ID: 1092368904

View in Genome Browser
Species Human (GRCh38)
Location 12:7900146-7900168
Sequence GTTACGTTTTTAGTTGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092368899_1092368904 22 Left 1092368899 12:7900101-7900123 CCTAGTGTTTCAATCAGTAAAAA 0: 1
1: 2
2: 2
3: 24
4: 294
Right 1092368904 12:7900146-7900168 GTTACGTTTTTAGTTGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092368904 Original CRISPR GTTACGTTTTTAGTTGGGGC GGG Intergenic
No off target data available for this crispr