ID: 1092376880

View in Genome Browser
Species Human (GRCh38)
Location 12:7963136-7963158
Sequence TTAGGCAGCTTGTCATAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092376876_1092376880 -6 Left 1092376876 12:7963119-7963141 CCTGTTCTTGCCCCTTCTTAGGC No data
Right 1092376880 12:7963136-7963158 TTAGGCAGCTTGTCATAAACAGG No data
1092376870_1092376880 21 Left 1092376870 12:7963092-7963114 CCTACCCTTTTACGCCTAGAAAT No data
Right 1092376880 12:7963136-7963158 TTAGGCAGCTTGTCATAAACAGG No data
1092376874_1092376880 7 Left 1092376874 12:7963106-7963128 CCTAGAAATGGAGCCTGTTCTTG No data
Right 1092376880 12:7963136-7963158 TTAGGCAGCTTGTCATAAACAGG No data
1092376872_1092376880 17 Left 1092376872 12:7963096-7963118 CCCTTTTACGCCTAGAAATGGAG No data
Right 1092376880 12:7963136-7963158 TTAGGCAGCTTGTCATAAACAGG No data
1092376873_1092376880 16 Left 1092376873 12:7963097-7963119 CCTTTTACGCCTAGAAATGGAGC No data
Right 1092376880 12:7963136-7963158 TTAGGCAGCTTGTCATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092376880 Original CRISPR TTAGGCAGCTTGTCATAAAC AGG Intergenic
No off target data available for this crispr