ID: 1092363313

View in Genome Browser
Species Human (GRCh38)
Location 12:7856463-7856485
Sequence CACACATTAGTTTTTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 451}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092363313 Original CRISPR CACACATTAGTTTTTGAGAC AGG (reversed) Intronic
901296249 1:8162885-8162907 CTCACTTTTTTTTTTGAGACAGG + Intergenic
901843882 1:11970425-11970447 AAGACCTTATTTTTTGAGACAGG - Intronic
902412925 1:16222083-16222105 TACAAACTAGTTTGTGAGACAGG + Intergenic
902608664 1:17583855-17583877 AACAAATTTTTTTTTGAGACAGG + Intronic
903196458 1:21692555-21692577 CACACATTATATTCTGAGAACGG + Intronic
903369079 1:22823398-22823420 CACACATTAGTTCAAGATACAGG - Intronic
904579965 1:31535594-31535616 CACCCTTTTATTTTTGAGACAGG - Intergenic
904817741 1:33218424-33218446 TTCACATTTTTTTTTGAGACAGG - Intergenic
905488527 1:38325290-38325312 CATACATTATTTTTTAAGCCAGG - Intergenic
905708817 1:40083447-40083469 AAAAAAATAGTTTTTGAGACAGG - Intronic
905991771 1:42343501-42343523 CACACTTTTTTTTTTGAGATAGG - Intergenic
906420026 1:45657841-45657863 TACTCATTTATTTTTGAGACAGG - Intronic
906426625 1:45719649-45719671 CACATATTAGTTTTGGTGGCTGG + Intronic
906940367 1:50250399-50250421 CACACATACATATTTGAGACAGG - Intergenic
907189889 1:52639792-52639814 AAAACATTTTTTTTTGAGACAGG + Intronic
907488902 1:54796317-54796339 CACACCTTTGTTTGTGAGGCTGG + Intronic
909089541 1:71208088-71208110 CACACATTTTTTTATAAGACCGG - Intergenic
909832940 1:80216479-80216501 CACACATCAGTATGTGATACGGG + Intergenic
911021889 1:93397538-93397560 CACACATACAATTTTGAGACAGG + Intergenic
911249201 1:95556320-95556342 CACAATTCTGTTTTTGAGACAGG + Intergenic
911450061 1:98050723-98050745 CAAACATTATTTTTTAAAACTGG - Intergenic
913452009 1:118998904-118998926 AACACATCAGTGTTTGAGAAAGG - Intergenic
915422784 1:155798073-155798095 TATATATTTGTTTTTGAGACAGG - Intronic
915938811 1:160105415-160105437 GACACATTTTTTTTTGAGACAGG - Intergenic
916716415 1:167450486-167450508 CACTTATTTTTTTTTGAGACAGG - Intronic
916790816 1:168123450-168123472 TACATATAATTTTTTGAGACAGG - Intronic
917691487 1:177474295-177474317 CAAACAGTAGTTTATGAGAATGG + Intergenic
918034522 1:180854690-180854712 CACACATTGTTTTTAGGGACTGG + Intronic
918317747 1:183336386-183336408 CACATATTGGTTTTTCAAACTGG - Intronic
919100271 1:193088016-193088038 CAAACTTTTTTTTTTGAGACAGG + Intronic
920357245 1:205383092-205383114 CATACATATTTTTTTGAGACAGG + Intronic
920806817 1:209242593-209242615 CACAATTTTTTTTTTGAGACAGG + Intergenic
921350741 1:214231764-214231786 CACACAGTAAGTTGTGAGACTGG - Intergenic
922410901 1:225374101-225374123 TACACCTTTTTTTTTGAGACAGG - Intronic
923370249 1:233303507-233303529 CATATATGATTTTTTGAGACAGG - Intergenic
923605978 1:235443205-235443227 CACACAATTTTTTTTGAGACAGG + Intronic
924471712 1:244348742-244348764 CAAAAAATTGTTTTTGAGACAGG + Intergenic
1063459826 10:6208080-6208102 CAAACTTTGTTTTTTGAGACAGG + Intronic
1063931700 10:11035103-11035125 CACACATTCGTATTTAAGAAAGG - Intronic
1065097852 10:22299660-22299682 CGAACTTTATTTTTTGAGACAGG + Intergenic
1065144907 10:22759064-22759086 CAACCATTAGTTGTTGAGACCGG - Intergenic
1065159663 10:22906627-22906649 CTCCCATTTTTTTTTGAGACAGG - Intergenic
1065208847 10:23382849-23382871 TACTCATTTTTTTTTGAGACAGG - Intergenic
1065507447 10:26443551-26443573 CATTCATTCATTTTTGAGACAGG + Intronic
1065762143 10:28992342-28992364 CACACATATTTTTTTCAGACAGG + Intergenic
1065965549 10:30767706-30767728 CACCAATTTTTTTTTGAGACAGG - Intergenic
1066815936 10:39412645-39412667 CACAAAGTAGTTTTTCAGAAAGG - Intergenic
1066896903 10:41022076-41022098 CACAAAGTAGTTGTTGAGAATGG - Intergenic
1067105714 10:43364809-43364831 AACACTTTTTTTTTTGAGACAGG - Intergenic
1067655474 10:48188383-48188405 CACAGAGTAGCTTTGGAGACTGG + Intronic
1068107272 10:52634330-52634352 CCCACTTTTTTTTTTGAGACAGG - Intergenic
1068590075 10:58844328-58844350 CCCACCTTATTTTTTGAAACAGG - Intergenic
1069299965 10:66895235-66895257 CACACTTTATTGTGTGAGACAGG + Intronic
1069998912 10:72361540-72361562 GACACCTTTTTTTTTGAGACAGG + Intergenic
1070578653 10:77701613-77701635 TACACTTTGTTTTTTGAGACAGG + Intergenic
1070899067 10:80011868-80011890 CTTATATTATTTTTTGAGACAGG - Intergenic
1071426061 10:85553584-85553606 AATACATGACTTTTTGAGACTGG - Intergenic
1072125004 10:92437706-92437728 CACCAATTTTTTTTTGAGACAGG - Intergenic
1074601046 10:114913414-114913436 AATACAATATTTTTTGAGACAGG + Intergenic
1075131545 10:119743973-119743995 CACCTGTTAGTTTTTGAGAGAGG - Intronic
1075355382 10:121768089-121768111 CATACAGTATTTTTTGTGACTGG - Intronic
1075885333 10:125895611-125895633 CACACAATAGTCTTTCATACTGG - Intronic
1077429077 11:2506841-2506863 CACACATGACTTTTAGACACAGG - Intronic
1078389672 11:10926116-10926138 TATACATTTTTTTTTGAGACAGG + Intergenic
1078577691 11:12515839-12515861 TACCCTTTTGTTTTTGAGACAGG + Intronic
1078723091 11:13902161-13902183 CATAGATTTTTTTTTGAGACAGG + Intergenic
1078845858 11:15117956-15117978 GACACTTGAGCTTTTGAGACAGG - Intronic
1080719665 11:34836960-34836982 CACATTTTATTTTTTGAGACAGG - Intergenic
1080859424 11:36140432-36140454 AGCACATCAATTTTTGAGACAGG + Intronic
1081898835 11:46610312-46610334 CACACATGTATTTTTGAAACAGG - Intronic
1082516950 11:53909292-53909314 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1083514064 11:63239704-63239726 CAAACATAAGTTTTTCAGAAAGG + Intronic
1083910683 11:65707479-65707501 TACATGTTTGTTTTTGAGACGGG - Intergenic
1083971309 11:66077553-66077575 CACCCATTTTTGTTTGAGACAGG - Intronic
1087703292 11:101461560-101461582 TTCATTTTAGTTTTTGAGACAGG - Intronic
1087936106 11:104036436-104036458 AACACATTTTTTTTTGAGACAGG - Intronic
1088285182 11:108180319-108180341 CTTACATTATTTTTTGAGACAGG - Intronic
1088650859 11:111957164-111957186 TACCTATTATTTTTTGAGACAGG - Intronic
1090080238 11:123607612-123607634 CACACCTTAGTTTATGTGAAAGG - Intronic
1090778021 11:129982250-129982272 CACACACATTTTTTTGAGACAGG - Intronic
1090792677 11:130105407-130105429 CACCCTTTTTTTTTTGAGACAGG - Intronic
1091736502 12:2926477-2926499 AACTTATTATTTTTTGAGACAGG - Intronic
1092363313 12:7856463-7856485 CACACATTAGTTTTTGAGACAGG - Intronic
1092449670 12:8590233-8590255 TAGACTTTTGTTTTTGAGACAGG - Intergenic
1095016612 12:36987565-36987587 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1095353252 12:41240346-41240368 CACCCATTATGTTTTGAGACAGG - Intronic
1095565042 12:43613240-43613262 AACAAATTTTTTTTTGAGACAGG + Intergenic
1095753866 12:45741194-45741216 CATTTATTTGTTTTTGAGACTGG + Intronic
1096275598 12:50205076-50205098 CATATTTTATTTTTTGAGACAGG + Intronic
1096752537 12:53770891-53770913 CACTGATTTTTTTTTGAGACAGG + Intergenic
1097872654 12:64613940-64613962 GACAGTTTTGTTTTTGAGACAGG - Intronic
1098414873 12:70221730-70221752 TACACATGACTTTTTGAAACTGG + Intergenic
1098970166 12:76846141-76846163 CACACATTAGTGTTCAAGAATGG + Intronic
1099597351 12:84683783-84683805 TACTCGTTAATTTTTGAGACTGG + Intergenic
1099787993 12:87292149-87292171 CTCATTTTATTTTTTGAGACAGG + Intergenic
1099963770 12:89423008-89423030 TACACACTTTTTTTTGAGACAGG + Intronic
1100136971 12:91565535-91565557 CAAACGTTAGTCTTTGATACAGG + Intergenic
1100512571 12:95291223-95291245 CACACATATATTTTTGAGACAGG - Intronic
1100725259 12:97401473-97401495 CAAAAAATATTTTTTGAGACAGG - Intergenic
1100830483 12:98512476-98512498 CACATATTGATTTTAGAGACAGG + Intergenic
1102144339 12:110643678-110643700 CTTATATTATTTTTTGAGACAGG + Intronic
1102154682 12:110715324-110715346 CAAAAATTATTTTTTGAGACAGG + Intergenic
1102335261 12:112073281-112073303 CACACATATATTTTTGAGATGGG + Intronic
1102982337 12:117251735-117251757 CAAACTTTTTTTTTTGAGACAGG + Intronic
1103548439 12:121718498-121718520 CATTCATTTATTTTTGAGACAGG - Intronic
1103657045 12:122479857-122479879 AACTAATTATTTTTTGAGACAGG + Intronic
1104438072 12:128771700-128771722 AACATTTTATTTTTTGAGACAGG - Intergenic
1105064915 12:133188200-133188222 CCCACTTTTTTTTTTGAGACAGG + Intronic
1105970854 13:25428176-25428198 CAGACTTTTTTTTTTGAGACAGG - Intronic
1106078136 13:26478297-26478319 CGCACTTTATTTTTTAAGACAGG + Intergenic
1106162114 13:27211019-27211041 AAAACATTTTTTTTTGAGACAGG + Intergenic
1108514700 13:51189428-51189450 CACACATTAGTTCCAGAGATGGG + Intergenic
1108539075 13:51419799-51419821 TTCACATTAGTTTTAGAGAGTGG - Intronic
1110016030 13:70405298-70405320 CACTTTTTATTTTTTGAGACAGG + Intergenic
1110912113 13:80978286-80978308 TATTTATTAGTTTTTGAGACAGG + Intergenic
1111869870 13:93817850-93817872 TATACATTATTTTTTGAAACAGG - Intronic
1112381154 13:98891549-98891571 CACATATAAATTTTTGAGAGAGG + Intronic
1112419603 13:99235960-99235982 CACAATTTTTTTTTTGAGACAGG - Intronic
1112926783 13:104685759-104685781 CACAAATTAATTATAGAGACTGG - Intergenic
1113564616 13:111312155-111312177 CACATTTTTGTTTTTGAGACAGG - Intergenic
1113870381 13:113555687-113555709 TATACATTCTTTTTTGAGACAGG - Intergenic
1115248539 14:31321162-31321184 CAGACTTTTTTTTTTGAGACAGG + Intronic
1116146637 14:41080876-41080898 CACACATTCATTTATCAGACTGG - Intergenic
1118287014 14:64484377-64484399 CACTCATTATTCTTTGACACAGG - Exonic
1118598392 14:67453626-67453648 CCCACCATAGTTTCTGAGACAGG - Intronic
1119280395 14:73401867-73401889 CCTAAATTTGTTTTTGAGACAGG + Intronic
1121121579 14:91379222-91379244 CACACATTAGTTTGTGATGCTGG - Intronic
1121978057 14:98424543-98424565 AATACATTTATTTTTGAGACAGG + Intergenic
1202872720 14_GL000225v1_random:178316-178338 CACACAATAGTCTTTCATACTGG + Intergenic
1123626611 15:22231196-22231218 AACACATTTTTTTTTGAGATAGG - Intergenic
1125906677 15:43399371-43399393 CACACTATTTTTTTTGAGACAGG + Intronic
1127852169 15:62923490-62923512 TATACATTTTTTTTTGAGACAGG + Intergenic
1128027356 15:64449369-64449391 CAAACTTTTATTTTTGAGACAGG + Intronic
1128141694 15:65305910-65305932 GTTACTTTAGTTTTTGAGACAGG + Intergenic
1128189389 15:65677215-65677237 CAAAAATTTTTTTTTGAGACAGG + Intronic
1129484451 15:75856179-75856201 TATACATTTTTTTTTGAGACGGG - Intronic
1129654409 15:77514531-77514553 CACACTTCACTTTTTGAAACAGG - Intergenic
1131285594 15:91054224-91054246 CTCTCTTTTGTTTTTGAGACAGG - Intergenic
1133338390 16:5021161-5021183 GTCACATTTTTTTTTGAGACAGG + Intergenic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1135823954 16:25709746-25709768 CACATCTTAGGTTTAGAGACTGG - Intronic
1136542269 16:30934650-30934672 CACATTTTTTTTTTTGAGACAGG - Intronic
1136917822 16:34226467-34226489 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1136919489 16:34251607-34251629 CACAAAGTAGTTTGTGAGAATGG - Intergenic
1137451257 16:48576902-48576924 CACACTTTTATTTTAGAGACAGG + Intronic
1137770603 16:51013152-51013174 CAGACATCAGTTTCAGAGACTGG + Intergenic
1137968724 16:52962415-52962437 CCCACTTTTTTTTTTGAGACAGG + Intergenic
1138436854 16:57006001-57006023 TACACATTTTTTTTTGAGACAGG + Intronic
1139422612 16:66857931-66857953 TACATTTTTGTTTTTGAGACAGG - Intronic
1139426406 16:66882829-66882851 TAAAATTTAGTTTTTGAGACAGG + Intronic
1139600122 16:67981441-67981463 AACAAATTTTTTTTTGAGACAGG + Intergenic
1140414216 16:74762048-74762070 CACAATTTTTTTTTTGAGACAGG + Intronic
1140422969 16:74835909-74835931 AAATTATTAGTTTTTGAGACAGG - Intergenic
1140433588 16:74925977-74925999 AAAACATTTTTTTTTGAGACAGG - Intronic
1141252894 16:82374912-82374934 CATACTTTTGTTTTTGAGACAGG + Intergenic
1142530456 17:576218-576240 AACACATTAGGTTCTGAGAGAGG - Intronic
1142657234 17:1402207-1402229 CCCACTTTATTTTTTGAGACAGG - Intergenic
1143245193 17:5478823-5478845 CAAAAATTGTTTTTTGAGACAGG + Intronic
1143759954 17:9093966-9093988 CACATTTTCTTTTTTGAGACAGG - Intronic
1144588001 17:16500305-16500327 AACACATTATTTTTAGAGACAGG - Intergenic
1145237739 17:21220973-21220995 TTCACTTTATTTTTTGAGACAGG - Intergenic
1145443983 17:23147161-23147183 CACAAAGTAGTTTCTGAGAAGGG - Intergenic
1145645083 17:26070217-26070239 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1145859921 17:28201083-28201105 CACACTTTGTTTTTTTAGACAGG + Intergenic
1147273029 17:39290568-39290590 CACAAACTTTTTTTTGAGACAGG + Intronic
1147695966 17:42353578-42353600 CAGACTTTATTTTTTGAGACAGG + Intronic
1150607863 17:66709637-66709659 CTCACATTAGTACTTGAGAAAGG + Intronic
1152541007 17:80975443-80975465 TTCACATTCTTTTTTGAGACAGG - Intergenic
1153195141 18:2586722-2586744 AACACTTTTTTTTTTGAGACAGG - Intronic
1153225970 18:2900191-2900213 TACTCATTTATTTTTGAGACAGG + Intronic
1153247279 18:3084733-3084755 CTCACAGAAGTTTTTGAGCCTGG + Intronic
1153439534 18:5101289-5101311 CTCACATTTGATTCTGAGACAGG - Intergenic
1155000431 18:21680897-21680919 CACACATATATATTTGAGACAGG + Intronic
1155267492 18:24107761-24107783 CAAACTTTTGTTTTTGAGACAGG + Intronic
1155752888 18:29451769-29451791 AACACATTATCTTTTCAGACTGG - Intergenic
1156087850 18:33429612-33429634 TACACATTCGTCTTTGAGAAAGG + Intronic
1156177263 18:34560914-34560936 CAAATTTTATTTTTTGAGACAGG - Intronic
1156214863 18:34987646-34987668 AAAATATTATTTTTTGAGACAGG + Intronic
1156719699 18:40054971-40054993 CTCACAGTAATTTTTAAGACAGG - Intergenic
1157434728 18:47658722-47658744 TGTACTTTAGTTTTTGAGACAGG - Intergenic
1157665226 18:49480310-49480332 AACATTTTATTTTTTGAGACAGG - Intronic
1158593566 18:58797398-58797420 CACCTTTTTGTTTTTGAGACAGG - Intergenic
1158808550 18:61004069-61004091 CATACATAAGTTTATGAGAATGG - Intergenic
1158869802 18:61675011-61675033 CACAGATTAGTTTTTGAACAAGG - Intergenic
1158903763 18:61991074-61991096 CACAAATTAGTAGCTGAGACTGG - Intergenic
1158984933 18:62804409-62804431 CCCAAATTAGTTTTTGAAAAAGG - Intronic
1160459133 18:79024408-79024430 TACAGTTTTGTTTTTGAGACAGG - Intergenic
1160936156 19:1596153-1596175 CACAATTTCTTTTTTGAGACAGG + Intergenic
1161223381 19:3130055-3130077 CAGAAAGTAGCTTTTGAGACTGG - Intergenic
1161670232 19:5603249-5603271 AACATTTTACTTTTTGAGACGGG - Intronic
1161810925 19:6470958-6470980 AACAAAGTGGTTTTTGAGACAGG + Intronic
1161846656 19:6715169-6715191 AATACATTATTTTTTGAGATGGG - Intronic
1161846794 19:6716222-6716244 CCCCAATTATTTTTTGAGACAGG + Intronic
1161896427 19:7085178-7085200 TACAATTTATTTTTTGAGACAGG + Intronic
1162157317 19:8687352-8687374 TACATATTTTTTTTTGAGACAGG - Intergenic
1162542001 19:11302722-11302744 CACATATATATTTTTGAGACAGG + Intronic
1162765445 19:12916610-12916632 CACTTATTTATTTTTGAGACAGG + Intronic
1162899201 19:13784479-13784501 GACACTTTTGTTTTTGAGATGGG - Intergenic
1163041348 19:14605099-14605121 CACATTTTTTTTTTTGAGACGGG + Intronic
1163107720 19:15135604-15135626 TACAGATTTTTTTTTGAGACAGG - Intergenic
1163278198 19:16299064-16299086 CACTTTTTATTTTTTGAGACAGG - Intergenic
1164342837 19:24425783-24425805 CACAAATAAGTTTCTGAGAATGG - Intergenic
1164731297 19:30506802-30506824 CACACATTAGTTTTATAATCAGG - Intronic
1165036096 19:33034925-33034947 AACATATTTGTTTTAGAGACAGG - Intronic
1165429073 19:35761853-35761875 CACATAACTGTTTTTGAGACAGG - Intronic
1165459290 19:35935129-35935151 CATACTTTTTTTTTTGAGACAGG - Intergenic
1165470906 19:36004016-36004038 GACACATTATTTTTTGAGACAGG + Intronic
1165980828 19:39721243-39721265 TACAGATTTATTTTTGAGACAGG - Intergenic
1166889618 19:45982561-45982583 CGCACACTTTTTTTTGAGACAGG - Intergenic
1167555391 19:50191832-50191854 CAAATATTTTTTTTTGAGACAGG - Intronic
925637775 2:5958659-5958681 CATTCATTGGTTTTTGAAACTGG + Intergenic
926182749 2:10660320-10660342 CACATATTTTTTTTGGAGACAGG + Intronic
926717582 2:15937285-15937307 CTCACATTAGGTCCTGAGACAGG + Intergenic
927008029 2:18871061-18871083 TAAACAGTTGTTTTTGAGACAGG - Intergenic
927129501 2:20046490-20046512 CACACATTTTATTTTGAGACAGG + Intronic
927595288 2:24391436-24391458 CACACTTTTTTTTTTGAGACAGG + Intergenic
928033646 2:27801841-27801863 CGCACTTTTGTTTTTGACACAGG + Intronic
928165939 2:28972092-28972114 CACATTTTATTTTTTGAGACAGG + Intronic
928887681 2:36168882-36168904 CAAACTTTTTTTTTTGAGACAGG - Intergenic
928893052 2:36228042-36228064 CCCACCTTTTTTTTTGAGACAGG - Intergenic
929031130 2:37650749-37650771 CACACATTTGTGTTTTAAACAGG - Intronic
931314440 2:61114660-61114682 CATACATATATTTTTGAGACAGG + Intronic
931395081 2:61880709-61880731 CAAACTTTTTTTTTTGAGACAGG + Intronic
933479079 2:82832168-82832190 CACACATTGGTTTCAGAGGCTGG - Intergenic
933612146 2:84447734-84447756 TAAACATTTTTTTTTGAGACAGG + Intronic
933989297 2:87622253-87622275 AACACATTTGTTCTTGAGTCAGG - Intergenic
934153036 2:89167738-89167760 GCCACATTAGTTTCTGAGATGGG - Intergenic
934214204 2:90014193-90014215 GCCACATTAGTTTCTGAGATGGG + Intergenic
936304546 2:111328573-111328595 AACACATTTGTTCTTGAGTCAGG + Intergenic
936718886 2:115224879-115224901 CTCTCAATAGCTTTTGAGACAGG + Intronic
936887534 2:117330952-117330974 TATACATTTTTTTTTGAGACAGG + Intergenic
937010568 2:118559280-118559302 AACAGTTTAGTTTTTGAGAAGGG + Intergenic
937645543 2:124262237-124262259 CATTTATTATTTTTTGAGACAGG - Intronic
940338496 2:152554399-152554421 CACAAAGGATTTTTTGAGACAGG - Intronic
940673207 2:156696278-156696300 AACACAGTAGTGTTTGATACAGG + Intergenic
942309247 2:174639259-174639281 CTCACTTTTATTTTTGAGACAGG + Intronic
943729426 2:191286150-191286172 CACAAATATGTTTCTGAGACTGG + Intronic
943841357 2:192585989-192586011 CACATTTTTTTTTTTGAGACAGG - Intergenic
944824939 2:203473278-203473300 GATACTTTATTTTTTGAGACAGG - Intronic
946377561 2:219322004-219322026 CCCACATTTTTTTTTGAGGCAGG + Intergenic
946849114 2:223888085-223888107 TACACTTTTTTTTTTGAGACAGG + Intronic
946956441 2:224935076-224935098 CAAGCATTTGTTTTTGTGACAGG - Intronic
947265701 2:228277595-228277617 CATTCATTTATTTTTGAGACAGG - Intergenic
1168918619 20:1512400-1512422 CACACACACGTTTTTGAGACAGG + Intergenic
1170083922 20:12508281-12508303 CAAACATCAGTCTTGGAGACGGG - Intergenic
1170973360 20:21137780-21137802 CACAATTTGCTTTTTGAGACAGG + Intronic
1171219536 20:23382357-23382379 TGCACATTAGGTTATGAGACTGG - Intronic
1171575355 20:26305902-26305924 CACAAAGAAGTTTTTGAGAATGG - Intergenic
1171576942 20:26339098-26339120 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1172145793 20:32757048-32757070 CACATTTTTTTTTTTGAGACAGG - Intergenic
1172259228 20:33547673-33547695 CACACACATTTTTTTGAGACAGG - Intronic
1172284285 20:33730310-33730332 CACACATTGATTATTGAGAAAGG + Intergenic
1172717364 20:36974895-36974917 CTTTTATTAGTTTTTGAGACAGG - Intergenic
1173022172 20:39275907-39275929 AACACATTAATTTTCGAGTCTGG - Intergenic
1173829993 20:46076919-46076941 CTCATTTTATTTTTTGAGACAGG + Intronic
1174010752 20:47447676-47447698 CATTCATTCGTTTTTGAGACAGG - Intergenic
1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG + Intergenic
1174540160 20:51282914-51282936 CATTCATTCATTTTTGAGACAGG - Intergenic
1174718429 20:52785042-52785064 CACAAATAAGTGTTTGAGCCAGG - Intergenic
1175587416 20:60153379-60153401 CATACATTGATTTTTGAGAAAGG - Intergenic
1175848717 20:62074893-62074915 GAAACATTTTTTTTTGAGACAGG + Intergenic
1176959429 21:15142602-15142624 CAAACATTCATTCTTGAGACTGG - Intergenic
1177452990 21:21296259-21296281 CACAGACTATTTTTTGAGAATGG + Intronic
1177555956 21:22689128-22689150 CACATTTTTTTTTTTGAGACAGG + Intergenic
1177665507 21:24151833-24151855 TATACAATTGTTTTTGAGACAGG - Intergenic
1178281497 21:31286705-31286727 CACACACAATTTGTTGAGACAGG - Intronic
1178339287 21:31772367-31772389 TAAACTTTAATTTTTGAGACAGG + Intergenic
1178636558 21:34308764-34308786 CACAGATTTTTTTTTGAGACAGG + Intergenic
1179017150 21:37603887-37603909 AAAACAATGGTTTTTGAGACTGG + Intergenic
1179446812 21:41437632-41437654 AATACATGTGTTTTTGAGACAGG - Intronic
1180285385 22:10741182-10741204 CACACAATAGTCTTTCATACTGG - Intergenic
1180624826 22:17187322-17187344 AACACTTTTTTTTTTGAGACAGG + Intronic
1181590330 22:23880442-23880464 CTCACAATTATTTTTGAGACAGG + Intronic
1182721604 22:32406327-32406349 CACACATTTTTTTTTGAGATGGG + Intronic
1182773288 22:32811522-32811544 AACACATTAGATTTGGAGGCGGG - Intronic
1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG + Intergenic
1183469003 22:37995994-37996016 CGCTCTTTATTTTTTGAGACAGG - Intronic
1183628085 22:39016895-39016917 CACACATGAGTCTATGAGACAGG + Intronic
1183789465 22:40054208-40054230 GACAGTTTTGTTTTTGAGACAGG - Intronic
949310092 3:2687634-2687656 TAGATATTATTTTTTGAGACAGG - Intronic
954218727 3:49139299-49139321 CAGACATTTTTTTTTGAGACGGG - Intergenic
954771429 3:52973209-52973231 TACTTATTAATTTTTGAGACAGG - Intronic
955192913 3:56778536-56778558 CACAAAATATTCTTTGAGACAGG + Intronic
955278245 3:57568447-57568469 CAAACTTTTTTTTTTGAGACAGG - Intergenic
955664186 3:61332783-61332805 CACACATTAGATTTGAATACTGG + Intergenic
957169820 3:76723952-76723974 CACACATTAAAGTTTGAGAATGG + Intronic
958208731 3:90439024-90439046 CACAAAGTAGTTTCTGAGAATGG + Intergenic
958209472 3:90451936-90451958 CACAAATTACTTTCTGAGAACGG + Intergenic
958272566 3:91522712-91522734 CACAAAGTAGTTTCTGAGAATGG + Intergenic
958273371 3:91538599-91538621 CACAAAGTAGTTTCTGAGAATGG + Intergenic
958273444 3:91540134-91540156 CACACAGTAGTTTCTCAGAATGG + Intergenic
958407433 3:93766794-93766816 CACAAAGTAGTTTCTGAGAATGG + Intergenic
964483587 3:157164775-157164797 CACACACCTTTTTTTGAGACAGG + Intergenic
965622967 3:170658983-170659005 CATTTATTATTTTTTGAGACAGG + Intronic
966098951 3:176242859-176242881 TACACACTTTTTTTTGAGACAGG + Intergenic
966530418 3:180972446-180972468 AAAACATTTTTTTTTGAGACAGG - Intronic
966689232 3:182726181-182726203 CTCACATGAGTCTTTAAGACCGG + Intergenic
968745683 4:2358805-2358827 CCCACTTTTTTTTTTGAGACAGG + Intronic
969143715 4:5102020-5102042 CACACTTTATTGTTTGAGCCAGG - Intronic
971005200 4:22365582-22365604 CACATATTATTTTTTGAGACAGG - Intronic
973491551 4:51150022-51150044 CACAAACAAGTTTCTGAGACGGG - Intergenic
973803823 4:54504635-54504657 CACAAATTGGTTTTTGACAAAGG + Intergenic
975112128 4:70639881-70639903 GACATCTTAGTTTTTGAGACAGG - Intronic
975328419 4:73086286-73086308 CATACATTCGTTTTTGAAATAGG - Intronic
976786770 4:88830243-88830265 CATACATTAGTTTTTTAAAGAGG - Intronic
978389816 4:108213672-108213694 CTCACAGTAGTTTATGGGACAGG - Intergenic
978710854 4:111779081-111779103 CACTCATTTCTTTTTTAGACAGG - Intergenic
978752219 4:112262299-112262321 CATACTTTTCTTTTTGAGACAGG - Intronic
979293961 4:119009827-119009849 TACACACTAGTGTTTGAGACTGG - Intronic
979812125 4:125049405-125049427 CACACATGATATTTTGATACAGG - Intergenic
980119711 4:128715212-128715234 CACACACTTTTTTTTGAGACAGG + Intergenic
980434509 4:132751007-132751029 CACACTTTTGGTTTTCAGACTGG - Intergenic
981429281 4:144641680-144641702 CAAAATTTACTTTTTGAGACAGG + Intergenic
981470816 4:145132429-145132451 TAAACATCAGTTTTTGAAACTGG - Intronic
981783936 4:148456587-148456609 CACTGATTATTGTTTGAGACTGG - Intergenic
981811751 4:148783588-148783610 CACACACAATTTTTAGAGACGGG + Intergenic
983194466 4:164791336-164791358 CATTTTTTAGTTTTTGAGACAGG + Intergenic
983702347 4:170613640-170613662 CAAACATTAGTTTGGGAGAGAGG - Intergenic
983848723 4:172552680-172552702 CACACGTAAGTTTTTAAGAAGGG - Intronic
984116366 4:175685946-175685968 CACACATTTGTTTTTGTTTCAGG + Intronic
984782037 4:183534656-183534678 CATTTATTATTTTTTGAGACAGG + Intergenic
985852619 5:2399804-2399826 CACACATGTGTTTTTGAGTGTGG - Intergenic
985898887 5:2770681-2770703 TATATATTTGTTTTTGAGACAGG - Intergenic
986032556 5:3907966-3907988 CACACATGAGAATTGGAGACAGG + Intergenic
986186405 5:5445437-5445459 CATATTTTATTTTTTGAGACAGG + Intronic
987107527 5:14655097-14655119 CACATAATTTTTTTTGAGACAGG - Intergenic
988571464 5:32371362-32371384 CTATCATTTGTTTTTGAGACAGG - Intronic
988904761 5:35775251-35775273 ATCACATTTTTTTTTGAGACAGG - Intronic
989528838 5:42483072-42483094 CTCTCTTTATTTTTTGAGACAGG + Intronic
989844483 5:46123776-46123798 CACAAATCAGTTTTTTAGAAAGG + Intergenic
990111562 5:52331694-52331716 CATACATTACTTTTTCAGTCAGG - Intergenic
990209617 5:53468513-53468535 TTCACTTTATTTTTTGAGACAGG - Intergenic
991053832 5:62301097-62301119 CACACATATTTTTTTGAGACAGG - Intergenic
992063204 5:73077842-73077864 AAAACATTTTTTTTTGAGACAGG - Intronic
992136298 5:73749493-73749515 CAAAAATTATTTTTAGAGACAGG - Intronic
992739546 5:79759473-79759495 CACACATTAATTTGGGACACAGG - Intronic
992926001 5:81587968-81587990 TAAATATTATTTTTTGAGACAGG + Intronic
993602171 5:89940679-89940701 CTCAAATTAGTATCTGAGACCGG + Intergenic
994129083 5:96204115-96204137 CAGTCATTGGTTGTTGAGACTGG - Intergenic
994539675 5:101078156-101078178 AATACATTATTTTTTGAGACAGG - Intergenic
995311168 5:110713488-110713510 CACATATTATATTTTGATACAGG - Intronic
995805004 5:116041832-116041854 AACAAATTTTTTTTTGAGACAGG + Intronic
997549798 5:134741938-134741960 CATACATATATTTTTGAGACGGG - Intronic
998480207 5:142456832-142456854 CCTACATTGTTTTTTGAGACAGG - Intergenic
999183137 5:149684285-149684307 AACACATAACCTTTTGAGACTGG + Intergenic
999503584 5:152171274-152171296 CACACATTTTTTTTTTAGAAAGG - Intergenic
1000429871 5:161138490-161138512 CTCACATTAGTTTATGAGCATGG + Intergenic
1003009860 6:2416542-2416564 CTTTCATTCGTTTTTGAGACAGG + Intergenic
1003502248 6:6712311-6712333 CACACATTACTGTTGAAGACTGG + Intergenic
1005455454 6:26015714-26015736 AACACGTTATCTTTTGAGACTGG - Intergenic
1006742388 6:36318715-36318737 CACTGATTTTTTTTTGAGACAGG - Intronic
1008509793 6:52265440-52265462 CTCACTTTTTTTTTTGAGACCGG - Intronic
1009054154 6:58315632-58315654 CACTCATTATTTTATGACACTGG + Intergenic
1009069683 6:58614519-58614541 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009086520 6:58849323-58849345 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009099018 6:59023486-59023508 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009103642 6:59087665-59087687 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009106898 6:59133007-59133029 CACAAAGTCGTTTCTGAGACTGG - Intergenic
1009119620 6:59310036-59310058 CACAAATTCGTTTCTGAGATTGG - Intergenic
1009141566 6:59615262-59615284 CACAAATTCGTTTCTGAGATTGG - Intergenic
1009236973 6:61134931-61134953 CACTCATTATTTTGTGACACTGG - Intergenic
1009255873 6:61397246-61397268 CACAAAATAGTTTCTGAGAATGG - Intergenic
1009256524 6:61411169-61411191 CACATAGTAGTTTCTGAGAAAGG - Intergenic
1009976823 6:70680169-70680191 CTCAAATTAGTTTTTGTGAATGG - Intronic
1010370364 6:75100151-75100173 CACAGATTAGAATTTGAGAATGG + Intronic
1013516044 6:110886765-110886787 CAGATATTATTTTTTGAGACAGG - Intronic
1015280867 6:131432821-131432843 CATGCATTTGCTTTTGAGACTGG - Intergenic
1015946970 6:138512904-138512926 AACACATTAGTTGTGGAGAAGGG - Intronic
1018153011 6:160957604-160957626 CACACATTATTTTTAGTGACTGG + Intergenic
1018153493 6:160963059-160963081 CCCACATTAGGTCTAGAGACAGG - Intergenic
1019222728 6:170487029-170487051 TATTCATTTGTTTTTGAGACAGG - Intergenic
1021553520 7:21897067-21897089 TATACTTTATTTTTTGAGACAGG - Intronic
1021668509 7:23012865-23012887 CACACAGTAGTTTTTGGAGCAGG - Intronic
1021704332 7:23351775-23351797 CACACATTTTCCTTTGAGACAGG + Intronic
1024106250 7:46089916-46089938 CACACATTATTTTTTCACCCAGG + Intergenic
1025323352 7:58174250-58174272 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025331936 7:58326590-58326612 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025336719 7:58410978-58411000 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025342532 7:58514200-58514222 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025342591 7:58515222-58515244 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025343226 7:58526467-58526489 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025348194 7:58614353-58614375 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025349131 7:58631044-58631066 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025351003 7:58664431-58664453 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025360520 7:58832834-58832856 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025363103 7:58878492-58878514 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025380951 7:59194981-59195003 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025384302 7:59254592-59254614 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025384361 7:59255614-59255636 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025387967 7:59319649-59319671 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025388370 7:59326803-59326825 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025395628 7:59455906-59455928 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025403121 7:59588274-59588296 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025411029 7:59728289-59728311 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025427337 7:60018234-60018256 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025428938 7:60046834-60046856 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025429905 7:60063868-60063890 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025433593 7:60129615-60129637 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025436351 7:60178671-60178693 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025436625 7:60183442-60183464 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025443920 7:60312917-60312939 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025444904 7:60330292-60330314 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025468864 7:60757202-60757224 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025472074 7:60814440-60814462 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025473290 7:60886932-60886954 CACAAAGAAGTTTCTGAGACTGG + Intergenic
1025513715 7:61602934-61602956 CACAAAGAAGTTTCTGAGACTGG - Intergenic
1025538061 7:62031773-62031795 CACAAAGAAGTTTCTGAGACTGG - Intergenic
1025568328 7:62519175-62519197 CACAAAGTAGTTTCTGAGAATGG - Intergenic
1025581625 7:62726574-62726596 CACAGAGTAGTTTTTCAGAAAGG - Intergenic
1025590200 7:62849615-62849637 CACACAGTAGTTTTTCAGACAGG - Intergenic
1025851568 7:65248912-65248934 CACCCATTTTTTTTTGAGACAGG + Intergenic
1026468725 7:70676424-70676446 CTCTCTTTATTTTTTGAGACAGG - Intronic
1028249897 7:88528091-88528113 CACACAATATTCTTTGAGATGGG - Intergenic
1028491933 7:91422450-91422472 AACTTATTAATTTTTGAGACAGG + Intergenic
1029167578 7:98604345-98604367 AACAATTTTGTTTTTGAGACAGG + Intergenic
1029462600 7:100705160-100705182 CATGCATTTATTTTTGAGACAGG - Intergenic
1029729099 7:102427636-102427658 GATATATTTGTTTTTGAGACAGG - Intergenic
1030042125 7:105460871-105460893 AAAAAATTTGTTTTTGAGACAGG + Intronic
1030611106 7:111690298-111690320 AACAAATTATTTTTTGAGACAGG + Intergenic
1030713394 7:112780716-112780738 CTGACTTTTGTTTTTGAGACAGG - Intronic
1031047928 7:116914466-116914488 CACACGTATTTTTTTGAGACAGG + Intronic
1031733036 7:125321235-125321257 AACTCTTTTGTTTTTGAGACAGG - Intergenic
1032224038 7:130016435-130016457 TACATATTTATTTTTGAGACAGG + Intergenic
1032645185 7:133816104-133816126 CACACATCAGTTATTTACACAGG + Intronic
1033009100 7:137600242-137600264 CACTTATTATTTTTTGAGACAGG - Intronic
1033021020 7:137724311-137724333 CCAACATAAGTTTTTGAGCCAGG + Intronic
1033736213 7:144224657-144224679 CACATTTTATTTTTTGAGGCCGG + Intergenic
1034063419 7:148113901-148113923 CAGAAATTAGTGTCTGAGACTGG - Intronic
1034287147 7:149893490-149893512 CTCACAATAGCTTATGAGACAGG + Intergenic
1034481566 7:151324196-151324218 TTCACATTTTTTTTTGAGACAGG + Intergenic
1034552035 7:151827242-151827264 CATTCATTTATTTTTGAGACAGG + Intronic
1034646887 7:152655705-152655727 CAAACTTTTCTTTTTGAGACAGG - Intronic
1034663978 7:152799426-152799448 CTCACAATAGCTTATGAGACAGG - Intronic
1034820829 7:154214910-154214932 CACATATTTTGTTTTGAGACTGG - Intronic
1037850307 8:22322256-22322278 CCCACCTTTTTTTTTGAGACAGG + Intronic
1038273456 8:26096935-26096957 AACACTTTTTTTTTTGAGACAGG - Intergenic
1038768985 8:30458717-30458739 CAGACACTGTTTTTTGAGACGGG + Intronic
1040141429 8:43921102-43921124 CACAACGTAGTTTTTGAGAATGG - Intergenic
1040142679 8:43943034-43943056 CACAAACTAGTTTCTGAGAAAGG - Intergenic
1040271343 8:45949234-45949256 CACAAACTAGTTTCTGAGAAAGG - Intergenic
1041061226 8:54036499-54036521 CACATTTTGGTTTTTGAGACAGG - Intergenic
1041915068 8:63130702-63130724 CACACACACATTTTTGAGACAGG - Intergenic
1042260853 8:66857775-66857797 CACACACACTTTTTTGAGACAGG - Intronic
1042393490 8:68263700-68263722 CACAGCTTTTTTTTTGAGACAGG - Intergenic
1044677455 8:94743628-94743650 CATTCATTTATTTTTGAGACAGG - Intronic
1044949277 8:97419512-97419534 CACAAATTAGTTTTCAAGGCAGG - Intergenic
1046791194 8:118323820-118323842 TACAGATTTTTTTTTGAGACAGG - Intronic
1047178692 8:122566810-122566832 CACAAATTATTTTAAGAGACTGG - Intergenic
1047239020 8:123068705-123068727 CACAATTTTTTTTTTGAGACAGG - Intronic
1047701652 8:127455141-127455163 CTCCCTTTATTTTTTGAGACAGG - Intergenic
1048429430 8:134355781-134355803 CATACATTACTTTTTGTGTCAGG - Intergenic
1048684768 8:136892030-136892052 TAAAAATTAGTTTTTGAGGCTGG - Intergenic
1049067077 8:140324762-140324784 CACTTATTTATTTTTGAGACAGG - Intronic
1049770632 8:144379267-144379289 CACACATTAGGTTTAGAGTTAGG + Intronic
1050466899 9:5936347-5936369 CATTTATTTGTTTTTGAGACAGG - Intronic
1050682306 9:8126282-8126304 AACAGATTAGGTTTTGAGATGGG + Intergenic
1051505924 9:17827794-17827816 GACACTTTTTTTTTTGAGACAGG + Intergenic
1052908833 9:33861584-33861606 CAAACTTTTTTTTTTGAGACAGG - Intronic
1052957594 9:34265896-34265918 GACAGTTTATTTTTTGAGACAGG + Intronic
1053937214 9:43172671-43172693 CACAAAGTAGTTTCTCAGACTGG - Intergenic
1054741370 9:68809463-68809485 CACACATTTGTTTTTTATTCTGG + Intronic
1055309170 9:74960549-74960571 CACTTTTTATTTTTTGAGACAGG - Intergenic
1055599355 9:77899391-77899413 CACACATTAGTGAATGAGACCGG - Intronic
1057770866 9:97966860-97966882 CACACATGGGTTATTGACACAGG + Intergenic
1058433251 9:104938083-104938105 TATACTTTATTTTTTGAGACAGG + Intergenic
1058575967 9:106401632-106401654 CAAACCTTAGTTTTTGGAACAGG - Intergenic
1058942239 9:109823892-109823914 CACACTTTATTTTTTTAGACAGG + Intronic
1061192709 9:129091106-129091128 CATATATTTGTTTTTGAGATGGG - Intergenic
1061600012 9:131662384-131662406 AACATTTTATTTTTTGAGACAGG + Intronic
1062305671 9:135905877-135905899 TTCACATGAGTTTTTGAGAACGG - Intronic
1203731741 Un_GL000216v2:98237-98259 CACACAATAGTCTTTCATACTGG - Intergenic
1203406510 Un_KI270538v1:22949-22971 CACAAATCAGTTTATGAGAATGG - Intergenic
1186071354 X:5824805-5824827 CACACTGTAGTTTTTGAGTGTGG + Intergenic
1186239823 X:7554354-7554376 CACATATTATTTTCTGAGACAGG + Intergenic
1187052536 X:15708883-15708905 AAAACATTTTTTTTTGAGACAGG - Intronic
1187567612 X:20467482-20467504 CAAAAATTAATTTTTGAAACTGG - Intergenic
1187879954 X:23837663-23837685 TATATATTTGTTTTTGAGACAGG + Intronic
1187959171 X:24551793-24551815 CATTCATTCATTTTTGAGACAGG - Intergenic
1188317074 X:28688195-28688217 CACATTTTTTTTTTTGAGACAGG + Intronic
1188632344 X:32380366-32380388 CACAGATTAATTTTTAAGAAAGG + Intronic
1188767373 X:34111510-34111532 TACATATTATTTTTTGACACAGG + Intergenic
1189957947 X:46295272-46295294 TACATATATGTTTTTGAGACAGG - Intergenic
1190034540 X:47009325-47009347 ATCACATTTCTTTTTGAGACAGG - Intronic
1190211169 X:48449275-48449297 CATACAATTTTTTTTGAGACAGG + Intergenic
1190259747 X:48790441-48790463 CACACACTTTTTTTTGAGGCAGG - Intronic
1190828063 X:54035795-54035817 CATTCATTTATTTTTGAGACAGG - Intronic
1192884467 X:75322215-75322237 ACCACATTTTTTTTTGAGACAGG + Intergenic
1195039710 X:101002913-101002935 CAATCATTTGTTTTTGAGACAGG + Intergenic
1195675767 X:107506383-107506405 CACAAGGTAGCTTTTGAGACAGG + Intergenic
1197106577 X:122723761-122723783 AACATTTTTGTTTTTGAGACAGG + Intergenic
1197829621 X:130627573-130627595 CAAACTTTTTTTTTTGAGACAGG - Intronic
1198222824 X:134618409-134618431 CTCACTTTTTTTTTTGAGACAGG + Intronic
1198301143 X:135335102-135335124 CACACATTCTTTTCTCAGACTGG - Intronic
1199830479 X:151544733-151544755 AACACCTCTGTTTTTGAGACAGG - Intergenic
1200269109 X:154664767-154664789 CACACACATTTTTTTGAGACAGG + Intergenic
1200414163 Y:2890539-2890561 GACTTATTATTTTTTGAGACAGG - Intronic
1200913141 Y:8548635-8548657 CACACATTTTCTTTTGAGAATGG + Intergenic