ID: 1092387450

View in Genome Browser
Species Human (GRCh38)
Location 12:8047103-8047125
Sequence CTCTATAAACAAATGTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092387450_1092387457 24 Left 1092387450 12:8047103-8047125 CCAAGCTACATTTGTTTATAGAG 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1092387457 12:8047150-8047172 CAGAGTGTAGAGAAAATAAGGGG 0: 1
1: 0
2: 0
3: 24
4: 407
1092387450_1092387455 22 Left 1092387450 12:8047103-8047125 CCAAGCTACATTTGTTTATAGAG 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1092387455 12:8047148-8047170 AGCAGAGTGTAGAGAAAATAAGG 0: 1
1: 0
2: 2
3: 32
4: 403
1092387450_1092387458 28 Left 1092387450 12:8047103-8047125 CCAAGCTACATTTGTTTATAGAG 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1092387458 12:8047154-8047176 GTGTAGAGAAAATAAGGGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 265
1092387450_1092387454 -5 Left 1092387450 12:8047103-8047125 CCAAGCTACATTTGTTTATAGAG 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1092387454 12:8047121-8047143 TAGAGGGTACAGGAATGACTTGG 0: 1
1: 0
2: 0
3: 18
4: 181
1092387450_1092387456 23 Left 1092387450 12:8047103-8047125 CCAAGCTACATTTGTTTATAGAG 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1092387456 12:8047149-8047171 GCAGAGTGTAGAGAAAATAAGGG 0: 1
1: 0
2: 3
3: 33
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092387450 Original CRISPR CTCTATAAACAAATGTAGCT TGG (reversed) Intronic
901890542 1:12259746-12259768 CGCTTTTAAAAAATGTAGCTGGG + Intronic
902519533 1:17008300-17008322 CTCTACAAAAAAAATTAGCTGGG - Intronic
902523416 1:17036472-17036494 CTCTACAAAAAAAGTTAGCTGGG - Intronic
903079906 1:20801684-20801706 CTCTAAAAACAAAAGTATCAGGG + Intergenic
904776362 1:32909894-32909916 GTCTTTCAACAAATGGAGCTGGG + Intergenic
905519665 1:38588276-38588298 CTCTATAAACAAATGTTTTAGGG - Intergenic
906517875 1:46450159-46450181 CTCTATAAAAAAAACTAGCTGGG + Intergenic
907149352 1:52268911-52268933 CTTTAAAAACCAATGTAGCAAGG - Intronic
908769632 1:67584316-67584338 CTTTATAATCAAAAGAAGCTTGG - Intergenic
910562951 1:88612294-88612316 CTCTATCTACAAAGGTGGCTGGG - Intergenic
910786864 1:91008425-91008447 ATCTACAAACAAATGGAGGTAGG + Intronic
910900210 1:92112241-92112263 CTCTACAAAAAAATTTAGCTGGG + Intronic
910959391 1:92745645-92745667 CTCTACAAAAAAAATTAGCTGGG + Intronic
911942470 1:104065271-104065293 CCCTATAAATACATATAGCTAGG - Intergenic
912461916 1:109840084-109840106 ATATATAAACATATGTATCTAGG + Intergenic
915408519 1:155681425-155681447 CTCTAAAAAAAAATTTATCTGGG + Intronic
915421529 1:155786367-155786389 CTCTACAAAAAAATTTAGCTGGG + Intronic
915816107 1:158967167-158967189 CTCTAGAAAAAAATGTAGTATGG - Intronic
916713101 1:167429522-167429544 CTCTACAAAAAAATACAGCTGGG - Intergenic
916986202 1:170193783-170193805 ACCTACAAACAAATGTACCTAGG - Intergenic
917387956 1:174498237-174498259 TTCTATAAATATATGTAGTTAGG - Intronic
918229829 1:182518198-182518220 CTCTATTAAAAAAATTAGCTGGG - Intronic
918791629 1:188837727-188837749 ATCTATAAATAAATGGTGCTGGG + Intergenic
919269333 1:195318765-195318787 CTCTAAATACAAAATTAGCTGGG - Intergenic
919956043 1:202417201-202417223 CTTTCTGAACAACTGTAGCTGGG + Intronic
920687589 1:208121123-208121145 CTCTGTAAACCAATGCTGCTGGG + Intronic
920951129 1:210572734-210572756 ATATAAAAAAAAATGTAGCTGGG + Intronic
1063943351 10:11153474-11153496 AACTATCAACAAATGTAACTGGG - Intronic
1064310156 10:14205264-14205286 CTCCATAGCCACATGTAGCTGGG + Intronic
1065306720 10:24376200-24376222 CTCCATAGATATATGTAGCTAGG - Intronic
1066685664 10:37979066-37979088 CTCTATTAACTAACATAGCTAGG + Intergenic
1067485317 10:46643643-46643665 CTCTATTTACAAATATATCTCGG + Intergenic
1067609441 10:47698020-47698042 CTCTATTTACAAATATATCTCGG - Intergenic
1068139282 10:52984337-52984359 CTCCAAGAACACATGTAGCTAGG - Intergenic
1068640570 10:59400940-59400962 CTATTTAAACAAATGGTGCTGGG - Intergenic
1068968762 10:62940371-62940393 CTCTATAACCACATGTGGCTAGG - Intergenic
1071222011 10:83478394-83478416 CTAAATACACAAATTTAGCTGGG + Intergenic
1071557360 10:86614964-86614986 CCATATAATCAAATGTACCTAGG - Intergenic
1071584575 10:86807151-86807173 CACTTTCAACAAATGTATCTAGG + Intronic
1073225091 10:101911568-101911590 CTCTAAAAAATAAAGTAGCTGGG + Intronic
1074995841 10:118756133-118756155 CTCTAAAAACAAAATTAGCCTGG + Intergenic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1075694718 10:124425220-124425242 ATCTCTAAAAAAATGTAGCTGGG + Intergenic
1077057375 11:601266-601288 ATCTATAAAAAAAATTAGCTGGG + Intronic
1077728287 11:4699593-4699615 CTCCATAAAGAAATGCAGCCTGG + Intergenic
1078593334 11:12664949-12664971 CTCTATAAAAAAATATAGCCAGG + Intergenic
1079710312 11:23675242-23675264 CTTATTAAATAAATGTAGCTGGG + Intergenic
1079780445 11:24595668-24595690 ATTTATAAATAAATGAAGCTAGG + Intronic
1079892482 11:26074056-26074078 CTCTAGAGACAGATGTAACTTGG + Intergenic
1082840514 11:57685724-57685746 CTCTATAAACAAATACACCGTGG + Intronic
1084058680 11:66654983-66655005 CTCAAAAAAAAAATTTAGCTGGG - Intronic
1084124594 11:67090804-67090826 CTCTACAAACAAAATTAGCCTGG + Intergenic
1085912331 11:80842445-80842467 CTCAATAAACAAATGTTGAATGG + Intergenic
1087375089 11:97329737-97329759 CTCTATACAAAAAGTTAGCTGGG + Intergenic
1088484701 11:110329313-110329335 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1089952489 11:122542218-122542240 CCCTTTAAACAAATGGTGCTGGG - Intergenic
1092387450 12:8047103-8047125 CTCTATAAACAAATGTAGCTTGG - Intronic
1092745188 12:11666481-11666503 CTCTTTAAATAAATGTCACTGGG - Intronic
1093150786 12:15618676-15618698 CTCTACAAAAAAAAGTAGCCAGG - Intergenic
1095266003 12:40158536-40158558 TCCTATAGCCAAATGTAGCTTGG - Intergenic
1095536467 12:43254192-43254214 CTCCAGAAAGAAATGTAACTTGG + Intergenic
1095840616 12:46687764-46687786 CTTTTTAAAAAAATGTACCTAGG + Intergenic
1096046973 12:48570814-48570836 CTCTACAAAAAAAATTAGCTGGG + Intergenic
1098520890 12:71434381-71434403 CTCTATTAACAAATGGTGCTGGG + Intronic
1099012981 12:77313483-77313505 CTCTTTAACAAAAGGTAGCTTGG + Intergenic
1099171803 12:79373982-79374004 ATCTATAAACCAATTTAACTGGG + Intronic
1099626646 12:85084397-85084419 CTATATAAGTAAATGTAGTTAGG + Intronic
1100318732 12:93469629-93469651 CTCTAAAAAAAAATGTGGGTTGG + Intronic
1102845580 12:116178167-116178189 TTCTATTAACAATTGTATCTGGG - Intronic
1106268820 13:28134789-28134811 CTCTACAAAAAAATTTAGCTGGG - Intergenic
1106977886 13:35244347-35244369 CTCTTTCAACAAATGGTGCTGGG - Intronic
1107765821 13:43733417-43733439 CTCTATGCACAAATGAATCTTGG + Intronic
1107933601 13:45326569-45326591 CTCTTAAAAGAAATGTAGCCAGG + Intergenic
1108355946 13:49628794-49628816 CTTTAAAAACATATGTGGCTGGG + Intronic
1108994526 13:56710979-56711001 GTATGTAAACACATGTAGCTAGG - Intergenic
1110198111 13:72814096-72814118 TCCTATAAACAAATAGAGCTGGG - Intronic
1110587865 13:77215745-77215767 CTCTATTAAAAAAATTAGCTGGG - Intronic
1112016200 13:95333386-95333408 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118218457 14:63832156-63832178 CTCTAAAGATAAATTTAGCTTGG + Intergenic
1118483461 14:66190005-66190027 CTCTATAAAAACATTTAGCCAGG - Intergenic
1118587237 14:67366239-67366261 CTCTACAAAGAAAGTTAGCTGGG - Intronic
1118673385 14:68155486-68155508 CTCTATAAAGAAATATAGGCCGG - Intronic
1121538750 14:94709566-94709588 CTCTATAAACAAAATCAGCCAGG - Intergenic
1122073520 14:99221009-99221031 AAATATAAAAAAATGTAGCTGGG - Intronic
1122138367 14:99647385-99647407 CTCAATAGACAAATGTGGCATGG - Intronic
1129599023 15:76987385-76987407 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1129827913 15:78646979-78647001 CTCTATATAAAAAATTAGCTGGG + Intronic
1130027508 15:80282503-80282525 CTCTTTAAAAAAAATTAGCTGGG + Intergenic
1130180451 15:81621676-81621698 CTCTACAAAAAACTCTAGCTGGG + Intergenic
1130215693 15:81966874-81966896 CTACATAAACAAATGTAAATGGG + Intergenic
1131676826 15:94678353-94678375 CTCTACAAAAAAAAGTAGCCAGG + Intergenic
1131856300 15:96599688-96599710 CTCTATTTACAAATTTACCTTGG - Intergenic
1132819093 16:1853267-1853289 CTTTTTAAACAAATGCAGTTGGG - Exonic
1134429187 16:14185614-14185636 CTCAATAAACATCTGTAGCATGG - Intronic
1134660193 16:15978201-15978223 CTCTTAAAAAAAATTTAGCTAGG + Intronic
1134762888 16:16729685-16729707 CTCTACAAAAAAAGTTAGCTGGG - Intergenic
1134983164 16:18629464-18629486 CTCTACAAAAAAAGTTAGCTGGG + Intergenic
1135700949 16:24632017-24632039 GTCTATTAAAAAAAGTAGCTGGG - Intergenic
1135929341 16:26723506-26723528 CAATAGAAAAAAATGTAGCTGGG + Intergenic
1138003128 16:53303067-53303089 CTCCATAAACAAATGTAAGCTGG - Intronic
1139638741 16:68275432-68275454 CTGAAAAAACAAATATAGCTGGG + Intronic
1139850561 16:69949671-69949693 CTCCATAAACACAGGTGGCTTGG + Intergenic
1139879545 16:70172583-70172605 CTCCATAAACACAGGTGGCTCGG + Intergenic
1140372979 16:74422965-74422987 CTCCATAAACACAGGTGGCTCGG - Intergenic
1140893342 16:79304040-79304062 CTCTATAAAGAAATATGGGTGGG + Intergenic
1142703774 17:1681245-1681267 CTTTACCAAAAAATGTAGCTGGG - Intronic
1142895467 17:2974636-2974658 ATTTATAAACAAAAGTAGCAAGG + Intronic
1144035983 17:11366433-11366455 CTTAACATACAAATGTAGCTGGG - Intronic
1144814261 17:18022440-18022462 CTCTACAAAAAAAATTAGCTAGG - Intronic
1144935930 17:18899063-18899085 CTAAATATACAAAAGTAGCTGGG - Intronic
1146267403 17:31461964-31461986 CTTTAAAAACTAATGTGGCTGGG + Intronic
1146888457 17:36487935-36487957 CTCTATAAACAAACAAAGCCAGG + Intronic
1147207066 17:38845055-38845077 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1148258737 17:46160458-46160480 CTCTACAAAAAAAAGTAGCCAGG - Intronic
1149888738 17:60366982-60367004 CTATAAAAACAAAATTAGCTGGG - Intronic
1150000019 17:61429039-61429061 CTCTAAAAACAAATTTTGCCAGG - Intergenic
1151891874 17:76955923-76955945 CTCTATAAAAAAAATTAGCCAGG - Intergenic
1152826530 17:82469473-82469495 CTCTATAAGCAAATGGAGGGAGG - Intronic
1153121614 18:1734333-1734355 CTCTATCCACAGTTGTAGCTGGG - Intergenic
1154931398 18:21000616-21000638 CTCTTCAAACAAATGTTGCTGGG + Intronic
1155135685 18:22989831-22989853 CTCTACAAAAAAAATTAGCTAGG - Intronic
1156004502 18:32423836-32423858 GTCTATTAAGAAATGGAGCTGGG + Intronic
1157258747 18:46160829-46160851 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1157267830 18:46244221-46244243 CACTGCAAACAAATGTAGTTGGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159249098 18:65850465-65850487 CTCTGTAAATACATGTAGCGAGG + Intronic
1159982172 18:74796448-74796470 CTATATAGAAAAATGCAGCTTGG - Intronic
1160055488 18:75475570-75475592 CTCTATAAACAGATGAATCCTGG - Intergenic
1161223088 19:3127229-3127251 CTCTAAAAAAAAAGGTGGCTGGG + Intergenic
1161406254 19:4092902-4092924 CTCTATAAAAAAAACTAGCTGGG + Intronic
1162703929 19:12541250-12541272 CTCAAAAAACAAAAATAGCTAGG + Intronic
1164033321 19:21431328-21431350 CTATAGAGACAATTGTAGCTAGG - Intronic
1164875603 19:31684148-31684170 ATCTATAAAATATTGTAGCTGGG - Intergenic
1167401243 19:49271793-49271815 ATTTATTAACAAAAGTAGCTGGG + Intergenic
1167809396 19:51815263-51815285 CTCTATAAAAAAATGTTGGCTGG + Intronic
1167957889 19:53082507-53082529 CTCTACAAAAAAATCAAGCTGGG + Intronic
928561836 2:32496517-32496539 CTGTATGAACAAATGAGGCTGGG - Intronic
929575337 2:43048431-43048453 AGCTATAAATAAATGCAGCTGGG + Intergenic
930471483 2:51821187-51821209 CCCTATAAACAAAACTTGCTTGG - Intergenic
931034317 2:58220530-58220552 CTCTAGAAACAAATTTACATGGG + Intronic
931144080 2:59497681-59497703 CACTATTAAGAAATGTGGCTGGG + Intergenic
932034160 2:68224140-68224162 ATCTATGAACAAATATAGCTGGG - Intronic
932768666 2:74487973-74487995 CTCGATAAATAAATATGGCTGGG - Intronic
933149392 2:78895757-78895779 CTCTAGAAAAACATTTAGCTGGG - Intergenic
933340610 2:81021183-81021205 TTCAATAAACAAATGGTGCTTGG - Intergenic
933621232 2:84544212-84544234 CTCTATAAACAAATAAAAATTGG - Exonic
935499310 2:103818933-103818955 CTTAATAAAAAAATGTGGCTGGG + Intergenic
936980405 2:118259430-118259452 CTGTATATAGAAATGTAACTTGG + Intergenic
937063307 2:118996572-118996594 CTCTATTAATAAATTTTGCTGGG - Intergenic
938736802 2:134193281-134193303 CTCTACAAAATAAAGTAGCTAGG - Intronic
941629121 2:167865052-167865074 CTGCATAAACATAGGTAGCTGGG - Intergenic
943363878 2:186950998-186951020 CTCTAAAAAGAAACCTAGCTGGG - Intergenic
945229706 2:207573397-207573419 CTCTAAAAACAAAAGCATCTGGG - Intronic
946398429 2:219455399-219455421 CTCACTAACCACATGTAGCTAGG - Intronic
946739116 2:222784737-222784759 CTCTTTGAACAAATGGATCTAGG - Intergenic
947162074 2:227225070-227225092 CTCTATAAAAAAAATTAGCCAGG - Intronic
947732270 2:232437919-232437941 CTCTATAGACAAAATTAGCTGGG + Intergenic
1170322475 20:15115388-15115410 CTCTACAAAAAAAATTAGCTGGG - Intronic
1171569269 20:26232798-26232820 CTCTATAAAAAAAATTAGCTGGG - Intergenic
1173437392 20:43045344-43045366 CTCAATAAACAAATAAAGATTGG - Intronic
1173769298 20:45644507-45644529 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1174259337 20:49282370-49282392 CTCTAAATAAAAATGTAGATTGG - Intergenic
1174471693 20:50766335-50766357 CTCTACAAAAAAAGTTAGCTGGG - Intergenic
1179435065 21:41356580-41356602 CTCCATAAGCAAGTGTGGCTAGG + Intronic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
949345624 3:3073761-3073783 TTCTACAAAAAAAGGTAGCTGGG - Intronic
950658523 3:14452291-14452313 CTCTGTAAACAGAAGTAGCGTGG + Intronic
951220524 3:20064451-20064473 CTCTCTAACCAAATATAGATAGG - Intronic
952295654 3:32059749-32059771 CTCTATAAAAAAAATTAGCCAGG + Intronic
952314104 3:32217768-32217790 TTCTAAAAACATATTTAGCTGGG - Intergenic
953165698 3:40463076-40463098 CTCTACAAAAAAAATTAGCTGGG - Intergenic
953946900 3:47157100-47157122 CTCTACAAACAAAATTAGTTGGG + Intronic
954095515 3:48323678-48323700 CTTTTTAAACAAATGCTGCTAGG - Intronic
954252218 3:49376811-49376833 CTTTACAAACAAATCTAGATTGG - Intronic
954276664 3:49546550-49546572 CTTTACAAACAAATCTAGATTGG + Intergenic
955857152 3:63285172-63285194 CTCTAAATACAAATGTTCCTTGG - Intronic
956025445 3:64978140-64978162 CTCTGAAGACAAATGTGGCTTGG - Intergenic
956619425 3:71206041-71206063 CTTATTAAACAAATGGAGCTGGG - Intronic
956882642 3:73526846-73526868 CTCAAAAAAAAAAAGTAGCTGGG - Intronic
958432225 3:94055677-94055699 CACTAGAAAGAAATGTAGTTTGG + Intronic
958553104 3:95641932-95641954 CTCCAGAAACGAATGTAGCCTGG - Intergenic
960175805 3:114516364-114516386 CTCTATAAACATATATGTCTTGG + Intronic
964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG + Intergenic
964285601 3:155114431-155114453 CTATATAAACAAATGCAAATTGG + Intronic
964323595 3:155523436-155523458 CTCTTTAAGAAAATGTACCTTGG - Intronic
965547525 3:169931484-169931506 CTCTTTAAAAAAAATTAGCTGGG - Intronic
967399242 3:189042057-189042079 CTCTGTAAACACATGTTGATGGG + Intronic
968579143 4:1381616-1381638 CTCTAAAAACAAATCTTCCTTGG - Intronic
968584193 4:1408323-1408345 CTCTATATCCAAATTTAGCTGGG - Intergenic
969885587 4:10212453-10212475 CTCTTGAAACAAAAGTACCTAGG + Intergenic
970633566 4:17981575-17981597 CTCTATAAAAAAAATTAGCTGGG + Intronic
970920509 4:21389144-21389166 CTCTATAAAAAAAATTAGTTAGG - Intronic
971206712 4:24577492-24577514 CTCTATAAATCTATGTACCTTGG + Intronic
971233827 4:24823396-24823418 CTCTATAAAATAATATAGTTGGG + Intronic
972187530 4:36549399-36549421 CTCTATCAGCAAATGCAGCTTGG + Intergenic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
972363351 4:38349684-38349706 CTCTAAAAAAAAAATTAGCTGGG + Intergenic
972547083 4:40090302-40090324 ATCTATAAAAAAATCTTGCTTGG + Intronic
972575904 4:40351169-40351191 CTCTATAAAAAGAATTAGCTGGG + Intronic
975612950 4:76219404-76219426 TTCTAGAAGCAAATGAAGCTTGG + Intronic
976976846 4:91176056-91176078 CTATCTAAACAAATGGTGCTGGG - Intronic
977408698 4:96633656-96633678 CTCTATAAATAATTGTTGCAAGG - Intergenic
977540290 4:98310731-98310753 CTCAATAACCATATGTGGCTTGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978118251 4:105048407-105048429 CTCTACAAAAAAAATTAGCTGGG + Intergenic
978407325 4:108394404-108394426 CTCTAGATAAAAATGCAGCTTGG + Intergenic
978816262 4:112909634-112909656 CTCAATAAACCAAAGTAGCACGG + Intronic
979391577 4:120134841-120134863 CTATATACACACATGTAGATAGG - Intergenic
979538940 4:121857282-121857304 CTCTTAAAAAAAATTTAGCTGGG - Intronic
980622596 4:135328552-135328574 CCATATAAACTAATGGAGCTTGG - Intergenic
981653219 4:147082376-147082398 GTCAACAAACAAATGTAGTTGGG + Intergenic
981811772 4:148783742-148783764 CTCTAAAAAAAAAATTAGCTAGG - Intergenic
982418786 4:155168956-155168978 CTATATAAGAAAATGTAGGTAGG - Intergenic
983081580 4:163391806-163391828 CTGTACACACAAATGTAGATAGG + Intergenic
983343520 4:166497913-166497935 ATCTCTAAACAAAAGTGGCTGGG + Intergenic
986083516 5:4418935-4418957 CTCTATAAAAAAATATAGCTGGG + Intergenic
987107412 5:14653736-14653758 CTTTATAAAAAAAATTAGCTGGG + Intergenic
989497793 5:42129620-42129642 CTTTTTAAACAAATGTGGGTGGG - Intergenic
990250164 5:53905588-53905610 CTCTCTAAAGAAATGTAGTGTGG - Intronic
991603661 5:68378892-68378914 CTCTGCAAACAACAGTAGCTGGG + Intergenic
992841320 5:80698066-80698088 CTCTACAAAAAAAATTAGCTGGG - Intronic
993180616 5:84547657-84547679 CTCTACAAAAAAAGGTAGCTGGG - Intergenic
993182282 5:84569849-84569871 CTGGATAAACAAATGTGGCATGG - Intergenic
993432354 5:87847425-87847447 CTTTAAAAAAAAATGTAGCTTGG - Intergenic
995201440 5:109429251-109429273 TTCTATAGACAAGTTTAGCTTGG - Intergenic
995291216 5:110456781-110456803 CTCTTAAAACAAATGGTGCTGGG + Intronic
996384841 5:122900182-122900204 CTCAAAAAAAAAAAGTAGCTGGG - Intronic
996469452 5:123843298-123843320 TTCTAGAAACAAATGTAGATGGG + Intergenic
996819999 5:127615972-127615994 TTCAATAAACAAAAGTAGCCTGG + Intergenic
997533678 5:134599076-134599098 TTCTATAAAAAAAATTAGCTGGG - Intergenic
998581600 5:143382827-143382849 CACTAAAAACAAATGTCCCTGGG + Intronic
999488029 5:152019691-152019713 CTCAAAAAACAAAAGAAGCTAGG - Intergenic
999624538 5:153506511-153506533 CTCAATTAACAAATGGAGCTTGG - Intronic
1000016384 5:157281310-157281332 CTCTACAAACAAATGGATCTAGG - Intronic
1001618942 5:173065801-173065823 CTCTACAAAAAAAATTAGCTGGG - Intronic
1002650152 5:180685382-180685404 CCCTATAAACAAATCTATCTCGG + Intergenic
1004897245 6:20160705-20160727 CCCTACAAATAAATGTAGCTGGG + Intronic
1004929214 6:20445553-20445575 TTTTATAAACAAATGTAGAGGGG - Intronic
1006290301 6:33130075-33130097 CTCCTTAACCAAATGTTGCTTGG + Intergenic
1006312964 6:33274211-33274233 CTCAAAAAATAAATGTGGCTGGG - Intronic
1008018496 6:46548431-46548453 GTCCACAAACAAATGTAGCTTGG + Intergenic
1011309016 6:85960716-85960738 CTCTAGAAACAAAGGAACCTGGG + Intergenic
1012909024 6:105099023-105099045 CTCTACAAAAAAAATTAGCTGGG - Exonic
1013138124 6:107302432-107302454 CTCTATAAAAAAAATTAGCCAGG - Intronic
1014607934 6:123501011-123501033 CTCTACAAACAGATTTAGATGGG + Intronic
1014617078 6:123616182-123616204 CTCTACAAAAAAAATTAGCTGGG + Intronic
1016224984 6:141723883-141723905 CTCTATAAATCCATGTTGCTGGG + Intergenic
1017162162 6:151375477-151375499 ATCTACAAAAAAATGTTGCTGGG - Intronic
1017676305 6:156817467-156817489 CTCTATAAAAAAAATTAGCCAGG + Intronic
1017702623 6:157090291-157090313 TTTTATAAACAAAAGTAGCCAGG - Intronic
1018301520 6:162407848-162407870 CTCTCTAGAGAAATGTAACTTGG + Intronic
1023544383 7:41302372-41302394 CTTTTTCAACAAATGTTGCTGGG + Intergenic
1024692035 7:51813552-51813574 ATCTAGAAGCAAATGAAGCTGGG - Intergenic
1026902322 7:74044078-74044100 CTCTACAAAAAAATTTAGCCAGG + Intronic
1028104316 7:86859124-86859146 ATCTCTAAAAAAATTTAGCTGGG - Intronic
1028174030 7:87632025-87632047 CTCTATAAACAAAAATATTTTGG + Intronic
1030188407 7:106786641-106786663 CTCTCCAATCAAATGGAGCTAGG - Intergenic
1031835827 7:126680992-126681014 CTCTAAAAATAAATGTATTTTGG - Intronic
1031884628 7:127232996-127233018 CTCTAAATACAAAATTAGCTGGG - Intronic
1032406090 7:131656809-131656831 CTCCATGACCAAATGTACCTGGG - Intergenic
1033128429 7:138724973-138724995 TTCTAAAAACACATGTGGCTGGG + Intronic
1034376729 7:150651712-150651734 CTTTTTCAACAAATGTTGCTGGG - Intergenic
1035447640 7:158953582-158953604 CTCTACAAATAAACATAGCTGGG + Intronic
1035460856 7:159037869-159037891 ATCTATAGACATATGTAGGTGGG + Intronic
1035630071 8:1100600-1100622 CTCTATAAGAAAATGAAGGTAGG + Intergenic
1036734735 8:11302090-11302112 CTCTATGAAAAAATTTAGCTAGG + Intronic
1037061329 8:14513201-14513223 CTCTACAAAGAAAAATAGCTGGG - Intronic
1038042844 8:23740565-23740587 CTTTAAAAAGAAATGCAGCTGGG + Intergenic
1038796226 8:30712511-30712533 CTCTACAAAAAAAAGTAGCTGGG + Intronic
1039340841 8:36648134-36648156 CTCTGTGAAGAACTGTAGCTGGG - Intergenic
1041259585 8:56009339-56009361 CTCAATAAATAAATTTAGCATGG - Intronic
1041516597 8:58706395-58706417 CTTTTTAAACAAATGATGCTGGG - Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1042990205 8:74630929-74630951 CTCAATAAATATATGAAGCTGGG - Intronic
1043465531 8:80502825-80502847 CTATGTAAACAAATGAAGGTAGG + Intronic
1044315399 8:90744814-90744836 CCCTATTAATAAATGGAGCTGGG - Intronic
1044857253 8:96489196-96489218 CTCTTTAAAAATATGTAGCCAGG - Intergenic
1046199502 8:110905137-110905159 CGTTAAAAACAAATGTAGCAAGG + Intergenic
1046737696 8:117794568-117794590 CTCTATAAAACAATCTATCTTGG + Exonic
1048912724 8:139151499-139151521 CTCTATAAACAAATGGCTGTAGG + Intergenic
1050434056 9:5590745-5590767 CTAAATATACAAATTTAGCTGGG - Intergenic
1051893108 9:21963369-21963391 CCTTTTAAACAAATGTTGCTGGG - Intronic
1052315573 9:27113287-27113309 CTCTCTTAATAAATGAAGCTTGG + Intronic
1052527395 9:29636423-29636445 ATCTATAAACACATGAAACTCGG + Intergenic
1056613870 9:88144928-88144950 CTCTATAAATAAATTTGGATGGG + Intergenic
1056628258 9:88271998-88272020 CTCTACAAAAAAAACTAGCTGGG + Intergenic
1057236936 9:93368602-93368624 ATCTCTAAAAAAAAGTAGCTGGG - Intergenic
1059777928 9:117494622-117494644 CAATTCAAACAAATGTAGCTTGG - Intergenic
1059986551 9:119825618-119825640 CTCTATAAATAAAAGAAGCCTGG - Intergenic
1186368850 X:8926060-8926082 CTTTAAAAACAAACCTAGCTGGG - Intergenic
1186400435 X:9253712-9253734 CTACATAAAAAAATTTAGCTGGG + Intergenic
1187254085 X:17626117-17626139 CTCTATAACCACATATGGCTAGG + Intronic
1187517305 X:19983909-19983931 AAATATAAAAAAATGTAGCTGGG + Intergenic
1187694046 X:21900221-21900243 CTCTAAAAAAAAAATTAGCTAGG - Intergenic
1188164827 X:26848941-26848963 ATCTATAAACAAATTGAGCCTGG + Intergenic
1188242222 X:27807224-27807246 CTATAAAAACAAATGTAACTTGG + Intergenic
1188359413 X:29234064-29234086 CTCCATAAATAAATGCAGCGTGG + Intronic
1189262739 X:39689551-39689573 TTCGATACACAAGTGTAGCTCGG - Intergenic
1190863423 X:54364427-54364449 CTCTACAAAAAAAGTTAGCTGGG + Intergenic
1191951428 X:66597825-66597847 CTCTATAATCAAGTTGAGCTAGG + Exonic
1192595357 X:72401393-72401415 CTCTACAAAAAAAATTAGCTGGG - Intronic
1192798614 X:74444946-74444968 TTCCATGGACAAATGTAGCTGGG + Intronic
1193120357 X:77816997-77817019 ATCAATAAAAAAATGTATCTTGG + Intergenic
1195523767 X:105861596-105861618 GTCTTTTAACAAATGGAGCTGGG - Intronic
1200325204 X:155230842-155230864 CTCTACCAAAAAATTTAGCTGGG - Intronic
1201060494 Y:10039841-10039863 ATACATAAACAAATGAAGCTGGG - Intergenic
1201940276 Y:19451398-19451420 CTCTAAACAAAAATGTAGATTGG + Intergenic
1202379772 Y:24266054-24266076 CTTTGTTAACAAATTTAGCTGGG - Intergenic
1202491010 Y:25404067-25404089 CTTTGTTAACAAATTTAGCTGGG + Intergenic
1202578561 Y:26353982-26354004 CTTTCTGAACAACTGTAGCTGGG - Intergenic