ID: 1092370841

View in Genome Browser
Species Human (GRCh38)
Location 12:7915693-7915715
Sequence CTGCATTGGAAGGCAGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092370836_1092370841 15 Left 1092370836 12:7915655-7915677 CCTAGAGCAATACAGAAAGGGCA 0: 1
1: 0
2: 2
3: 22
4: 236
Right 1092370841 12:7915693-7915715 CTGCATTGGAAGGCAGGTCAAGG 0: 1
1: 0
2: 2
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092370841 Original CRISPR CTGCATTGGAAGGCAGGTCA AGG Intergenic
900415931 1:2534675-2534697 CTGCCTGGGAAGTCAGTTCAGGG + Intergenic
900691083 1:3981030-3981052 CTGCTATGGAGGGCAGGACAAGG - Intergenic
900880802 1:5380024-5380046 CTTCATGGGAAGGCAGGGGAGGG - Intergenic
900919865 1:5663216-5663238 CTGCCTCGGAAGGCTGGTTAGGG - Intergenic
901138135 1:7010803-7010825 CTGAAATGGAAGGAAGGTGATGG - Intronic
903827917 1:26158667-26158689 CTGAATGGGAAGGCAGAACAGGG - Intergenic
904374698 1:30073112-30073134 CTGCTTTGGAGGGGAGGTCAGGG + Intergenic
905403764 1:37720059-37720081 CTGTAGGGGCAGGCAGGTCAGGG + Intronic
905590396 1:39158350-39158372 CTGCATATCAAGGCAGTTCAAGG - Intronic
905947941 1:41919412-41919434 CTGCAGAGCAAGGCAGGGCAGGG - Intronic
907443254 1:54491069-54491091 CTGCAGAGGCAGGCAGGTCCAGG - Intergenic
907598370 1:55742031-55742053 CTGCAGTCAAAGGCAGGGCAAGG - Intergenic
908517913 1:64912404-64912426 CTGCATTGACAGGCAGTTAAGGG + Intronic
909063659 1:70907200-70907222 CTACATTGCAAGGCATTTCAGGG + Intronic
911050269 1:93665086-93665108 CTGCCCGGGAAGACAGGTCAAGG - Intronic
912517880 1:110227281-110227303 CTGCATGGGCTGGCAGGCCACGG - Intronic
915579838 1:156806945-156806967 CTGCATTGGAAAGGATGTTAAGG - Intronic
916255505 1:162783425-162783447 CTGAATAGGGAGGAAGGTCAGGG + Exonic
917108777 1:171523200-171523222 CTCTAATGAAAGGCAGGTCATGG - Exonic
917219555 1:172714017-172714039 GTGTATTGGGAGGCAGGTCTAGG - Intergenic
917976752 1:180244863-180244885 CTGCCCTGGGAGTCAGGTCAGGG - Intronic
917986926 1:180330119-180330141 CTTCATTTGAAGGCTGGGCATGG + Intronic
921822600 1:219634763-219634785 CTTTCTTGGAAGGCAGGTAAGGG - Intergenic
923525278 1:234767813-234767835 CTGCCTCTGAAGGGAGGTCAGGG - Intergenic
924919277 1:248609844-248609866 CTGGGTGGGAAAGCAGGTCATGG - Intergenic
1062998997 10:1896411-1896433 GTGCATTAAAAGGCAGCTCAGGG + Intergenic
1063138919 10:3239691-3239713 CTGCGCTGCAAGGCAGGGCATGG - Intergenic
1065241576 10:23710205-23710227 CTGAATTGTAATGCAGCTCAGGG - Intronic
1065509825 10:26467194-26467216 ATGCATTAGAAGGCTGGGCACGG - Intronic
1066721969 10:38349085-38349107 CTGAATAGGGAGGAAGGTCAGGG + Intergenic
1067087900 10:43252490-43252512 CTGCCTGGGAAGGAAGGGCAGGG + Intronic
1067159712 10:43815008-43815030 CTCAATTGGAGGGCAGGGCAGGG - Intergenic
1069631609 10:69900467-69900489 CTACTTTGGAAACCAGGTCAGGG - Intronic
1069901231 10:71707785-71707807 GTGTGTTGGTAGGCAGGTCATGG - Intronic
1072793957 10:98339957-98339979 CTGCATGGGCAGGCAGGTGATGG - Intergenic
1073805044 10:107088395-107088417 CTGCATCTGAAGGCAGGCCCTGG + Intronic
1075170436 10:120108683-120108705 CTGCAAGAGAAGGTAGGTCAAGG - Intergenic
1075837418 10:125466604-125466626 CAGGATTTGAAGCCAGGTCATGG + Intergenic
1075975510 10:126690677-126690699 ATTCAGTGGAAGGCTGGTCAAGG - Intergenic
1076193066 10:128496399-128496421 CTGCCTTGGAATGCTGGTCCCGG + Intergenic
1076444476 10:130502843-130502865 TTGCATTGGATGGCAGATCAAGG + Intergenic
1077004645 11:347577-347599 CTGCATTTGAGGGCCGGGCACGG - Intergenic
1077120893 11:907937-907959 CTGCAGAAGAAAGCAGGTCAAGG - Intronic
1079150217 11:17892211-17892233 CTGAATGGGAAGGCAATTCATGG - Intronic
1079929009 11:26534099-26534121 CTGCATTGGAAAGCATGGTATGG + Intronic
1080368681 11:31609083-31609105 CTTCATTGGCAGGCTGGACAAGG + Intronic
1083352870 11:62043497-62043519 CTTCAGTGGAAGGCTGATCAAGG + Intergenic
1084111130 11:67014805-67014827 CTGCCCTGGAGGGCAGGACAGGG - Intronic
1084155257 11:67309690-67309712 CTGCAGGGGAGGGCAGGTGAAGG - Intronic
1084480002 11:69414723-69414745 CTGCACTGGCAGGCAGGTAGAGG - Intergenic
1085083567 11:73652281-73652303 CTGCCTTTGTAGGCAGGTCCAGG - Intronic
1088504694 11:110516520-110516542 CCGCATTAGAAGCCAGGTCTTGG - Intergenic
1091418939 12:317869-317891 CTGCTTTGGCAGGCAGCTCCTGG - Intronic
1092370841 12:7915693-7915715 CTGCATTGGAAGGCAGGTCAAGG + Intergenic
1092776745 12:11950211-11950233 CTGCATTGGGGGACAGGTGAGGG + Intergenic
1095255633 12:40032454-40032476 CTGCTTTGGTAGGCAGGTGCTGG - Intronic
1100302716 12:93322969-93322991 CTGCAGAGGAAGTCAGGGCAAGG + Intergenic
1102251343 12:111389620-111389642 CCACATTGGAAGGCAGGTCCAGG + Intergenic
1102353001 12:112208535-112208557 CTGCAATGGGAGGCGGGTGAGGG + Exonic
1102718896 12:114999341-114999363 CTGCATTGGCAGGTCTGTCAGGG + Intergenic
1102867702 12:116387090-116387112 CTGCATTGGGAGCCTGGCCAAGG - Intergenic
1104090547 12:125513098-125513120 CTGCGTAGGCAGGCAGGCCAGGG - Intronic
1104890796 12:132139210-132139232 CTGCTCTGGAAGGAGGGTCAGGG + Exonic
1108107947 13:47033374-47033396 GTGCTTTGAAAAGCAGGTCATGG - Intergenic
1111521354 13:89409206-89409228 CTTCATTGGAAGTCCTGTCAAGG + Intergenic
1113258963 13:108539310-108539332 GTACATTGCAAGGCAGGACAGGG + Intergenic
1113434778 13:110282481-110282503 GTGCATTGGAAGTGAGGACAGGG - Intronic
1115334243 14:32229319-32229341 ATGGATTGGAAGACAGGTAAGGG + Intergenic
1116957886 14:50943417-50943439 CTGCTGAGGAAGGCTGGTCAGGG - Intronic
1117335946 14:54757650-54757672 CTGCATGGGATGGCATGGCAGGG + Intronic
1117521890 14:56559448-56559470 CTGCATTAGAAGGCTGGGCGTGG + Intronic
1122283990 14:100640051-100640073 CAGTCTTGGAAGGCAGGTCGTGG + Intergenic
1122684009 14:103490025-103490047 CAACATTGGAAGGCTGGGCATGG + Intronic
1123439590 15:20280961-20280983 CTGCCTTTGGAGGCATGTCACGG + Intergenic
1126719173 15:51558127-51558149 CATCATTTGAAGGCAGGTGAGGG - Intronic
1127251717 15:57245579-57245601 CTGAGTAGGAAGGCAGGCCATGG + Intronic
1127540104 15:59929033-59929055 CTGCATGGGAAGGCAGATGTGGG + Intergenic
1129718445 15:77865067-77865089 CTGCACTGGGAGGCAGGGCCTGG - Intergenic
1130915245 15:88299744-88299766 CTGCTTGGGAATGCAGGTCTGGG + Intergenic
1131079591 15:89523446-89523468 CTGGCTTGGTAGCCAGGTCACGG + Intergenic
1132362909 15:101232978-101233000 CTGCCTTGGGAGGTGGGTCAGGG - Intronic
1132495288 16:260276-260298 CTGGATGGGAAGGAAGGTTATGG + Intronic
1134040440 16:11064304-11064326 CTGCTTTGGAATGGAGGCCAGGG + Intronic
1134844888 16:17431716-17431738 ATCCATTCGAAGGCAGGCCATGG + Intronic
1135663186 16:24314456-24314478 GTGCATTGGGAGAAAGGTCAAGG - Intronic
1136487642 16:30583533-30583555 CTGCCTTCCAAGGCAGGACATGG - Intronic
1138251097 16:55502619-55502641 CTGCAGTGGAAGGAAGGGCATGG - Intronic
1139378608 16:66516200-66516222 TTACAATGGAAGGAAGGTCAGGG + Intronic
1142278501 16:89135650-89135672 CTGCATTTGAAGGGAAGTCATGG - Intronic
1144314775 17:14049181-14049203 GTGGAGTGGAAGTCAGGTCAGGG - Intergenic
1144729889 17:17520200-17520222 CTGCATTGGCAGGACAGTCAGGG - Intronic
1146507995 17:33422096-33422118 CTCCATCTGGAGGCAGGTCAGGG - Intronic
1146528008 17:33583502-33583524 CTGTTCTGGAAGGAAGGTCATGG - Intronic
1146644220 17:34566182-34566204 CAGGAATGGAAGGCAGGACAAGG + Intergenic
1148812309 17:50301354-50301376 ATGCAGTGGAATGCATGTCATGG + Intergenic
1150165797 17:62941134-62941156 ATGAACTGGAAGACAGGTCAAGG + Intergenic
1150221819 17:63499941-63499963 CGGCATTGGCAGGCATGGCACGG - Intronic
1150304142 17:64070063-64070085 CTGCAGTGGAAGGAAGGTTCTGG + Intronic
1151857249 17:76730539-76730561 CGGCCGTGGAAGGCAGTTCAGGG - Intronic
1152637005 17:81434336-81434358 CTGCAGTGGGAGACAGGTCGAGG + Intronic
1157112176 18:44831840-44831862 GTGAATGGGAGGGCAGGTCATGG - Intronic
1157689048 18:49665797-49665819 TGGCAGTGGAAGGCAGGTCAAGG - Intergenic
1159219802 18:65445547-65445569 ATGCATTGGGAAGCATGTCAGGG + Intergenic
1159370609 18:67523176-67523198 CAGCAATGGAAAGCAGTTCAGGG + Intergenic
1160451212 18:78967048-78967070 CTGCTTTGAAGAGCAGGTCATGG - Intergenic
1163374459 19:16921833-16921855 CTGCATTGGATGTGAGGCCATGG + Intronic
1164567898 19:29341304-29341326 CTGGGTTGGAAAGCAGGGCATGG - Intergenic
1164776197 19:30855568-30855590 CCACATGGGAAGGCAGGCCAGGG - Intergenic
1164938630 19:32233835-32233857 CTGCATGGGCAGCCAGGTCATGG + Intergenic
1165154553 19:33779176-33779198 CAAGATTGGAAGGCAGGCCAGGG - Intergenic
1165265862 19:34663618-34663640 CTGCAGTTGAAGAAAGGTCATGG - Intronic
1165903404 19:39179125-39179147 CTGGATGGGGAGACAGGTCAGGG + Exonic
1166101851 19:40576033-40576055 CAGCATTGGAAGTGAGGTAAAGG - Exonic
1167194345 19:48016897-48016919 CTGCATTGAAATGCAGGTCAGGG - Intronic
925046571 2:777308-777330 CGGCACTGGAAGGCAGTTCAGGG + Intergenic
929481419 2:42311998-42312020 GTGCATAGGAAGGCCGGGCATGG - Intronic
931767482 2:65469758-65469780 ATGCATTATAAGGCAGGGCATGG - Intergenic
932601575 2:73130348-73130370 CTGCTTAGGAAGGCAGATCCTGG + Intronic
936403805 2:112185145-112185167 CTGCAATGGAGGGAAGGTCAGGG + Intronic
939262640 2:139829917-139829939 GTGCATTGGAAAGCTGCTCATGG - Intergenic
940204827 2:151191291-151191313 TTACATTGGAAGGCAATTCAGGG - Intergenic
940578576 2:155547995-155548017 GTGTATTGGAAGGCAGGATAAGG - Intergenic
941377570 2:164750692-164750714 ATGCATTGGAAGGCCAGTGAAGG - Intronic
944075956 2:195731022-195731044 CAGAGTTGGAAGGCAGGGCAAGG - Intronic
944214189 2:197237842-197237864 CTGCATGGAAAGGAAAGTCATGG - Intronic
944399625 2:199310419-199310441 CTCAATTGAAAGGCAGGTCATGG + Intronic
946891412 2:224280914-224280936 ATACATTAGAAGGCGGGTCAAGG + Intergenic
947804231 2:232954102-232954124 CTGCAGTGTCAGGCAGTTCAGGG + Intronic
948599088 2:239097822-239097844 CTGCCTTGGAAGGGCGGTCATGG + Intronic
1173337868 20:42127434-42127456 CTGCAATGCAAGGCAGAACAGGG + Intronic
1173793496 20:45842909-45842931 CTCCCTTGGAAAGGAGGTCAGGG + Intronic
1174127815 20:48320136-48320158 CAGCAATGGAAGGTAGGACAGGG - Intergenic
1174316548 20:49707182-49707204 CTATATTGGAAGCCAGGTCTTGG - Intronic
1174348410 20:49948951-49948973 CTGGATTGGAAGGCCAGTCTAGG + Intronic
1175917910 20:62435834-62435856 CTGCAATAGAAAGCAGGGCATGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176364324 21:6023484-6023506 CTCCAGTGGAAGCCAGGTCCAGG + Intergenic
1177895593 21:26853201-26853223 CTGCTCTGGAAGCCAGGACATGG - Intergenic
1178230503 21:30778496-30778518 CTGGATTAGAAGACAAGTCATGG + Intergenic
1179759194 21:43515061-43515083 CTCCAGTGGAAGCCAGGTCCAGG - Intergenic
1180672401 22:17563408-17563430 CTGCATTGATATGCATGTCATGG - Intergenic
1180968561 22:19803086-19803108 CTGCATCAGAAGGCTGGTGATGG + Intronic
1182149965 22:28020987-28021009 CTGCCTTGGAAGCCAGGTGAGGG - Intronic
1184190579 22:42891912-42891934 CTGCAGAGGAAGGCAGTGCAGGG - Intronic
1184696094 22:46139876-46139898 CTGCCTTTGGAGGCATGTCACGG + Intergenic
1184739117 22:46416911-46416933 CTGCATTGGGAGGCCGGTGGGGG + Intronic
1185228517 22:49667546-49667568 CTGCAGGACAAGGCAGGTCAGGG + Intergenic
1185278101 22:49958501-49958523 CTGGAGTGGAGGGCAGGGCAGGG - Intergenic
950021342 3:9789833-9789855 CTGGAAGGGAAGGCAGGACATGG - Exonic
950234523 3:11307232-11307254 CTGTATTGGCAGGAAGGTCAGGG + Intronic
950666703 3:14500178-14500200 GTGAATTGGAAGACAGGTTAAGG + Intronic
955939225 3:64132154-64132176 CTGCATTGAAAGGATGGTCAAGG - Intronic
956038055 3:65117140-65117162 CAGCTTTGGAAGGCAGGGGAAGG + Intergenic
960698547 3:120418934-120418956 CTGCAGTGCAAGGGAGGACAGGG - Intronic
962827051 3:139107901-139107923 CTGCATTAGAAGGCGGGGGATGG - Intronic
967407068 3:189128347-189128369 GAGTATTGGAAGTCAGGTCAAGG + Intronic
968615962 4:1577994-1578016 CTGCAAGGGCAGCCAGGTCAAGG - Intergenic
969067824 4:4502782-4502804 CTGCATAGGAAGACAGATGAAGG - Intronic
969923134 4:10559573-10559595 CTGCATTGCTAGCCTGGTCATGG + Intronic
970635966 4:18009788-18009810 CTCCATTGGAAGGCATGCTAAGG - Intronic
975330055 4:73102209-73102231 CAGCATTTTATGGCAGGTCAAGG - Intronic
981568965 4:146131637-146131659 CTGCTTTAGAAGGGAGGTCAAGG - Intergenic
982582672 4:157198788-157198810 CTCAATTGTAAGGGAGGTCACGG + Intergenic
984040997 4:174733667-174733689 CTGCAAAGGCAGGCAGGGCAAGG - Intronic
985968978 5:3360503-3360525 TCTCATTGGAATGCAGGTCACGG + Intergenic
987483460 5:18491223-18491245 CTGCTTTGTAAGTCAGTTCAAGG - Intergenic
991275665 5:64843897-64843919 CAGCAGTGGGAGGCAGGGCATGG - Intronic
992704280 5:79372688-79372710 CTGGAATGGGAGGCAGGTCGGGG - Exonic
994421961 5:99534015-99534037 CTGCAGTTGAGGGCAGCTCAAGG + Intergenic
994460882 5:100066569-100066591 CTGCAGTTGAGGGCAGCTCAAGG - Intergenic
994485030 5:100379994-100380016 CTGCAGTTGAGGGCAGCTCAAGG - Intergenic
995896952 5:117025199-117025221 ATGTAGTGAAAGGCAGGTCAGGG + Intergenic
995903269 5:117094056-117094078 CTGCCTTTGGAGGCAGGTCCAGG - Intergenic
997519219 5:134511927-134511949 CAGCAGTGGGAGGCAGATCAAGG + Intergenic
1000254566 5:159525487-159525509 CTGCGCTGGTAGGCAGGTCTTGG + Intergenic
1001313751 5:170628781-170628803 CTGCACTCGAGGGCAGCTCAAGG + Intronic
1003816535 6:9847639-9847661 CTGGGTGGGAAGCCAGGTCAGGG + Intronic
1004847613 6:19662581-19662603 CTGCTTTGGGGGGAAGGTCAGGG + Intergenic
1010622159 6:78090026-78090048 ATTCAGTGGAAGGCTGGTCAAGG + Intergenic
1011989604 6:93497533-93497555 CTGCTTTGGAAGAGAGATCAAGG - Intergenic
1014246968 6:119079150-119079172 TGCCATTGGAAGGAAGGTCAGGG - Intronic
1017485191 6:154896017-154896039 CTGGATTGCAAGGAAGGACAGGG - Intronic
1021483313 7:21142309-21142331 CTTCATTGGTAGGAAGGACACGG + Intergenic
1022849460 7:34245539-34245561 CTGCATGGGAAGACAGTTAAAGG + Intergenic
1023849444 7:44141896-44141918 CTGCATGGGAGGGCAGCTGATGG - Intergenic
1023998638 7:45177137-45177159 CTGCACTGACAGGTAGGTCAGGG + Intronic
1024307024 7:47937811-47937833 GGGCATTGGAGGGCAGGTGAGGG + Intronic
1024351245 7:48367101-48367123 CTACATTTAAAGGCAGGTAAAGG + Intronic
1024645673 7:51368524-51368546 CTGCATTTTGAGGCAGGGCAAGG + Intergenic
1025928060 7:65974826-65974848 CTGCAGTTGAGGGCAGCTCAGGG - Intronic
1029505970 7:100964500-100964522 CTGCCTGGGAAGGCAGGACAAGG - Intronic
1029855424 7:103510871-103510893 CTTCAGTGGGAGTCAGGTCATGG + Exonic
1031622126 7:123946727-123946749 ATGCAGTGGAAGGCTGATCAAGG - Intronic
1033793003 7:144815147-144815169 CTGCATGGGATGGCCGGGCACGG + Intronic
1034505718 7:151488925-151488947 CTGAGTTGGAAGGAAAGTCATGG - Intronic
1034848969 7:154475959-154475981 CTGAATTGGAAGTCAGGGGACGG - Intronic
1035380739 7:158439037-158439059 ATTCACTGGAAGGCTGGTCAAGG + Intronic
1036793276 8:11737572-11737594 CAGCATTAGAAGCCAGGCCAGGG + Intronic
1037992420 8:23330453-23330475 CAGCTTGGGAAGGGAGGTCAGGG - Intronic
1040488652 8:47898994-47899016 CTGCATAGGAAGGGAGGTCAAGG - Intronic
1040902484 8:52431019-52431041 CTGCAGAGGAGTGCAGGTCAGGG + Intronic
1041256175 8:55981205-55981227 CTGCTTCAGAAGGAAGGTCAGGG - Intronic
1043170714 8:76962454-76962476 CTGCAATGGAAGCTGGGTCAAGG - Intergenic
1048179225 8:132180077-132180099 CTGCAAAGGAAGGGATGTCATGG + Intronic
1048299977 8:133244496-133244518 CTCCTTTGTAAGGCAGGACAAGG - Intronic
1049624234 8:143612966-143612988 CTGCAGAGGCAGGCAGGTGAGGG + Intronic
1052165865 9:25327165-25327187 CTGGATTGGAAGACAGGTAGGGG + Intergenic
1056119530 9:83473370-83473392 CTGCTGTGGAAGGTAGGTGAGGG - Intronic
1056160034 9:83880172-83880194 CAGCAGTGAAGGGCAGGTCAAGG + Intronic
1058833559 9:108840733-108840755 CTGACCTGGAAGGCAGGTCTTGG - Intergenic
1061595813 9:131628507-131628529 CTGCATGGGAAGGCAGGGAGGGG - Intronic
1062301358 9:135873061-135873083 CTGCAAGGTAAGGCATGTCACGG + Intronic
1186407518 X:9317015-9317037 CTGCATTGCCAGGGAGGCCAAGG + Intergenic
1189277846 X:39799685-39799707 CTGCCTTGGAAGGCAAGTTTGGG + Intergenic
1191061263 X:56299450-56299472 CTGAATTGGGATGGAGGTCAGGG - Intergenic
1193561441 X:83022469-83022491 CTGCATTAAAAGGAAGGACATGG + Intergenic
1194768898 X:97876539-97876561 CTGCATTGGAAACTAAGTCAAGG - Intergenic
1199594148 X:149493484-149493506 CTGCCTTGGAGGTCAGGTGAAGG + Intronic
1200843239 Y:7805127-7805149 CCCCATTGGAAGGAGGGTCAGGG + Intergenic