ID: 1092366502

View in Genome Browser
Species Human (GRCh38)
Location 12:7881249-7881271
Sequence CAGCTCCCTCAGCTTGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 3, 1: 5, 2: 9, 3: 34, 4: 221}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092366492_1092366502 6 Left 1092366492 12:7881220-7881242 CCCCTTCCTGGGCTGGCCTAGGC 0: 3
1: 57
2: 1025
3: 666
4: 623
Right 1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG 0: 3
1: 5
2: 9
3: 34
4: 221
1092366487_1092366502 24 Left 1092366487 12:7881202-7881224 CCTGCTGCACTATGGGAGCCCCT 0: 1
1: 20
2: 147
3: 45
4: 177
Right 1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG 0: 3
1: 5
2: 9
3: 34
4: 221
1092366493_1092366502 5 Left 1092366493 12:7881221-7881243 CCCTTCCTGGGCTGGCCTAGGCC 0: 2
1: 46
2: 782
3: 851
4: 795
Right 1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG 0: 3
1: 5
2: 9
3: 34
4: 221
1092366484_1092366502 27 Left 1092366484 12:7881199-7881221 CCCCCTGCTGCACTATGGGAGCC 0: 1
1: 10
2: 225
3: 994
4: 881
Right 1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG 0: 3
1: 5
2: 9
3: 34
4: 221
1092366486_1092366502 25 Left 1092366486 12:7881201-7881223 CCCTGCTGCACTATGGGAGCCCC 0: 1
1: 8
2: 24
3: 147
4: 184
Right 1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG 0: 3
1: 5
2: 9
3: 34
4: 221
1092366497_1092366502 -10 Left 1092366497 12:7881236-7881258 CCTAGGCCGGAGCCAGCTCCCTC 0: 71
1: 489
2: 823
3: 618
4: 443
Right 1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG 0: 3
1: 5
2: 9
3: 34
4: 221
1092366485_1092366502 26 Left 1092366485 12:7881200-7881222 CCCCTGCTGCACTATGGGAGCCC 0: 4
1: 158
2: 784
3: 751
4: 445
Right 1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG 0: 3
1: 5
2: 9
3: 34
4: 221
1092366496_1092366502 0 Left 1092366496 12:7881226-7881248 CCTGGGCTGGCCTAGGCCGGAGC 0: 2
1: 34
2: 59
3: 90
4: 264
Right 1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG 0: 3
1: 5
2: 9
3: 34
4: 221
1092366494_1092366502 4 Left 1092366494 12:7881222-7881244 CCTTCCTGGGCTGGCCTAGGCCG 0: 2
1: 35
2: 491
3: 890
4: 676
Right 1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG 0: 3
1: 5
2: 9
3: 34
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092366502 Original CRISPR CAGCTCCCTCAGCTTGCGGG AGG Intronic
900293738 1:1937770-1937792 CACCTCCCTGAGCCTGAGGGCGG - Intronic
900958191 1:5901364-5901386 CAGCAGCCGCAGCTTGTGGGAGG - Intronic
901110037 1:6786149-6786171 CACCTCCCTGAGCGGGCGGGGGG + Intronic
901187729 1:7385979-7386001 CAGCACCCTTAGCATGGGGGAGG - Intronic
902702744 1:18183782-18183804 CAGCTCCCTCGGGTGGCGGGTGG + Intronic
902788096 1:18745890-18745912 CAGATCCCTCTGTTTGTGGGAGG + Intronic
903646201 1:24897691-24897713 CAGCCCCCACAGCTTGAGGTTGG - Intergenic
903659782 1:24969970-24969992 AAGGTCCCCCAGCTTGCTGGTGG + Intergenic
904330601 1:29755728-29755750 CCCCTCCCTCAGCCTGAGGGAGG - Intergenic
904814719 1:33187116-33187138 CAGCTCCCTCACCCTTTGGGTGG - Intergenic
909782929 1:79570342-79570364 CAGCTCCCTCACCCTTCTGGTGG - Intergenic
911530515 1:99037923-99037945 CAGTTCCCTCATGTTGTGGGAGG - Intergenic
912511582 1:110193621-110193643 CAGCTCCCTCAGCATTAGGATGG - Intronic
914044980 1:144083867-144083889 CAGCTCCCTCACCTCTCAGGTGG - Intergenic
914133130 1:144876819-144876841 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
915527851 1:156487184-156487206 CAGCTCCCCCAGCATGAGGCGGG - Intronic
922347253 1:224706600-224706622 CAGCTCCTTCAGCATTTGGGAGG + Intronic
922799937 1:228360539-228360561 CACCTCCTTCCTCTTGCGGGAGG + Intronic
923755388 1:236786509-236786531 CAGCTTCCTCAGCTGGCACGAGG - Intergenic
1065554860 10:26905515-26905537 TGGCTCCCTCTGCTTGCGGGAGG + Intergenic
1066957107 10:42183549-42183571 CAGCTCCCTCACCTCTCAGGTGG - Intergenic
1069600995 10:69708042-69708064 CAGCTCCTCCAACTTGCAGGTGG + Intergenic
1070436037 10:76394591-76394613 CAGCTCACTCAGCTTTCTGGAGG + Intronic
1070839745 10:79475853-79475875 GAGCTCCCTCAGGTTGAGGTTGG - Intergenic
1072949008 10:99836107-99836129 CAGACGCCTCAGCTGGCGGGAGG - Exonic
1073141241 10:101249335-101249357 CAGCTCCCTGAGCCAGCCGGGGG + Intergenic
1074993382 10:118732495-118732517 GAGCTTGCTCTGCTTGCGGGAGG + Intronic
1075088227 10:119428324-119428346 CTGCTCCCTGAGCTTGTGTGAGG + Intronic
1075400632 10:122159090-122159112 CAGCTCCCCCAGCTCCCTGGAGG - Intronic
1075922766 10:126226555-126226577 AAGGTCCCTCAGCTGGCCGGAGG - Intronic
1077539330 11:3139243-3139265 CCGCTCACTCAGCTGGCCGGTGG - Intronic
1078141919 11:8699225-8699247 CAGCTCCTTCAGTTTGGGGAGGG + Exonic
1079186221 11:18239793-18239815 GAGCTCCCTCAGCATGTGGATGG - Intronic
1080106068 11:28512723-28512745 TGGCTCCCTCAGCTTGCAGGGGG - Intergenic
1081675701 11:44967821-44967843 CAGCTCCTGCAGCTTGCCAGAGG + Intergenic
1083003595 11:59320721-59320743 CAGGTCCCTCAGCCTGTTGGAGG + Intergenic
1083545275 11:63544912-63544934 CATCTCCCTCTGCTTGGGGCTGG + Intronic
1083624518 11:64065300-64065322 CAGCTGCCTCAACATGCAGGAGG + Intronic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1084962634 11:72725337-72725359 CAACCCCATCAGCTTGTGGGGGG - Intronic
1084964913 11:72739441-72739463 GAGCTGCCTCAGCTTGCTGGTGG + Intronic
1085263813 11:75224559-75224581 CAGCTCCCTCTGCTTCCCTGTGG - Intergenic
1088527905 11:110776375-110776397 CAGCTCCCTCAGCCTCCAGTAGG - Intergenic
1090131027 11:124142184-124142206 CAGCTCACACAGCTTGCCTGCGG + Intronic
1090335060 11:125956522-125956544 CAGCTCCCCCAGCCTGGGGGCGG - Exonic
1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG + Intronic
1094108742 12:26839147-26839169 CAGCTCCCTCTGCTTGCTGTGGG + Intergenic
1094791904 12:33925146-33925168 CGGCTCCCTCAGCTTCCAAGAGG - Intergenic
1096848217 12:54419311-54419333 CAGCCCCCTCGGCAGGCGGGGGG - Exonic
1096864041 12:54550627-54550649 CACCTCCTTCAGCTTCCAGGTGG - Intronic
1097149743 12:56967934-56967956 CATCTCCCACAGCTTGGAGGGGG + Intergenic
1098002680 12:65961644-65961666 CAGCTCGCTCAGTCTTCGGGGGG + Intronic
1098434458 12:70453806-70453828 TTCCTCCCTCAGCTTGCTGGTGG - Intergenic
1104691018 12:130826454-130826476 CAGCGCCCTCTGCTGGTGGGCGG - Intronic
1105441849 13:20421686-20421708 CAGCTCCCTCAGTTTGAAGTTGG - Intronic
1107946082 13:45418565-45418587 CAGCTCCCTCAGGCAGCGGCAGG - Intergenic
1110790580 13:79582386-79582408 CACCTCCCTCCGCTGGGGGGTGG + Intergenic
1110913977 13:80998819-80998841 CGGCTCCCTCAGCTTGCGGGAGG - Intergenic
1111232557 13:85363119-85363141 CGGCTCCCTCTGCTGGCGGGGGG + Intergenic
1111333524 13:86792234-86792256 TGGCTCCCTCTGCTGGCGGGAGG + Intergenic
1114490092 14:23095101-23095123 CAGCTCCGCCATCTTGCGTGAGG + Exonic
1115753596 14:36513778-36513800 CAGCTCTCTCAGCTAGCGAGGGG - Exonic
1116223234 14:42113856-42113878 CGGCTCCCTCGGCTTGCTGGGGG - Intergenic
1116774872 14:49167634-49167656 CAGCTCCCTCACCTTTCAGGTGG + Intergenic
1118374356 14:65163719-65163741 CAGCTCCTACAGCTTGTGAGAGG + Intergenic
1119880975 14:78099403-78099425 ATGCTCCCTCAGCTTGCAGAAGG - Intergenic
1121259950 14:92558758-92558780 CAGCTCCCTCACCCTTCCGGTGG - Intronic
1121713474 14:96056203-96056225 CAGCTCACTCAGCATGCTGGTGG + Intronic
1122023694 14:98859450-98859472 AAGCTCCCACAGCTTGGGGCTGG - Intergenic
1122071318 14:99207431-99207453 AAGCTCCCTCAGCTTCATGGGGG - Intronic
1122410246 14:101522035-101522057 CAGCACCCACAGCTCGCAGGAGG + Intergenic
1122807034 14:104264948-104264970 CAGAGCCCCCAGCTTGGGGGAGG + Intergenic
1202936004 14_KI270725v1_random:88227-88249 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
1125729218 15:41883351-41883373 CAGCTCCTCCAGCTGGTGGGAGG + Exonic
1125880142 15:43186143-43186165 CAGCTGCCTCATCTGGGGGGTGG - Exonic
1125956291 15:43793068-43793090 GGGCTACCTCTGCTTGCGGGCGG - Exonic
1128813355 15:70587557-70587579 CGGCTCCCTCAGCTTGCGCGAGG - Intergenic
1132363301 15:101236290-101236312 CAGTTCCCACATGTTGCGGGAGG + Intronic
1132545065 16:529110-529132 GAGGTCCTTCTGCTTGCGGGAGG + Intronic
1132715230 16:1286747-1286769 CTGGCCCCTCAGCTTGTGGGAGG - Intergenic
1132856466 16:2047316-2047338 CTGCTCCCCCAGCTCGGGGGAGG - Intronic
1132893283 16:2214919-2214941 GAGCTCCCGCAGCCCGCGGGAGG - Intergenic
1134833813 16:17345061-17345083 GAGCTTCCTCAGCCTGTGGGTGG + Intronic
1135557999 16:23453156-23453178 CAGCGCACTCAGTTTGCGGCTGG + Exonic
1135923724 16:26673900-26673922 CAGCTCCCTCAGCCTGAAAGGGG + Intergenic
1136356596 16:29748327-29748349 CCGCTCCCTCTGCTTGCCAGAGG + Intergenic
1136547572 16:30964350-30964372 CAGCTCCCAGACTTTGCGGGCGG - Intronic
1137616378 16:49850227-49850249 CAGCTCCCTCAGCCTACTGTGGG - Intronic
1138480239 16:57297994-57298016 CAGCTTCCTTAGCTTGTGTGTGG + Intergenic
1140197490 16:72867159-72867181 CAGCTTCCTCAGCTTCCTGTGGG - Intronic
1142117886 16:88369579-88369601 CAGCTCCCTCAACTTCAGGCAGG + Intergenic
1142605292 17:1078045-1078067 CAGCTCCCGCAGCTGGCTGGGGG - Intronic
1142740027 17:1926463-1926485 CAGCTCCCTCAGTGACCGGGTGG + Intergenic
1142911494 17:3097458-3097480 CACCTCCCTTGGCTTGGGGGTGG - Intergenic
1143174492 17:4948450-4948472 GAGCTGCCTCGGCTGGCGGGCGG + Exonic
1143188048 17:5022405-5022427 CAGCTCCCGCATCTTGAGGGCGG - Exonic
1143374026 17:6456967-6456989 AAGCTCCCTCAGGCTGCAGGTGG - Intronic
1144215055 17:13048092-13048114 CAGCTCCATCAGCCTGCTGGAGG + Intergenic
1145991318 17:29080855-29080877 CACCTCCCTGAGCGAGCGGGCGG - Intronic
1146289382 17:31596966-31596988 CTGCTCCCTCTGCCTGCTGGGGG + Intergenic
1148216543 17:45836608-45836630 CAGCTCCCTCACCTGTTGGGTGG - Intergenic
1148743725 17:49907237-49907259 CTGCTCCCTCAGCTTCTGGAAGG - Intergenic
1150500978 17:65650495-65650517 CAGCTGCCTCTGCTTGCTGCTGG + Intronic
1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1151909280 17:77071174-77071196 TAGCACCCTCAGCTTTCGGGAGG - Intergenic
1152059819 17:78063672-78063694 GATCTCTCTCAGCTTGTGGGTGG + Intronic
1152569302 17:81114684-81114706 CAGCTCCCTAAGCTTTCCTGAGG - Intronic
1152597596 17:81245620-81245642 CAGCTCCGCCAGGCTGCGGGGGG - Exonic
1154171814 18:12057624-12057646 CAACTCCCACACCTTGAGGGTGG + Intergenic
1157711889 18:49855884-49855906 CAGCTCCCTCAGCCAGGTGGTGG - Intronic
1158568910 18:58579935-58579957 CAGTTGCCTCAGATAGCGGGAGG + Exonic
1158794239 18:60823150-60823172 CAATTCCCTGAGCTTGCGGTTGG + Intergenic
1160463251 18:79055265-79055287 CAGCTCCTTCACAGTGCGGGGGG + Intergenic
1161883013 19:6970809-6970831 CTGCACCCTCAGGTTGAGGGAGG - Intergenic
1162364311 19:10238621-10238643 CAGCTCCCTCAGCTAGAGAAAGG + Intergenic
1163722169 19:18903481-18903503 CAGCCCCCTCCCCTAGCGGGGGG + Intronic
1164520230 19:28973353-28973375 CTGCTCCCTCAGCTCCCGGGGGG - Intergenic
1164528118 19:29026694-29026716 CAGCTCCCTCATCCTGCCTGGGG + Intergenic
1164684273 19:30156790-30156812 CAGCAGCCTCAACTTGCTGGAGG + Intergenic
1165409167 19:35648299-35648321 CACCTCTCTCAGCTTCCGGCTGG + Exonic
1166700566 19:44879391-44879413 CAACTCCCCCAGGTTGCTGGGGG + Intronic
1167748703 19:51367588-51367610 CAGCTAGCTCATCTTGCGGCTGG - Intronic
1202684538 1_KI270712v1_random:37271-37293 CAGCTCCCTCACCTCTCAGGTGG - Intergenic
925172652 2:1759702-1759724 CGGCTCCCTCTGCTTGTGGGGGG - Intergenic
927517357 2:23680163-23680185 CAGCTCACTCAGGGTGCTGGAGG + Intronic
927948547 2:27152215-27152237 CAGCTCCCTCAGCTCCCAGGTGG + Intronic
929084744 2:38157405-38157427 CATATCCCTCAGCTTCTGGGAGG + Intergenic
929592764 2:43157851-43157873 CAGCCCCCTCAGGTTGTGGGGGG - Intergenic
929786247 2:44994723-44994745 CAGCTATCCCAGGTTGCGGGAGG + Intergenic
930338807 2:50084598-50084620 CGGTTCCCTCAGCCTGCGGGGGG - Intronic
932445080 2:71775645-71775667 CAGCTGCCTCCCCTTGTGGGTGG + Intergenic
933313186 2:80685939-80685961 CAGCTTCTTCAGCTTCCGGTTGG - Intergenic
934247181 2:90317575-90317597 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
934262145 2:91485028-91485050 CAGCTCCCTCACCTCTCAGGTGG - Intergenic
934819054 2:97356200-97356222 CAGCTCCCTCACCTTTCAGGTGG + Intergenic
935514918 2:104023956-104023978 CAGCACCCTCAGTGTGCTGGTGG - Intergenic
935689607 2:105719044-105719066 CTGCTTCCTCTGCTTGAGGGAGG - Intergenic
936038420 2:109130061-109130083 CAGCTCCCGCAGACTGCCGGCGG - Exonic
937615123 2:123912968-123912990 CAGCTACTTCAGATTGTGGGAGG - Intergenic
948817727 2:240521321-240521343 CAGCTCCCTGGGCTTCCGAGTGG - Intronic
1168805795 20:671707-671729 GAGTTTCCTCAGCTTGCTGGGGG + Intronic
1169676050 20:8156237-8156259 CAGCTCCCTCACCTCTTGGGTGG + Intronic
1172594107 20:36137883-36137905 CAGCTGCCACAGGTTGGGGGAGG - Intronic
1173200282 20:40949682-40949704 CAGCTCCCTCACCTCATGGGTGG + Intergenic
1175061118 20:56244224-56244246 CAGCTCCCCCATCCTGCAGGTGG - Intergenic
1175551320 20:59819770-59819792 CAGGTGCCTCAGCTGACGGGTGG - Intronic
1176013987 20:62919050-62919072 AAGCTCCACCAGCTTGCGGCAGG + Intronic
1176904481 21:14483254-14483276 CAGCTCCCTCAACGTGGGGCAGG - Intergenic
1177192709 21:17869589-17869611 CTGGTCCCCCAGCTTGCGGATGG - Intergenic
1178441835 21:32604689-32604711 CAGCCCCCTCAGCATGGGGCAGG + Intronic
1179807226 21:43847412-43847434 CAGCACTCTCAACTTGCAGGTGG - Intergenic
1179874258 21:44259651-44259673 CAGCACCCTCTGTTTGAGGGAGG - Exonic
1180280350 22:10687907-10687929 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
1180587572 22:16906444-16906466 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
1181442671 22:22944802-22944824 CAGCTCCCTGTGCTTTCCGGGGG - Intergenic
1181879490 22:25966653-25966675 CAGCTCTCTGAGCATGCGGGAGG - Intronic
1183095395 22:35548944-35548966 CAGCTCCCCCAGCCTTGGGGAGG + Intronic
1183199251 22:36374666-36374688 CAGGTCACTCACCTTGGGGGTGG - Intronic
1183884508 22:40866845-40866867 AAGCTCCCTCTGCTTGAGAGTGG + Intronic
950124585 3:10503574-10503596 CCGCCCCCTCAGCTTCCAGGAGG - Intronic
950684072 3:14603865-14603887 CAGCTGCCTCAGCCTGGTGGAGG - Intergenic
950770963 3:15310713-15310735 CAGTTCCCTCTGCTTGGAGGAGG + Intronic
953386624 3:42509944-42509966 AAGATCCCTCAGGTTGCAGGTGG - Intronic
956195695 3:66651540-66651562 CGGCTCCCTCAGCTTGTGGGGGG + Intergenic
956568948 3:70672622-70672644 CAGCTTCCTCAGCTTTTGAGTGG - Intergenic
960560086 3:119073791-119073813 CAGCTCCCTCTGCTTGTGGGAGG - Intronic
961351730 3:126308458-126308480 CAGCTCCCTCAGCTGGAATGAGG - Intergenic
961471471 3:127115825-127115847 CAGCACCCTGATCTTTCGGGGGG - Intergenic
961745443 3:129061291-129061313 CAGCTCACTTAGCTGGTGGGGGG + Intronic
961872461 3:129998736-129998758 CAGCTCCATGAGTTTGCTGGAGG + Intergenic
964395455 3:156240986-156241008 CAGCTCCCTCACCTTTCAGGTGG - Intronic
964405420 3:156343546-156343568 CAGCCTCCGCAGCTTGTGGGAGG + Intronic
964993544 3:162844990-162845012 CAGCTCCCTCTGCTTGCAGGGGG - Intergenic
965256743 3:166423946-166423968 CGGCTCTCTCAGCTTGCAGCGGG + Intergenic
965294448 3:166925605-166925627 CATCACCCTCAGCTTGTTGGAGG - Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
967649788 3:191972883-191972905 CAGCTTCCTCAGCTGGCAGCAGG + Intergenic
968190207 3:196661617-196661639 CAGCTGCCTCACCCTGCTGGTGG + Exonic
968801684 4:2747089-2747111 CAGGTCTCCAAGCTTGCGGGAGG + Intronic
971760285 4:30756401-30756423 CAGTTTCCTCATCTTCCGGGTGG - Intronic
971798539 4:31259281-31259303 CAGCTCCCTCTGCTGCAGGGAGG + Intergenic
971825342 4:31614353-31614375 CAGCTCACTGAGCAAGCGGGGGG - Intergenic
976690651 4:87864055-87864077 CGGCTCCCTCAGCTTGCGGGAGG - Intergenic
977470747 4:97438475-97438497 CAGCTCCCTCAGCTTGCGGCAGG - Intronic
977507704 4:97923223-97923245 CAGCTCCCTCAGCCTGCGGGGGG + Intronic
977606977 4:98993874-98993896 CGGTTCCCTCAGCTTGTGGTAGG - Intergenic
983369805 4:166843179-166843201 TGGCTCCCTCTGTTTGCGGGGGG - Intronic
983726848 4:170940175-170940197 CACCTCCCTTGGCTTGGGGGAGG - Intergenic
985534081 5:453427-453449 CAGGTCCATCAGCTTCCGGTGGG - Exonic
985750346 5:1670011-1670033 CAGCACTCTCAGCTTGAGGAAGG + Intergenic
989091961 5:37743211-37743233 CGCCTCCCTTAGCTTGGGGGAGG - Intronic
989167883 5:38448398-38448420 CACCTTCCTCAGCTTTCTGGGGG + Intronic
992886282 5:81163179-81163201 CAGCTGTCTCAGCTGGCAGGTGG - Intronic
993770234 5:91917244-91917266 CGGCTCCCTCATCTTGCTGTGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
994768681 5:103954201-103954223 CGGCTCCCTCGGTTTGGGGGAGG - Intergenic
995070671 5:107918146-107918168 CAGCTCCCTCAGCTCCCATGTGG + Intronic
995368134 5:111386859-111386881 CAGGTCCCTCAGCTGCCAGGGGG - Intronic
997228567 5:132227497-132227519 CAGTTCCCTCGGCTGTCGGGCGG - Intronic
997375861 5:133396943-133396965 CAGCTTCCTCAGCCTGCGGGCGG - Intronic
998374844 5:141683321-141683343 CAGCTGCCTCAGCTAGGGGAGGG + Intergenic
1001429735 5:171649905-171649927 TAGCTCCCTCAGCAGGCTGGAGG - Intergenic
1001927962 5:175652794-175652816 CAGGTCCCACAGCTAGCTGGGGG - Intergenic
1002790775 6:435930-435952 CGGCTCCCTCAGCTTGCGCGGGG - Intergenic
1003039078 6:2670475-2670497 CAGCTCCCTAATCTTGGGTGGGG - Intronic
1003149496 6:3536941-3536963 AAGGTCCCTCAGCTAGCAGGTGG - Intergenic
1003176830 6:3758134-3758156 CGGCTCCCTCGGCTTGCGGGGGG + Intergenic
1003279051 6:4676219-4676241 CAGCTCCCTCAACCTTCGGTCGG - Intergenic
1004580208 6:16943399-16943421 CAGCTCCCTATTCTTGGGGGAGG + Intergenic
1005827339 6:29641975-29641997 CAGCTCCCTCTGCCTGGGCGTGG + Intergenic
1005830192 6:29664567-29664589 CAACTTCATCAGCTTGCGGAAGG - Intronic
1006750435 6:36373441-36373463 GAGCTTCCTCACCTTCCGGGGGG + Exonic
1007836607 6:44678719-44678741 CAGCTCCCCCAGCTCACAGGAGG - Intergenic
1012381438 6:98624268-98624290 AACCTCCTTCAGCTTGGGGGTGG + Intergenic
1013490631 6:110643066-110643088 CAGCTTCCTTACCTTGCTGGTGG - Intronic
1016217145 6:141618182-141618204 CGGCTCCCTCAGCTTGCAGGGGG + Intergenic
1017382713 6:153848709-153848731 CAGCTCCTCCTGCTTGCAGGGGG - Intergenic
1018099846 6:160427532-160427554 CAGTTCCCTCAGCTGGCGAGTGG + Intronic
1018632537 6:165833602-165833624 CAGTTCCTTCAGCATGAGGGGGG + Intronic
1018676847 6:166229559-166229581 CAGCTCCCTCAGCAACTGGGTGG - Intergenic
1019000312 6:168744175-168744197 CCACTCCCTCAGCTTGCAGGGGG - Intergenic
1021085938 7:16421175-16421197 CAGCTGCCACGGCTTGCGGGTGG + Exonic
1022649218 7:32259476-32259498 CAGCTCCCCCAGCTGGTGGGAGG - Intronic
1022801695 7:33782882-33782904 CAGCTTCCTCAAATTGTGGGTGG + Intergenic
1023545695 7:41315946-41315968 CAGCGCCCTCAGCTGGCCAGGGG - Intergenic
1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1025691189 7:63754144-63754166 GACCTCCCTCAGCTTGAGAGAGG - Intergenic
1029255376 7:99266026-99266048 CAGCTCCCTCACCCTTCTGGTGG + Intergenic
1031976178 7:128095017-128095039 CATCTCCCTCCTCTTGCTGGTGG + Intergenic
1037356366 8:18023956-18023978 CTGCCCTCTCAGCTTGAGGGTGG - Intronic
1040932385 8:52748534-52748556 CAGCTCTCTCCCCTTGTGGGAGG + Intergenic
1042804253 8:72754841-72754863 CTGCTCCCTCTCCTTGAGGGCGG - Intronic
1042993464 8:74666937-74666959 CAGCTGTCTCAGCATGCAGGTGG - Intronic
1044441598 8:92230759-92230781 CAGCTCCCTCAGCTTGCAGGGGG + Intergenic
1046482906 8:114846665-114846687 CAGCTCCCTCACCTTTTGGCTGG - Intergenic
1047615348 8:126558267-126558289 CAGCAGCCCCAGCTGGCGGGAGG - Exonic
1047761835 8:127960279-127960301 CAGGTCACACAGCTTGAGGGTGG + Intergenic
1049104595 8:140603970-140603992 CAGCTCCTTCACCCTGAGGGAGG - Intronic
1049365052 8:142233046-142233068 CCCCTCCCTCAGCTTGGGGAGGG - Intronic
1049775979 8:144405249-144405271 CAGCCCCATCAGCTTTCAGGAGG - Intronic
1051314237 9:15810793-15810815 CAGCTCCCTCTCCTTGTGGGAGG - Intronic
1053409202 9:37904628-37904650 AAGCTCAGACAGCTTGCGGGGGG + Intronic
1053696493 9:40644044-40644066 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
1054307744 9:63443272-63443294 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
1054406470 9:64767274-64767296 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
1054440098 9:65252747-65252769 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
1054490307 9:65769192-65769214 CAGCTCCCTCACCTCTCAGGTGG - Intergenic
1056261580 9:84854191-84854213 CAGCTTCCTCAGCTTTGGGATGG + Intronic
1056752236 9:89360710-89360732 CAGCTCCCTCAACGTGCAGATGG + Intergenic
1057834902 9:98436662-98436684 CAGCTCATTTAGCTTGCTGGGGG - Intronic
1057882816 9:98806216-98806238 AATCTCCCTCAGGTTGCAGGAGG - Intergenic
1058615053 9:106817273-106817295 TAGCTCCATCAGCTGGCTGGTGG - Intergenic
1058731480 9:107854156-107854178 CAAGTCCCTCTGCTTGCAGGAGG + Intergenic
1059469201 9:114491663-114491685 CAAGTCCCTCTGCTTGCGGGTGG - Intronic
1061732753 9:132629084-132629106 GAGCTCCCTCAGCTGGAGGCTGG - Intronic
1062208061 9:135348197-135348219 ACGCTCGCTCAGCTTGGGGGGGG - Intergenic
1062269384 9:135701692-135701714 CAGATGCCGCAGCCTGCGGGGGG + Intergenic
1062397714 9:136359104-136359126 CATCTCCCCCAGCTGGTGGGAGG - Exonic
1062555153 9:137110491-137110513 CCGCTCCCACAGCCTGCGTGTGG + Intergenic
1202778941 9_KI270717v1_random:17704-17726 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189057293 X:37711448-37711470 CATCTCCCTTAGTTTGGGGGTGG - Intronic
1194571751 X:95561209-95561231 AAGTTCCCTCAGCTTGGGTGGGG + Intergenic
1196020328 X:110984485-110984507 CAGCTGCCTCAGCTGGAGAGGGG + Intronic
1196828363 X:119758364-119758386 CAGCTCCCCCGGGTCGCGGGCGG - Intergenic
1199574641 X:149301688-149301710 AAGCTCACTCAGCTTGTAGGAGG - Intergenic
1201194239 Y:11475977-11475999 CAGCTCCCTCACCTCTCAGGTGG + Intergenic
1202137149 Y:21677054-21677076 CGGCTCCCTCAGCTTGCAGGGGG - Intergenic
1202272716 Y:23086155-23086177 CGGCTCCCTCCGCTTGTGGGAGG - Intergenic
1202293310 Y:23334527-23334549 CGGCTCCCTCCGCTTGTGGGAGG + Intergenic
1202425713 Y:24719899-24719921 CGGCTCCCTCCGCTTGTGGGAGG - Intergenic
1202445076 Y:24950186-24950208 CGGCTCCCTCCGCTTGTGGGAGG + Intergenic