ID: 1092385581

View in Genome Browser
Species Human (GRCh38)
Location 12:8033512-8033534
Sequence GGGGAACTCCCCCAAGGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092385564_1092385581 10 Left 1092385564 12:8033479-8033501 CCTCCACCTCAGAAAGATCCAGT 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1092385581 12:8033512-8033534 GGGGAACTCCCCCAAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 124
1092385563_1092385581 11 Left 1092385563 12:8033478-8033500 CCCTCCACCTCAGAAAGATCCAG 0: 1
1: 0
2: 0
3: 29
4: 225
Right 1092385581 12:8033512-8033534 GGGGAACTCCCCCAAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 124
1092385565_1092385581 7 Left 1092385565 12:8033482-8033504 CCACCTCAGAAAGATCCAGTTTG 0: 1
1: 0
2: 0
3: 19
4: 133
Right 1092385581 12:8033512-8033534 GGGGAACTCCCCCAAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 124
1092385568_1092385581 4 Left 1092385568 12:8033485-8033507 CCTCAGAAAGATCCAGTTTGGGG 0: 1
1: 0
2: 0
3: 16
4: 135
Right 1092385581 12:8033512-8033534 GGGGAACTCCCCCAAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 124
1092385576_1092385581 -8 Left 1092385576 12:8033497-8033519 CCAGTTTGGGGGGGAGGGGAACT 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1092385581 12:8033512-8033534 GGGGAACTCCCCCAAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 124
1092385562_1092385581 28 Left 1092385562 12:8033461-8033483 CCAGCAGACAGAAAGAGCCCTCC 0: 1
1: 0
2: 3
3: 28
4: 240
Right 1092385581 12:8033512-8033534 GGGGAACTCCCCCAAGGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092385581 Original CRISPR GGGGAACTCCCCCAAGGGGG AGG Exonic
900629842 1:3628623-3628645 GAGGAGCTCCCAGAAGGGGGAGG - Exonic
903460532 1:23517498-23517520 CGTGAACTCCTCCAAGGGTGGGG + Intronic
903528376 1:24010642-24010664 GGGGCACTCCACCATGAGGGAGG + Intergenic
905922487 1:41728751-41728773 CGGGAATTCCCCCAAGGGGTGGG + Intronic
909232398 1:73106413-73106435 CAGGAACTCCCCCAACGGGTGGG - Intergenic
913451848 1:118997993-118998015 AGGAAGCTCCCCCAGGGGGGCGG - Intergenic
915301830 1:154956171-154956193 AGTCAACTTCCCCAAGGGGGCGG + Intergenic
916214246 1:162382302-162382324 GGAGAACAGCCCCAAGGGAGGGG + Intronic
1070400911 10:76052844-76052866 GGGGAAAGCCCCCAAGGCTGGGG - Intronic
1070982976 10:80665112-80665134 GGGCAGCTCCACCAAGGGAGGGG + Intergenic
1077092773 11:787214-787236 GGCGAACTCCCAGAAGGTGGTGG - Exonic
1077502849 11:2917065-2917087 GAGGGACCCCCCCAATGGGGTGG + Intronic
1084564247 11:69920427-69920449 GGGGAACTCACCCTAAGGAGGGG - Intergenic
1085515071 11:77106997-77107019 GGGGGACTCCCCCAAGGCTGGGG + Intronic
1085629265 11:78099903-78099925 GGGGATCTTGCCAAAGGGGGAGG - Intergenic
1089063311 11:115643634-115643656 GGGGAGCTCCCCCAAAGATGTGG - Intergenic
1089660679 11:119983220-119983242 GGGTGCCTCCCCAAAGGGGGTGG + Intergenic
1092385581 12:8033512-8033534 GGGGAACTCCCCCAAGGGGGAGG + Exonic
1096659552 12:53115716-53115738 GGGGGAGTCCCCCAAAGAGGGGG + Intronic
1100730263 12:97458828-97458850 GGGAAACTCCCCCAAGGAATTGG - Intergenic
1108478415 13:50843379-50843401 GGCGAACTCCCCAGAGGAGGAGG - Exonic
1110630002 13:77697566-77697588 GGGGAAGCCCACCCAGGGGGCGG - Intergenic
1112040468 13:95542164-95542186 CGGGAACAGCCCCAAGGGGATGG + Intronic
1112442634 13:99435307-99435329 GGGGAAATGCCCCAATGGGAAGG - Intergenic
1113414400 13:110117014-110117036 GAGGAACTTCCCCAAAGGGCAGG - Intergenic
1117479694 14:56130133-56130155 GGGGACCTCCCCCAAGGAGCAGG - Intronic
1118308127 14:64673160-64673182 GGGGAAGTCCCCCCAGGGGTGGG - Intergenic
1118449012 14:65880339-65880361 GGGCAACAAGCCCAAGGGGGTGG - Intergenic
1118753203 14:68821195-68821217 CTGGAATTCCCCCAAGGAGGCGG - Intergenic
1121114130 14:91331678-91331700 AGGGAGCTGCCCCAAGGAGGTGG - Intronic
1122264622 14:100540843-100540865 GGGAACCTCCCACAAGGTGGGGG + Intronic
1125419190 15:39487306-39487328 AAGGGACTCCCCCAAGGGGCCGG + Intergenic
1125511643 15:40295347-40295369 AGGGAGCTGCCCCAAAGGGGAGG - Intronic
1128769941 15:70274445-70274467 GGGGAACCCCCTTAAGGAGGGGG + Intergenic
1132000882 15:98179136-98179158 GCGGAGCTGCCCCAAGGAGGTGG + Intergenic
1134023075 16:10934769-10934791 GGGGAACTCCCTCAAGGGTAAGG - Intronic
1136748337 16:32612010-32612032 GGTGAACTCAGCCAAGGGAGAGG + Intergenic
1138505599 16:57476812-57476834 CAGGGACTCCCCCAAGGGGGTGG + Intronic
1139378730 16:66516883-66516905 GGGGAACGCCTCCAAGCAGGAGG + Intronic
1139636948 16:68263890-68263912 GTGCAGCTCCCCCAAGAGGGGGG + Intergenic
1141948291 16:87324884-87324906 GGGGACCTCCCCTAAGGAGGGGG + Intronic
1142369169 16:89668652-89668674 GTGGCACTCCACGAAGGGGGTGG + Intronic
1142382159 16:89739082-89739104 GGGGAGCTCCCCCCAGCCGGAGG - Intronic
1203050472 16_KI270728v1_random:871215-871237 GGTGAACTCAGCCAAGGGAGAGG + Intergenic
1144848965 17:18234484-18234506 GAGGGACTTCCCCGAGGGGGTGG + Intronic
1146952494 17:36916578-36916600 GGACAGCTCCCCCAAGGAGGAGG - Intergenic
1148945726 17:51260389-51260411 GAGGAACTCCCACACGGGGCGGG + Intergenic
1150229644 17:63543159-63543181 AGGGCCCTCCCCCAAGGTGGAGG - Intronic
1152094257 17:78263852-78263874 GGGGAACCCACCCAGGGTGGAGG - Intergenic
1157589659 18:48828827-48828849 GGGGGACTCTCCCCAGGGGAGGG + Intronic
1160610296 18:80079111-80079133 GGGGAACACTCCGAAGGGTGTGG - Intronic
1160754523 19:750695-750717 GGGGAGTTGCCCCAAGGGGTGGG + Intergenic
1161001774 19:1914365-1914387 GGGGAACAGGCCCGAGGGGGCGG - Intronic
1161626571 19:5330443-5330465 GGAGAACTAACCCAAGCGGGCGG - Intronic
1161988230 19:7669452-7669474 GGGGAGCTTGCCCAAGTGGGGGG - Intronic
1162312222 19:9914094-9914116 CGGGAACACCGCCTAGGGGGAGG - Intronic
1166261255 19:41642971-41642993 GGGAAACTCCCCCAGGTTGGAGG + Intronic
1166281112 19:41794294-41794316 GGGAAACTCCCCCAGGTTGGAGG - Intergenic
1167112117 19:47468684-47468706 GGGGTGCTCCCCAGAGGGGGAGG - Intronic
1167485973 19:49763172-49763194 CGGGGACACCCCCACGGGGGTGG - Exonic
1168502351 19:56904029-56904051 GGGGGACTCTCCCATGGGAGGGG - Intergenic
925596693 2:5562461-5562483 GGTGAACTCCCCCCAGTGGATGG - Intergenic
927789814 2:26001414-26001436 GGGGAACTACAAAAAGGGGGTGG - Intergenic
928115004 2:28540070-28540092 GGGAAGCTCTCCCTAGGGGGTGG - Intronic
937953246 2:127404579-127404601 GGGGAACTGCCCCACATGGGAGG + Intergenic
942450108 2:176103971-176103993 GGGGTTCTCCCCCAGGGAGGCGG + Intergenic
943862754 2:192889727-192889749 GAGAAACTCCCCCAAGGGAGGGG - Intergenic
946689592 2:222300335-222300357 GGAGAACTCCCTCCAGGGGCAGG - Intronic
1169193007 20:3669591-3669613 GGTGAACGCCGCCCAGGGGGTGG + Exonic
1169343038 20:4810603-4810625 TGGGAAGTCCTCCAAGGGAGGGG + Intronic
1170902458 20:20478689-20478711 TGGGAACTACCAGAAGGGGGAGG + Intronic
1171278164 20:23876089-23876111 GGAGACCTCCCCCAGGGTGGGGG + Exonic
1172039643 20:32034908-32034930 GGGGAAAACCCCCTAGGGGTGGG + Intergenic
1172178183 20:32985158-32985180 GGAGGGCTCCCCCAAGGAGGAGG - Exonic
1173665206 20:44758061-44758083 GGGGCACTCACCCATGGGTGTGG + Exonic
1179580957 21:42343679-42343701 GGGGGACCCCCCAAAGGAGGAGG + Intergenic
1180832763 22:18914488-18914510 GCGGAACTCACCCCAGGGTGGGG - Intronic
1181177533 22:21046154-21046176 GGAGAAGACCCCCAAAGGGGAGG - Intronic
1182073396 22:27478661-27478683 GGGGAACTCTGCCTAGAGGGTGG + Intergenic
1182435046 22:30325249-30325271 AGGGAACTCCCCTTAGGGGAGGG + Intronic
1183051410 22:35264857-35264879 GGGGAACTACCCCTAGAGGATGG + Exonic
1183568129 22:38631374-38631396 GGGGGACTCTCAAAAGGGGGAGG + Intronic
1203282848 22_KI270734v1_random:139792-139814 GCGGAACTCACCCCAGGGTGGGG - Intergenic
950158946 3:10744276-10744298 GGGGAACACCCCCATGGGGCTGG - Intergenic
953847333 3:46438268-46438290 GGGGGACTCCACTAAGGAGGTGG - Intronic
954614875 3:51964417-51964439 GAGGGAATCCCCCAAGGGGCGGG - Intronic
962350433 3:134651917-134651939 GGGGAACGCCCCCAGCAGGGTGG - Intronic
967814391 3:193787060-193787082 GAGGATCTCCCCCACGGGGCGGG + Intergenic
970192702 4:13530660-13530682 AGGGAACTCCTCCAAGGGTCTGG + Intergenic
971315078 4:25560884-25560906 GAGGAACTTGCCCAAGGGGAAGG - Intergenic
979098985 4:116590938-116590960 GATGAACTGCCCTAAGGGGGAGG + Intergenic
985135416 4:186780828-186780850 GGGAAACTCCCTCCAGGGGCTGG + Intergenic
986561031 5:9061070-9061092 GGTGAAATCCACCAAGGGGCTGG + Intronic
997351133 5:133232289-133232311 GGGGAAGTCCCAGAAGGTGGTGG + Intronic
1002044046 5:176532265-176532287 GGGTGACTCCCCCCATGGGGAGG + Intronic
1002200284 5:177524174-177524196 GGTGCACTCACCCAAGGAGGAGG + Exonic
1002876782 6:1217760-1217782 GGGGAAGTCCTCCAAGGGCCAGG + Intergenic
1004332878 6:14737510-14737532 TGGGCAGTCCCACAAGGGGGAGG + Intergenic
1005856463 6:29866724-29866746 GGGAAACTCCCCCATGTGGGAGG - Intergenic
1005862298 6:29911053-29911075 GGGAAACTCCCCTATGTGGGAGG - Intergenic
1005873747 6:29996054-29996076 GGAAAACTCCCCCATGTGGGAGG - Intergenic
1006092757 6:31637575-31637597 GAGGAACTCCCTCAGCGGGGTGG - Exonic
1006109287 6:31735065-31735087 GGGGACCACACCTAAGGGGGCGG + Intronic
1006832734 6:36978363-36978385 TGGGAGCTCCCCCATGGGGCTGG + Intronic
1007399985 6:41598017-41598039 GGGGAACCCCACCCAGGGTGGGG - Intronic
1008160338 6:48068697-48068719 GGGGGACTGGCCCCAGGGGGTGG - Intergenic
1010116382 6:72316862-72316884 GGGCAGCTGCCCCCAGGGGGAGG + Intronic
1012972273 6:105743975-105743997 GGGAATCTCCCCCAAGAGAGGGG + Intergenic
1015371747 6:132462156-132462178 GGGGTACTCCCCCTAGCGTGGGG + Intronic
1018977360 6:168575540-168575562 GGGGAGCTCCTCGCAGGGGGTGG + Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019294446 7:266507-266529 GGGGAGGTCCCCCCAGGAGGTGG - Intergenic
1019470040 7:1214668-1214690 GGGGATGCGCCCCAAGGGGGAGG - Intergenic
1019515824 7:1439857-1439879 GGGGCCCCCACCCAAGGGGGAGG + Intronic
1022157122 7:27671777-27671799 TGGGAACACCCCTAAGGAGGTGG + Intergenic
1026067629 7:67089246-67089268 GAGGAACTCCCTCAGTGGGGTGG + Intronic
1026533324 7:71219208-71219230 GGGTAATTCTTCCAAGGGGGTGG + Intronic
1026709295 7:72723085-72723107 GAGGAACTCCCTCAGTGGGGTGG - Intronic
1026866973 7:73830044-73830066 GGGGAACTCTTCCAGGGTGGAGG - Exonic
1026895997 7:74010396-74010418 GGAGACCTCCCCCCAGGGGCTGG + Intergenic
1026978376 7:74512563-74512585 GGGGGCCTACCCCAAGGAGGAGG + Intronic
1027274145 7:76541327-76541349 GGGGTACTCCCTCCAGGAGGTGG - Intergenic
1029572374 7:101378814-101378836 GGGGACATCCTCCAAGGGGCTGG - Intronic
1033656231 7:143376530-143376552 GGGCCACTCCCCCAAGAGAGGGG - Intergenic
1044784110 8:95776667-95776689 CAGGAATTCCCCCAAGGGGCTGG + Intergenic
1047259135 8:123240835-123240857 GGGGAGCTCGCCGAAGAGGGAGG + Intronic
1049019521 8:139946082-139946104 GTGGAAATCCCCAAGGGGGGAGG + Intronic
1049407312 8:142457521-142457543 GGGGTGCGCCCCCAAGGGTGTGG - Intronic
1053018327 9:34676885-34676907 GGAGGACAGCCCCAAGGGGGTGG + Intergenic
1053397658 9:37788777-37788799 AGTGAACTCCCCCAAGGGCAGGG - Intronic
1060817106 9:126640783-126640805 GGGGAACTGCCCGAAGAGGTGGG - Intronic
1062459246 9:136656009-136656031 GGGGAACTGCGTCAAGGGGTGGG - Intergenic
1185464264 X:345844-345866 GGGGAGCTCCAGCATGGGGGTGG + Intronic
1187958095 X:24540491-24540513 GGAGAAATCCCCCACGGTGGTGG - Intergenic
1200128841 X:153830436-153830458 GGGGCACGCCCCCGAGGTGGGGG + Exonic