ID: 1092367629

View in Genome Browser
Species Human (GRCh38)
Location 12:7890170-7890192
Sequence CTCCATCTTCAATAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2375
Summary {0: 5, 1: 323, 2: 745, 3: 735, 4: 567}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092367629 Original CRISPR CTCCATCTTCAATAGGAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr