ID: 1092387912

View in Genome Browser
Species Human (GRCh38)
Location 12:8050410-8050432
Sequence CAGGGAAGAGAGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3723
Summary {0: 1, 1: 1, 2: 32, 3: 422, 4: 3267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092387906_1092387912 0 Left 1092387906 12:8050387-8050409 CCTGCAGGAGCTACAGAACAGGG 0: 1
1: 0
2: 2
3: 33
4: 439
Right 1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG 0: 1
1: 1
2: 32
3: 422
4: 3267
1092387904_1092387912 8 Left 1092387904 12:8050379-8050401 CCTTCATGCCTGCAGGAGCTACA 0: 1
1: 1
2: 0
3: 19
4: 173
Right 1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG 0: 1
1: 1
2: 32
3: 422
4: 3267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092387912 Original CRISPR CAGGGAAGAGAGAAGGAGGA TGG Intronic
Too many off-targets to display for this crispr