGTGGGGAGGGTGGGAAGGGGG + Intergenic
1034415759 7:150963568-150963590 CTGGGGCTGGGGTGGGAATGGGG - Intronic
1034415773 7:150963597-150963619 CTGAGGCTGGGGTGGGAGTGGGG - Intronic
1034466111 7:151230161-151230183 CCCAGGGCAGGGTGGGCAGGGGG - Intergenic
1034574785 7:151987613-151987635 CTGGGGGTGGGGTGGGCGGGAGG + Intronic
1034724765 7:153325106-153325128 CTCAGAGGTGGGTGGGAAGGTGG + Intergenic
1034776142 7:153828407-153828429 CTGAGGGAAGGGTGGGCACCTGG + Intergenic
1034793365 7:153990221-153990243 CTGAGGGTGGGGCTGGAAGAGGG - Intronic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034829344 7:154295664-154295686 CTGAGGGTAGGGAGGGGAAGGGG - Intronic
1034868153 7:154658263-154658285 CTGAGGGCAGGGGAAGAAGGAGG + Intronic
1034914368 7:155024643-155024665 GTGAGGGTAGAGTGAGAAGCTGG + Intergenic
1035038085 7:155908372-155908394 CTGAGGGCAGGGAGGAGAGGGGG - Intergenic
1035242167 7:157539376-157539398 CTGTGGGAAGGGCGGGATGGAGG + Exonic
1035382449 7:158448488-158448510 AGGAGGGTGGGGTGGGGAGGGGG + Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035785504 8:2256847-2256869 CAGAGAGCAGGGTGGGAAGCAGG + Intergenic
1035807304 8:2464869-2464891 CAGAGAGCAGGGTGGGAAGCAGG - Intergenic
1035853851 8:2951267-2951289 CTGAAGGAACTGTGGGAAGGGGG + Exonic
1036384937 8:8270615-8270637 CTGTGGGTAGGGTGGGGCAGAGG - Intergenic
1036685292 8:10905355-10905377 CTAAGGGTGGGGTGTGAAGAAGG - Intronic
1036942690 8:13066869-13066891 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1036946105 8:13096259-13096281 TTGAGGGTTTGGTGGGATGGGGG + Intronic
1037353502 8:17991849-17991871 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1037606127 8:20438644-20438666 CAGAGGGCAGGATGGGAAGAGGG + Intergenic
1037914093 8:22761392-22761414 CTGGGGGGAGGCGGGGAAGGCGG + Intronic
1038074895 8:24061000-24061022 CTCAGGAAAGGGTGGGAAGGGGG + Intergenic
1038205134 8:25458430-25458452 CTAGGGGCGGGGTGGGAAGGAGG - Exonic
1039415879 8:37393726-37393748 CTTTGGGAAGGGTGGGAAGCTGG - Intergenic
1039417353 8:37407137-37407159 CTGATGGCAGGGTTGGCAGGTGG - Intergenic
1039479211 8:37859265-37859287 CTGGGAGAAGGGTGGGAGGGAGG + Exonic
1039822354 8:41145345-41145367 AGGAGGGTAGGGTGGGGAGATGG + Intergenic
1040292387 8:46132153-46132175 CTCAGGGTGGGGTGGGCGGGCGG - Intergenic
1040392290 8:46960618-46960640 ATGGGGAAAGGGTGGGAAGGGGG - Intergenic
1040680837 8:49806578-49806600 CAAAGGGAAGGGTGGGAGGGGGG + Intergenic
1040812830 8:51475769-51475791 GTGAGGGAAGGGAGGGAGGGGGG - Intronic
1040839799 8:51772683-51772705 CTGTGTGGAAGGTGGGAAGGAGG + Intronic
1041242599 8:55861046-55861068 CTGGGGGTGGGGTGGGATGGGGG + Intergenic
1041383820 8:57278909-57278931 CTGACCGTAGGGTGGGAGGGAGG + Intergenic
1041627873 8:60051814-60051836 CTGTGAGTGGGGTGGGAAGTGGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041799976 8:61788090-61788112 CTATGGGTGGGGTAGGAAGGGGG + Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042148782 8:65759411-65759433 CTGAAGCCAGGGTGGGAAGTGGG - Intronic
1042339720 8:67666410-67666432 CTGAGAGAGGGGTGGGGAGGGGG + Intronic
1042547190 8:69961303-69961325 CTGAGAGGAGGGTGGGAATGGGG - Intergenic
1042723614 8:71849188-71849210 CTGGGGGTAGGCTGGGGAGAGGG + Intronic
1042858689 8:73293430-73293452 CTGAGGCTAGGGTTGGGATGCGG - Intronic
1043979473 8:86621632-86621654 CAGGGAGAAGGGTGGGAAGGGGG - Intronic
1044249338 8:89988015-89988037 CTGAGAGTAGGGTGGGGTGCGGG + Intronic
1044255322 8:90053487-90053509 GTGAGAGGTGGGTGGGAAGGTGG - Intergenic
1044379535 8:91517929-91517951 ATGAGGGTGGGGTGGGAAGTGGG - Intergenic
1044483370 8:92719651-92719673 TAGAGGGTAGGGTGGGTAGAGGG - Intergenic
1044880471 8:96718137-96718159 CTGAGGGGTGAGTGGGAAGTGGG - Intronic
1045224830 8:100234421-100234443 CTGAGGGTAGGGGTGGAGGGAGG - Intronic
1045288384 8:100811424-100811446 TGGGAGGTAGGGTGGGAAGGTGG - Intergenic
1045529880 8:102974384-102974406 CGGGAGGAAGGGTGGGAAGGAGG - Intronic
1045878418 8:107009989-107010011 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
1046902739 8:119540574-119540596 CTAGGGGTGGGGTGTGAAGGTGG - Intergenic
1047188985 8:122661019-122661041 CTGAATGTAGGGGAGGAAGGTGG - Intergenic
1047237486 8:123054836-123054858 TGGGGGGAAGGGTGGGAAGGGGG + Intronic
1047289965 8:123521200-123521222 CTGGGGGTAGAGTGGGAAACAGG - Intronic
1047330346 8:123881294-123881316 ATGAGGGTAGGGTAGAATGGTGG + Intronic
1047484543 8:125317114-125317136 TTGAGGGTATTCTGGGAAGGTGG - Intronic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048314112 8:133349572-133349594 GTGAGGGAAGGGAAGGAAGGGGG + Intergenic
1048361624 8:133701989-133702011 CTGAGGTGATGGTGGGGAGGGGG + Intergenic
1048408819 8:134150679-134150701 GGGAAGGTAGGGTGGGGAGGTGG - Intergenic
1048573896 8:135676275-135676297 AAGAGGGTGGGGTGGGGAGGAGG - Intergenic
1048985573 8:139732976-139732998 CTGAGGTCAGGGTGGGGTGGGGG + Intronic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049152480 8:141044237-141044259 CAGAGGGTAGAGTGGGAAGCTGG - Intergenic
1049270559 8:141693439-141693461 CTGAGGGATGGGCAGGAAGGAGG + Intergenic
1049356847 8:142193269-142193291 CTGAGGGTGGGAGGGAAAGGCGG - Intergenic
1049378534 8:142300938-142300960 CAGAGGGGAGGGTGGGCAGGAGG + Intronic
1049583301 8:143422263-143422285 CTGAGGACTGGGTGGGAGGGAGG + Intronic
1049696663 8:143987304-143987326 CTGAGGGGTGAGTGGGAAGTAGG - Intronic
1050194282 9:3064444-3064466 AGTAGGGTGGGGTGGGAAGGAGG - Intergenic
1050419896 9:5452340-5452362 CCAAGGGTAGGATGGGTAGGAGG - Intronic
1050624045 9:7484872-7484894 TGGAGGGTAGGGTGGGAGGAAGG + Intergenic
1050663461 9:7909017-7909039 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1050991937 9:12166842-12166864 CTGAGGGGAGGATGAGTAGGAGG - Intergenic
1051542166 9:18231858-18231880 CTGAGGGTAGATTCTGAAGGTGG - Intergenic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1051897798 9:22006419-22006441 CTGAAGGTGGGGTGGGAAAGTGG - Intronic
1052392139 9:27892738-27892760 CTGAGGAAAGGGTGGGGAGGAGG - Intergenic
1052503001 9:29316909-29316931 CTTAAGGGAGGGAGGGAAGGGGG + Intergenic
1052998758 9:34565835-34565857 CAGCGGGTAGGATGAGAAGGGGG - Intronic
1053135527 9:35648154-35648176 CGGAGGGTAGAGTGAGATGGGGG - Intergenic
1053281926 9:36826124-36826146 CTGGGGGTGGGGGGGGGAGGGGG - Intergenic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1053620648 9:39810780-39810802 CTGAGGAGAGGGTGAGATGGAGG + Intergenic
1053626061 9:39873155-39873177 CTGAGGAGAGGGTGAGATGGAGG - Intergenic
1054217827 9:62377546-62377568 CTGAGGAGAGGGTGAGATGGAGG + Intergenic
1054263515 9:62896664-62896686 CTGAGGAGAGGGTGAGATGGAGG - Intergenic
1054916454 9:70499139-70499161 CTGAGGGCAGGCTGGGGAGCTGG + Intergenic
1054941005 9:70741817-70741839 TTGGGGAAAGGGTGGGAAGGGGG + Intronic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056027148 9:82510764-82510786 CAGGGGGAAGGGTGGGAGGGAGG + Intergenic
1056053556 9:82796490-82796512 CTGAGGGTAGGGTGGAAGAAGGG + Intergenic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056280758 9:85039086-85039108 CCAAGGGTTGGGTGGGAGGGTGG + Intergenic
1056838300 9:89976018-89976040 CAGAGAACAGGGTGGGAAGGAGG + Intergenic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1057816708 9:98301220-98301242 CTGAGGGTAGGGTGGGGGTCAGG + Intronic
1058733505 9:107873302-107873324 CTGAGGACAGGGTGGGAGTGAGG - Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1058944196 9:109841605-109841627 AAGAGGGTAGGGTGGGGGGGTGG + Intronic
1058947167 9:109868476-109868498 CAGAGGACTGGGTGGGAAGGTGG + Intronic
1059009146 9:110437784-110437806 TTGAGGGAAGGGTGAGAAGTGGG - Intronic
1059283633 9:113154759-113154781 AAGAGGATAGGGTGGGAGGGAGG - Intronic
1059330779 9:113534105-113534127 CTGAGGGTTGGGTTGGATGCAGG + Intronic
1059398806 9:114055571-114055593 CTGAGTGGGGGGTGGGGAGGAGG - Exonic
1059452005 9:114376524-114376546 CTGGTGATAGGGTGGGCAGGAGG + Exonic
1059667863 9:116466119-116466141 TTGCGGGGAGGGTGGGAAGCGGG + Intronic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060554642 9:124501948-124501970 TTGAGGGTAGGGAGGCAAAGAGG + Intronic
1060557411 9:124515523-124515545 CTGGGGGTGGGGTGGGGTGGGGG + Intergenic
1060927802 9:127467439-127467461 CTTAAGGGAGGGAGGGAAGGGGG + Intronic
1060968565 9:127724936-127724958 CCGAGGGCAGGGCGGGCAGGAGG + Intronic
1061230923 9:129315425-129315447 GTGGGGGTGGGGTGGGGAGGTGG + Intergenic
1061339207 9:129965767-129965789 GGGAGGGAAGGGAGGGAAGGAGG + Intronic
1061742897 9:132720290-132720312 CTGGGAGTGGGGTGGGGAGGAGG + Intergenic
1061920175 9:133778361-133778383 CTGAGGTAGGGGTGGGGAGGAGG + Intronic
1062010837 9:134265821-134265843 ATGAAGGTAGGGAGGGAAGGAGG - Intergenic
1062022950 9:134327638-134327660 CTGCAGGGAGGGTGGGCAGGAGG - Intronic
1062141348 9:134960831-134960853 CTGAGGCTGGGCCGGGAAGGAGG + Intergenic
1062266868 9:135690576-135690598 ATGAGGGTGGGGTGGGAGGTGGG - Intergenic
1062437589 9:136553442-136553464 CTCAGTGTAGGGGGGGAAGGGGG + Intergenic
1062465150 9:136677623-136677645 CTGGGGGTGGGGTGTGGAGGAGG + Intronic
1062475809 9:136726614-136726636 CTGAAGGGATAGTGGGAAGGTGG - Intergenic
1062542637 9:137048428-137048450 CTGAGGGTGGGGTGGAAGGATGG + Exonic
1062696663 9:137879178-137879200 CTGAGGGCAGGGTGGTGGGGAGG + Intronic
1062751957 9:138261861-138261883 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1062753559 9:138274642-138274664 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1203769682 EBV:43060-43082 CTGAGGTGAGTGTGGGAAGATGG + Intergenic
1203576071 Un_KI270745v1:9421-9443 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1185633487 X:1534849-1534871 GTGTGGGTAGGGTTGGAGGGAGG + Intronic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1185700498 X:2227734-2227756 GGGAGGGAAGGATGGGAAGGAGG + Intronic
1185811722 X:3116428-3116450 TGGAGGAAAGGGTGGGAAGGGGG + Intergenic
1185887280 X:3794047-3794069 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1186137305 X:6533575-6533597 CTGATGGTGGGGAGGGAGGGAGG - Intergenic
1186187279 X:7033589-7033611 CTGAGTGTAGGGTGTGGAGTGGG + Intergenic
1186196115 X:7111492-7111514 CTGGGGGTGGGGTGGGGCGGGGG + Intronic
1186267139 X:7844164-7844186 CTGATGGTGGGGAGGGAGGGAGG + Intergenic
1186298006 X:8169901-8169923 CTGATGGTGGGGAGGGAGGGAGG - Intergenic
1186319947 X:8413445-8413467 CTGAGGGTAGGCTAGGGATGTGG - Intergenic
1186324844 X:8466531-8466553 CTGATGGTGGGGAGGGAGGGAGG + Intergenic
1186348810 X:8722349-8722371 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1186373833 X:8976376-8976398 CTGGGAATAGGGTGGGAAAGAGG + Intergenic
1186559482 X:10595658-10595680 CTGAGGGTATGGGGGAAGGGAGG + Intronic
1186927468 X:14350905-14350927 CGGAGGGGCTGGTGGGAAGGTGG + Intergenic
1187098364 X:16169105-16169127 TTCATGGTGGGGTGGGAAGGAGG + Intronic
1187228131 X:17394002-17394024 CTGAGGGTGCGGTGGGGGGGCGG - Intronic
1187357597 X:18591778-18591800 CTGAGTCTAGGGGAGGAAGGAGG - Intronic
1187557958 X:20370078-20370100 CTGAGGGTAGGGTTGGGGGCTGG - Intergenic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1188282637 X:28289285-28289307 GTGACAGTTGGGTGGGAAGGTGG - Intergenic
1188509902 X:30924270-30924292 GTAAGGGCAGGGTGGGGAGGTGG + Intronic
1189336754 X:40175157-40175179 CTGGGGGTGGGGTGGGGCGGGGG + Intronic
1189434168 X:40976536-40976558 CAGAGGAAAGGGTGGGGAGGGGG - Intergenic
1189703957 X:43741522-43741544 CTAAGGAAAGGGTGGGAGGGAGG - Intronic
1190042522 X:47082695-47082717 CTGAGGGTAGAATGGGGATGGGG + Intronic
1190304777 X:49075774-49075796 CTGAGGTTGGGGTGGTATGGAGG + Intronic
1191670064 X:63740726-63740748 CTGAGTGAAGGGTGGGAAGCAGG - Intronic
1191965619 X:66754013-66754035 CAAGGGGAAGGGTGGGAAGGGGG - Intergenic
1192204026 X:69084304-69084326 CTGAGGGTAGGTTGGCAAAGTGG + Intergenic
1192683575 X:73280359-73280381 CTGGGGGGAAGGTGGGGAGGGGG + Intergenic
1192951549 X:76022876-76022898 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1193437271 X:81490916-81490938 CAGAGGCTAGGGTGGTTAGGAGG + Intergenic
1193917585 X:87383919-87383941 CAAGGGGAAGGGTGGGAAGGAGG + Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194347369 X:92782817-92782839 CAGGGGGAAGGGTGGGAAAGAGG + Intergenic
1194766950 X:97852459-97852481 GTGGGGGTAGGGTGGGAAGTTGG + Intergenic
1194816252 X:98445609-98445631 CTGAGGGGTAGGTTGGAAGGGGG + Intergenic
1194978653 X:100417630-100417652 GTGGGGGTGGGGTGGGAAGGAGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195401504 X:104465984-104466006 TTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1195746235 X:108121505-108121527 CTGAGTGTAGGGTGGGGCAGGGG - Intronic
1195870226 X:109477994-109478016 CTGAGGGGTGTGTGGGATGGGGG + Intronic
1195984701 X:110616137-110616159 CAGAGGAAAGGATGGGAAGGGGG - Intergenic
1196440927 X:115719580-115719602 GTTGGGGGAGGGTGGGAAGGAGG - Intergenic
1196743792 X:119049776-119049798 CTGGGGGTAGGGGGAGATGGTGG + Intergenic
1196767691 X:119263438-119263460 ATGAGGGTAGGGAGGAAATGTGG - Intergenic
1196976708 X:121166167-121166189 CTGAGGATAGGGTGGGGAGGAGG - Intergenic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197239024 X:124103563-124103585 TTGGGGGCAGGGTGGGAAGGGGG - Intronic
1197843602 X:130776759-130776781 TTAAGGGTAGGCTGGGATGGAGG + Intronic
1198064715 X:133084887-133084909 AGGAGGAAAGGGTGGGAAGGGGG - Intronic
1198657921 X:138934983-138935005 CTGAGGGCAGGGGGAGAAGAGGG - Intronic
1198954723 X:142115948-142115970 TTGAGAGTAGGGTGGTGAGGAGG + Intergenic
1198954824 X:142117213-142117235 TTGAAGGTAGGGTGGTGAGGAGG + Intergenic
1199111412 X:143939774-143939796 CAGAGGGTAGGGGTGGGAGGAGG + Intergenic
1199293264 X:146129149-146129171 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1199766509 X:150945490-150945512 ATGAAGGCAGGGTGGGAAGTAGG - Intergenic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1200616748 Y:5388154-5388176 CTCAGGGTAGGGTGTGAATCTGG - Intronic
1201578236 Y:15483587-15483609 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic