ID: 1092388581

View in Genome Browser
Species Human (GRCh38)
Location 12:8054950-8054972
Sequence CAGAAGACACAGATGAACAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 466}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092388581_1092388583 3 Left 1092388581 12:8054950-8054972 CCCTTGTTCATCTGTGTCTTCTG 0: 1
1: 0
2: 2
3: 51
4: 466
Right 1092388583 12:8054976-8054998 ACTAGTCTCATGAAGAATTCTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1092388581_1092388585 16 Left 1092388581 12:8054950-8054972 CCCTTGTTCATCTGTGTCTTCTG 0: 1
1: 0
2: 2
3: 51
4: 466
Right 1092388585 12:8054989-8055011 AGAATTCTGGCGTGCAGCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 175
1092388581_1092388584 15 Left 1092388581 12:8054950-8054972 CCCTTGTTCATCTGTGTCTTCTG 0: 1
1: 0
2: 2
3: 51
4: 466
Right 1092388584 12:8054988-8055010 AAGAATTCTGGCGTGCAGCCAGG 0: 1
1: 0
2: 2
3: 12
4: 149
1092388581_1092388586 30 Left 1092388581 12:8054950-8054972 CCCTTGTTCATCTGTGTCTTCTG 0: 1
1: 0
2: 2
3: 51
4: 466
Right 1092388586 12:8055003-8055025 CAGCCAGGGTAGCTGAAGTTTGG 0: 1
1: 0
2: 1
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092388581 Original CRISPR CAGAAGACACAGATGAACAA GGG (reversed) Exonic
900002123 1:20346-20368 CAAAGGGCACAGTTGAACAATGG + Intergenic
900021844 1:190869-190891 CAAAGGGCACAGTTGAACAATGG + Intergenic
900106379 1:982975-982997 CCGAGGACACAGATGCAGAAAGG - Intergenic
903597713 1:24508485-24508507 CAGGAGAGAAAGATGAAAAAAGG + Intronic
904318900 1:29683842-29683864 CAGAAGACAAAAATGCACAAAGG - Intergenic
904423881 1:30410912-30410934 CAGAAGACTCACCTGATCAAAGG + Intergenic
905256256 1:36687437-36687459 AAGAAGACACAGACACACAAAGG + Intergenic
908424481 1:63992610-63992632 CAGAAGCCACTGGTGAACAGGGG + Intronic
909658921 1:78061157-78061179 AAGAAGACACAGGGAAACAAAGG - Intronic
909879061 1:80849309-80849331 CAGAAGACAAAGAGAAAAAAAGG + Intergenic
909991483 1:82227844-82227866 AGGAAGACAGAGAAGAACAAAGG - Intergenic
910135607 1:83965369-83965391 CAGAAGAGACAGAAGAACAAAGG - Intronic
910447492 1:87313511-87313533 CAGAAGACAAAGTTGAGCATAGG + Intergenic
911096997 1:94062756-94062778 GAGAAGACACAGAGGGACAAAGG + Intronic
911470781 1:98315843-98315865 CAGAAGAATCACTTGAACAAGGG - Intergenic
914084910 1:144444778-144444800 AACAAGACACAGATGAACTGGGG - Intronic
914940496 1:152018694-152018716 GAGAAGACAGAGATGAACACTGG + Intergenic
915444004 1:155964479-155964501 CTGAAGACAGAGATAAAGAAGGG + Intronic
915783523 1:158581331-158581353 CAGAAGACACAGTAGAAAAAAGG + Intergenic
916193209 1:162198847-162198869 CAGAAGCCACATATGAATAGTGG - Intronic
916219378 1:162428403-162428425 AAGAAGACCCAAATGAACAGAGG + Intergenic
916496157 1:165349222-165349244 CAGAAGAGACTGCTGAATAACGG - Intronic
916549840 1:165839716-165839738 CAGAAGAAACAGATTAAAAGTGG - Intronic
917261063 1:173170292-173170314 AAGAAGACAGAGAGGAAAAAAGG - Intergenic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
918240485 1:182616113-182616135 CAGAATACAGACAAGAACAAAGG + Intergenic
918508440 1:185283230-185283252 CATAAGACACAGAAGAACCTTGG + Intronic
918890397 1:190258836-190258858 CACAAGATAAAGCTGAACAAGGG + Intronic
918935228 1:190913036-190913058 CAGAAGTCAAAGAGGAAGAAAGG + Intergenic
919362915 1:196617408-196617430 ACAAAGATACAGATGAACAACGG - Intergenic
919550404 1:198978414-198978436 CATAAGAAACAAATGAAAAAGGG + Intergenic
921926565 1:220714889-220714911 CAAAAGATACAGATGAAGAGAGG + Intergenic
921952040 1:220940276-220940298 CCATAGACACAGATGAACCATGG - Intergenic
923367867 1:233280827-233280849 CAGAAGAAACAGATTTACAAAGG - Intronic
1063356578 10:5405252-5405274 CATAGGACACAGATGTAAAAAGG - Intergenic
1063482571 10:6388842-6388864 CAGAAGGCACAGCTCAGCAATGG - Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1065764676 10:29016908-29016930 CTCAAGACACAGATGTACTAAGG - Intergenic
1066090048 10:32008452-32008474 AACCAGACTCAGATGAACAATGG + Intergenic
1066643805 10:37584493-37584515 CAAAAGACACAGTTTAAAAATGG + Intergenic
1067432151 10:46251814-46251836 TGGAAGCCACAGATGGACAAGGG - Intergenic
1068057357 10:52027573-52027595 AAGTAGACACACATAAACAATGG + Intronic
1068637296 10:59361886-59361908 CAGAAGACAAACATGACAAAGGG + Intronic
1068767152 10:60776381-60776403 CAGAAGTGACATTTGAACAAAGG - Intergenic
1070486828 10:76939596-76939618 CAGAACACAAAGGTGACCAAAGG - Intronic
1071380230 10:85052146-85052168 CAGATGACTCAGAAGAGCAAAGG - Intergenic
1073586727 10:104717561-104717583 GAGAAGACACTCATAAACAAAGG - Intronic
1074559614 10:114523382-114523404 CAGGACACATAGATCAACAAGGG + Intronic
1074606579 10:114975839-114975861 CAGAAGAAAGAGATCAATAATGG - Exonic
1076210361 10:128636717-128636739 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1076873921 10:133206757-133206779 CAGAAGGAAAAGAGGAACAAAGG + Exonic
1077094654 11:794199-794221 GAGAAGAGACAGATGTACCATGG + Intronic
1077201030 11:1307656-1307678 CAGGAGACTCAGAGCAACAAGGG - Intronic
1078323243 11:10355947-10355969 CAGAAGACACAGTTAAACTGTGG - Intronic
1078831113 11:14978019-14978041 CAGAAGAGACAGGAGAAGAAGGG + Intronic
1079896575 11:26126760-26126782 CAGAAGGCAAAGGTGAAGAAAGG + Intergenic
1080439214 11:32275422-32275444 CAGAAGAAACAGCTGATCATGGG - Intergenic
1081011950 11:37824371-37824393 CAGAAGAGACACTTGAAAAAAGG - Intergenic
1081779206 11:45698488-45698510 TAGAAGACAGAGAAGAAAAAGGG + Intergenic
1081828511 11:46083407-46083429 CAGACTACTCAGATAAACAAAGG + Intronic
1082864644 11:57887550-57887572 AAGAAGACACAGATAACCTATGG + Intergenic
1082869644 11:57932153-57932175 CAGAAGCAACAGATGAAAAAAGG - Intergenic
1083034871 11:59627778-59627800 GAGAAGAGACAGATGTGCAAAGG - Intergenic
1083356130 11:62067594-62067616 GAGAAGACACAGAGACACAAAGG - Intergenic
1085101696 11:73806064-73806086 CAGAAGACAAAGGTAAACTAGGG - Intronic
1085157277 11:74307318-74307340 CAGAGGACACTGAGGCACAAAGG + Intronic
1085350631 11:75796075-75796097 CTGAAGACTGAGAGGAACAAGGG + Intronic
1086568914 11:88260824-88260846 AAAAAGACAAAGATGAACAAGGG - Intergenic
1088039171 11:105355840-105355862 CAGAAAACTCAGATTAAGAAGGG - Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1088703668 11:112439952-112439974 CAAAAGCCACAGACGAAAAAAGG - Intergenic
1089812115 11:121140757-121140779 CAGAAGACACAGAGGGAAAGAGG - Intronic
1090453491 11:126827268-126827290 CAGAAGACTCACTTGAACATGGG - Intronic
1090485791 11:127110855-127110877 CAGCAGACACAGATATAAAAGGG - Intergenic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1091064672 11:132498308-132498330 AAGAAAAAACAGATGACCAATGG - Intronic
1091375187 12:20381-20403 CAAAGGGCACAGTTGAACAATGG + Intergenic
1091407709 12:219734-219756 CAGAAGACCCATCTGAACAAAGG + Intergenic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1093087324 12:14880882-14880904 CAGTATACACAGTGGAACAAAGG + Intronic
1093473597 12:19531450-19531472 AAGGAGAGACAGAAGAACAAAGG - Intronic
1093772889 12:23037945-23037967 TAGAAGAAAAAGATGAACACTGG - Intergenic
1094504570 12:31050785-31050807 CTCATGACACAGATGAAGAAAGG - Intergenic
1094817162 12:34199464-34199486 CAGAACACACATATGCACCATGG + Intergenic
1095099858 12:38169250-38169272 CAGAACACACATATGCACCATGG - Intergenic
1095341326 12:41092480-41092502 CAGAAGACACAGGTAAATGAAGG - Intergenic
1095796241 12:46221930-46221952 CAGAAGACAGAGATGAGACAGGG + Intronic
1096021335 12:48328191-48328213 CAGAAGAGGTAGATGAACAAGGG - Intergenic
1096088123 12:48880004-48880026 CAGAAGACACAGGTGATACAGGG - Intergenic
1096426830 12:51511069-51511091 CAACATTCACAGATGAACAATGG - Exonic
1096528605 12:52229574-52229596 CAGGAGACACTGCTGACCAAAGG + Intergenic
1097167481 12:57093496-57093518 CAGCAGACACTGATGGACGAGGG + Exonic
1097445201 12:59662078-59662100 CAGAAAACACAAAAAAACAAAGG - Intronic
1098258086 12:68638042-68638064 GATAAAACACAGTTGAACAATGG - Intronic
1098377701 12:69835568-69835590 CAGAACACAGATAGGAACAAGGG - Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1099246408 12:80198022-80198044 CAGAAAACAAAGAGGAAGAAAGG - Intergenic
1100344741 12:93717274-93717296 CAGAGGACACATATGATAAAGGG - Intronic
1101554602 12:105797038-105797060 AAGAAGGGATAGATGAACAAAGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1103458941 12:121088792-121088814 CAGAAGCCACACATGAATGATGG - Intergenic
1104518677 12:129452640-129452662 CAGAAGCCATGGATCAACAAAGG - Intronic
1104771081 12:131365185-131365207 AAGAAGACACACAAAAACAATGG + Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107193318 13:37617008-37617030 CAGAAGACAAAGCAGAACCAAGG - Intergenic
1107237400 13:38188928-38188950 CAGAAGCCACAGATAATTAAAGG + Intergenic
1109062757 13:57639131-57639153 CAGAAGGCACAGAGTAAGAAAGG - Intronic
1109174119 13:59134237-59134259 AAGAAGACACAGAAGCACCATGG - Intergenic
1109266484 13:60206491-60206513 TAAAACACACAGATGCACAATGG - Intergenic
1109880767 13:68471736-68471758 CAGAAGGCAAAGATGGACAAAGG - Intergenic
1110423691 13:75341138-75341160 CAGAAGACACACGTGCACATCGG - Exonic
1110634544 13:77751549-77751571 GAGAAGGAACAAATGAACAAGGG - Intronic
1110659144 13:78038271-78038293 CACAAGACAGTGTTGAACAAAGG - Intergenic
1111115082 13:83765024-83765046 CAGAAGAATCACTTGAACAAGGG + Intergenic
1111223304 13:85235567-85235589 CAAAAGACACAGAATAACCAAGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111801009 13:92980840-92980862 CAGAAGACAGAGAGGAAAAAAGG - Intergenic
1112883797 13:104143813-104143835 CAGAAAACACAGGTGATTAACGG + Intergenic
1113859262 13:113470763-113470785 CAGAAGACACAACTCCACAAGGG + Intronic
1114657938 14:24327272-24327294 CAGGAGACACCCTTGAACAAAGG + Intronic
1114671058 14:24411317-24411339 CAGAAGACAGAAATGGTCAAGGG - Intronic
1114797473 14:25732641-25732663 CAGAACACCCAAATGAACAGTGG - Intergenic
1117372611 14:55092452-55092474 GAGAAGACAGAGATGAGAAACGG + Intergenic
1118250518 14:64155935-64155957 CCGAAGATACAGATCAAAAATGG - Intronic
1118594163 14:67423152-67423174 CAGAAGACACTGATGATGACAGG - Intergenic
1119061113 14:71475731-71475753 CATAGGACACAGCTGAAAAAGGG + Intronic
1119543574 14:75456328-75456350 CAGAACACGGAGATGAAGAAGGG - Intronic
1119948776 14:78722954-78722976 CAGAAGGAACAGATGTATAAAGG + Intronic
1120726148 14:87943769-87943791 CAGACAACAGAAATGAACAAGGG + Intronic
1120929682 14:89836140-89836162 GAGAAAACACAGATGGTCAAGGG + Intronic
1121607442 14:95251770-95251792 CAAAAGAGACAGTTGAACAATGG - Intronic
1122341397 14:101030817-101030839 CAACAGACAGAGATGAGCAACGG - Intergenic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1124797058 15:32792053-32792075 CAGAAGAAACAGAGGAACTAAGG + Intronic
1124954868 15:34353770-34353792 CAGAACACACAGCTGATGAATGG + Exonic
1125448078 15:39779379-39779401 CAGAAAATACAGATAAGCAAGGG - Intronic
1125497547 15:40211247-40211269 AAGAAGAAACAGATGACAAAGGG - Intronic
1125672120 15:41481161-41481183 CAGAAGAGAAAGATGAAGAGAGG - Exonic
1125913504 15:43463433-43463455 AAGAAATAACAGATGAACAAGGG + Intronic
1126556356 15:49992303-49992325 GAGAAGACAGACTTGAACAAGGG - Intronic
1126724728 15:51621166-51621188 CATAAAACACAGATGACAAAAGG + Intronic
1127119999 15:55763256-55763278 CAGAAGAATCAGATGAACCCGGG + Intergenic
1127750458 15:62035832-62035854 CTCATGACACAGATGAACTATGG + Intronic
1128532972 15:68467535-68467557 CAGGAGCCACAGCTGAAAAAAGG - Intergenic
1129146746 15:73655025-73655047 GAGAAAAAACAGATTAACAAGGG - Intergenic
1129626136 15:77201957-77201979 CAGATGAATCAGATGCACAAAGG - Intronic
1131069970 15:89460038-89460060 CAGAAGACTAAGATAACCAAGGG - Intergenic
1132451388 15:101970593-101970615 CAAAGGGCACAGTTGAACAATGG - Intergenic
1132477622 16:149191-149213 AAGAAGCCCCAGATGAGCAAAGG + Intergenic
1132927665 16:2439704-2439726 CCCAAGACACAGTTGTACAAAGG + Intronic
1133159777 16:3903250-3903272 CAGTAGCCAGAGATGAGCAAAGG + Intergenic
1134741056 16:16545873-16545895 GAAAAGACAAAAATGAACAAAGG - Intergenic
1134926442 16:18166250-18166272 GAAAAGACAAAAATGAACAAAGG + Intergenic
1135261529 16:20985002-20985024 CAAAACACCCAGAAGAACAAGGG + Intronic
1136081413 16:27854688-27854710 AAGTGGACACAGATGAACACAGG - Intronic
1137903608 16:52296042-52296064 CAGAAGACAAAGGGGAAAAAAGG - Intergenic
1138246894 16:55474341-55474363 CAGAACACACACATTTACAAGGG + Intronic
1139372722 16:66478885-66478907 CAGAGGGCACAGATGAGCAAAGG + Intronic
1140133540 16:72185002-72185024 AACAGGACACAGATGAAGAAAGG - Intergenic
1140694630 16:77520491-77520513 CAGAAGATACTAATGAACAAAGG + Intergenic
1141593269 16:85082532-85082554 CAGCAGAAACAGGTAAACAAAGG - Intronic
1142360388 16:89623490-89623512 CAGAAGGTCCAGATGAACAATGG + Intronic
1142437940 16:90074932-90074954 CAGAAGATTCCGATGAAGAATGG - Exonic
1143159687 17:4861014-4861036 CAGAAGAAGCTGAGGAACAAGGG - Intronic
1143426391 17:6842497-6842519 GATAAAACACAGATTAACAAAGG + Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144507982 17:15849587-15849609 CAGAAGTGACAGATCAACACAGG - Intergenic
1145172106 17:20667219-20667241 CAGAAGTGACAGATCAACACAGG - Intergenic
1146441334 17:32897723-32897745 TAGAAGTGACAGATGAACAGTGG + Intergenic
1147549003 17:41424937-41424959 CAGGAGACACAGAGAACCAATGG + Intergenic
1148132445 17:45270356-45270378 CAGAAGACAGAGGTGGACAGAGG - Intronic
1148765199 17:50034847-50034869 CAGAAGAATCACTTGAACAAGGG - Intergenic
1148824045 17:50379034-50379056 CAGAAGATACAGAAGAAGACTGG - Intronic
1149003910 17:51784496-51784518 CGGAAGACAGAGATAAACAGAGG - Intronic
1149226256 17:54474585-54474607 CAAAAGACACAGTTTAAGAAAGG - Intergenic
1149826986 17:59837655-59837677 CAGAAGTCAGTGATTAACAAAGG - Intronic
1150577118 17:66440342-66440364 GAGAAGAAACAAATGAACATTGG - Intronic
1150930435 17:69578992-69579014 CAGAACACAGACATGAAGAATGG - Intergenic
1151157474 17:72135925-72135947 CAGATAACACAGGTGAACATTGG - Intergenic
1152442474 17:80317469-80317491 GAGAGGACAGAGAAGAACAAGGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156820019 18:41361045-41361067 CAAAACACACATATAAACAATGG - Intergenic
1157428450 18:47603626-47603648 AAGAACACACAGATGATAAATGG + Intergenic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158820650 18:61154802-61154824 GAGAACACACAAGTGAACAAGGG - Intergenic
1158983531 18:62789581-62789603 GAGAAGACACTGATGAAGAATGG - Intronic
1159135157 18:64328963-64328985 CAGAAGACAGAGCTTAACAGTGG + Intergenic
1159254154 18:65924034-65924056 CAGGATACACATATGAACAATGG + Intergenic
1159423337 18:68251284-68251306 CAAAAGCCACAGTTGACCAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159925279 18:74263573-74263595 CAGAAGACACAGATGACAACAGG + Intronic
1160633876 19:61954-61976 CAAAGGGCACAGTTGAACAATGG + Intergenic
1161808226 19:6457432-6457454 CAGAAGACAGAGATGGCCAAGGG + Intronic
1162693311 19:12451317-12451339 CAGAAGAACCAGGTTAACAATGG + Intronic
1163195057 19:15712869-15712891 CAAAAGACACAGAAGAAAATTGG + Intergenic
1163261914 19:16196123-16196145 AATGAGACACAGATGAACTAGGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166585603 19:43945332-43945354 CAGAAGACAGAGCTGGAGAAGGG - Intergenic
1167602307 19:50461461-50461483 CACAAGACACAGACGAAAGAAGG - Intronic
925159100 2:1670733-1670755 GACAAGACACAGATCAACACAGG + Intronic
925236360 2:2281221-2281243 CAGAAGGCAAAGCTGAAGAAAGG - Intronic
925273822 2:2635136-2635158 CAGAGGACACAGCTGAACCATGG - Intergenic
926874527 2:17460183-17460205 CAGAAGCCTCAGATGAATGATGG + Intergenic
926899985 2:17740245-17740267 TAGGAGAAACAGATGGACAAGGG - Intronic
927378753 2:22452422-22452444 CATAAGACAGTGATGAACGAAGG + Intergenic
927719089 2:25371883-25371905 CAGTAAACAGAGTTGAACAAGGG + Intergenic
928367906 2:30716849-30716871 CAGAAGTCTGAGATGAACAGAGG + Intergenic
928415352 2:31087160-31087182 CAGAAGACACAACTTGACAAAGG + Intronic
929276417 2:40030361-40030383 AAGAAGACACAAATGATTAATGG + Intergenic
929433854 2:41911684-41911706 CAGCAGACACAGAATAGCAATGG - Intergenic
929514421 2:42593589-42593611 CAAACCACACATATGAACAACGG - Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
931439852 2:62281116-62281138 CAGAATCCACAGAAAAACAATGG - Intergenic
932098811 2:68877651-68877673 CAGATGACACTGAAGTACAAAGG + Intergenic
935375999 2:102398190-102398212 CAAAAGAGGCAGATGCACAATGG - Exonic
935806717 2:106756105-106756127 CAGTAGACAAATATGAAAAATGG + Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936490917 2:112971410-112971432 CAGAGGAGACAGATGAACTCTGG + Intergenic
936567601 2:113593061-113593083 CAAAGGGCACAGTTGAACAATGG - Intergenic
937198063 2:120177658-120177680 CAGGAGACACTGCTGAACAGAGG + Exonic
937522944 2:122734034-122734056 AACAAGACACAGATTTACAAAGG - Intergenic
937599323 2:123711038-123711060 CAGAAGAAACACATGTACTATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938463330 2:131511668-131511690 CAGAAGAGACAGAAGAGCAGAGG - Intergenic
938897585 2:135767540-135767562 CAAAATACAAAGCTGAACAAAGG - Intronic
938992730 2:136645908-136645930 AAGAAGTCACTGATGATCAAAGG - Intergenic
939173345 2:138721382-138721404 CAGAAGACTGAGAGGAACACAGG + Intronic
939198127 2:138998767-138998789 GAGAAGACACAGATAAGAAAGGG + Intergenic
939654175 2:144802155-144802177 CAGAAATCACAGATGAGCCAAGG + Intergenic
939689867 2:145244856-145244878 CAAAAGACCCAGATGGACAGAGG - Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
940867200 2:158829352-158829374 CAGGAGACACAGCTGCAAAAGGG + Intronic
941208296 2:162602551-162602573 CAGAGGAAACAGATGTGCAAAGG - Intronic
941234615 2:162955085-162955107 AATAAGACAAAGAAGAACAAAGG - Intergenic
941886305 2:170531072-170531094 CAGCAGACACAGATCCAGAAAGG - Intronic
942722756 2:178971113-178971135 CAGAAGAATCACTTGAACAAGGG + Intronic
943401753 2:187421080-187421102 CAGATGACAAAGATGAATATAGG - Intronic
944189416 2:196985268-196985290 CAGAAGACCCAGCTAAACTAGGG + Intronic
944342483 2:198619043-198619065 CAGATGACACAGTTTAACAGCGG - Intergenic
944782270 2:203031917-203031939 CTGATCACACAGATCAACAATGG - Intronic
945237613 2:207646302-207646324 AAGAAGACCCAAATGAAAAAGGG + Intergenic
945267994 2:207910357-207910379 CACATGACACAAATGATCAAGGG + Intronic
945692994 2:213065224-213065246 CAGAAAACACTCATGAAAAAAGG - Intronic
945752308 2:213803468-213803490 CAGAAGAGACAGAAAGACAATGG - Intronic
945772643 2:214063480-214063502 CAGGAGAAACAGGTCAACAATGG + Intronic
948046555 2:234950676-234950698 CAGGAGACACAGGTGGACAGAGG - Intergenic
948356307 2:237380587-237380609 CAGTAGAAACAGAAGAACACAGG + Intronic
948997077 2:241586738-241586760 AATTAGACACAGATGAAGAAAGG + Intronic
1168884018 20:1232256-1232278 CAGGAGACACAGATGATGTAGGG + Intronic
1169314620 20:4579427-4579449 GAGGTGACACTGATGAACAAAGG + Intergenic
1169322130 20:4641666-4641688 CAGTGGACACAGCTCAACAACGG + Intergenic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1170182627 20:13549308-13549330 GAGAAGACACAGCTGAACCAAGG + Intronic
1170239517 20:14148204-14148226 CAGACCACACATATAAACAAAGG - Intronic
1170287091 20:14721647-14721669 CAGAAGAAACCTATGAAGAAAGG - Intronic
1170461717 20:16583292-16583314 CAGAAAACACACCTAAACAAGGG - Intergenic
1172134017 20:32675214-32675236 CAGAAGACACAGAGACCCAAGGG - Intergenic
1172222599 20:33283996-33284018 CAGAAGACAGAGCTGAACCCCGG - Intronic
1172354162 20:34268172-34268194 CAGTAGCCACAGATGACCAGTGG + Intronic
1172370524 20:34386579-34386601 CAGAAGACACAAAAAAACTAAGG - Intronic
1172470442 20:35189804-35189826 AAGGATACAAAGATGAACAAGGG - Intergenic
1172820944 20:37733590-37733612 CAGAGGACACAGAAGTCCAAAGG - Intronic
1172990227 20:39030415-39030437 CAGAAGATACACATAAACATAGG + Intronic
1173078677 20:39845455-39845477 CAGAGGAAACAGATGTGCAAAGG + Intergenic
1173639703 20:44592332-44592354 CAGAGGACACAGAGGAATCAAGG + Intronic
1174221066 20:48956039-48956061 CAGAAGAGGGAGTTGAACAAGGG + Intronic
1175722792 20:61297517-61297539 CCCAAGACACAGATGGACCATGG - Intronic
1175880926 20:62258554-62258576 CAGAAAATACAGATGAGCAAAGG - Intronic
1176077965 20:63257315-63257337 CAGAGGACAGTGATGGACAATGG + Intronic
1176225337 20:63994926-63994948 CAGAAGTCACAGAAGAAGAGTGG + Exonic
1176656433 21:9592282-9592304 CCAAAGACACACATGAACACGGG + Intergenic
1176992259 21:15511477-15511499 TAGAAGAAACAGATGAAAAATGG - Intergenic
1177374897 21:20257507-20257529 CAGAAGACACAAGTGCAAAAAGG + Intergenic
1177530938 21:22356952-22356974 CAGAAAACACACATGATGAAAGG - Intergenic
1177752255 21:25298743-25298765 CAGAACACACAGAAGAAGTAGGG + Intergenic
1178408319 21:32343920-32343942 CACAACACACAGAGAAACAAAGG + Intronic
1179278740 21:39915692-39915714 CAGAAAACAGATATGAACAGAGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1181329115 22:22075330-22075352 CTGCAGACACAGATGCACATGGG - Intergenic
1181416419 22:22762613-22762635 AAGATGAGACAGATGAAAAATGG - Intronic
1182418363 22:30235971-30235993 CCGCAGACACAGACGAGCAATGG - Intergenic
1183751676 22:39724414-39724436 CAGAAGAGGCAGGAGAACAAGGG + Intergenic
1184035608 22:41916486-41916508 GAAAAAACACAGATGAACAAAGG + Intergenic
949486778 3:4547396-4547418 CACAAGACACATGTGAAGAACGG - Intronic
949601987 3:5610244-5610266 CAGAAAACAGAAATTAACAAGGG - Intergenic
949756921 3:7422763-7422785 AATAAAACACAGAAGAACAATGG - Intronic
952929014 3:38345569-38345591 CAGAAGAATCAGTTGAACCAGGG + Intergenic
953210951 3:40874761-40874783 CATAAGAAAAAGATGAACCAAGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
957086066 3:75678266-75678288 CAGAACACACATATGCACCATGG - Intergenic
957153300 3:76514417-76514439 CTGAAGACTCAGCTGAATAAAGG - Intronic
957214248 3:77298759-77298781 CAGGAGGCACAGATGAATGAAGG - Intronic
957428681 3:80072732-80072754 CAGAAGACAGTGATGGAAAATGG - Intergenic
957842501 3:85689845-85689867 CAGAAGACATACATGAAATATGG + Intronic
958665554 3:97132707-97132729 GAGAATACAAAGCTGAACAAAGG + Intronic
958900985 3:99886575-99886597 TAGAACAAACAAATGAACAAAGG + Intronic
959175224 3:102900755-102900777 CTAAAGTCACAGATGAAAAAAGG - Intergenic
959780684 3:110229512-110229534 CAGAAGATCCAGAGGAAGAAGGG - Intergenic
960611716 3:119560610-119560632 AACAAGACACAGGTGAAGAAGGG - Intergenic
960623406 3:119657768-119657790 AAGAAGAAACAGATGATAAAGGG - Intronic
961371057 3:126431954-126431976 AATAAGAAACAGATGCACAAGGG - Intronic
961415038 3:126750922-126750944 AAGAAGGCACAGCTGAGCAAGGG + Intronic
962342161 3:134594886-134594908 CAGAGGACACAAATGCACACAGG - Intergenic
962546867 3:136445352-136445374 CAAGAGTCAAAGATGAACAATGG + Intronic
962938248 3:140101504-140101526 CAAAAGACACAAATGAACAAAGG - Intronic
963097968 3:141565635-141565657 CAGAAGACAAAGAAGAGTAAAGG - Intronic
963795298 3:149625425-149625447 CAGAAGGCAGGGATGAAAAAGGG - Intronic
965701708 3:171464891-171464913 CAAAAGACAATGATAAACAAAGG + Intergenic
967615946 3:191566769-191566791 CAGTAGACAAAGATGTATAAAGG - Intergenic
967879063 3:194286438-194286460 GAGAAAACACTGTTGAACAAGGG - Intergenic
968027456 3:195454356-195454378 CAGAAGACTCACTTGAACACAGG + Intergenic
968048997 3:195641311-195641333 CAGAGGAAAAAGAGGAACAAAGG - Intergenic
968305623 3:197648622-197648644 CAGAGGAAAAAGAGGAACAAAGG + Intergenic
969502247 4:7560161-7560183 CAGAACAAACAGATCAATAAAGG - Intronic
969869363 4:10095089-10095111 CAGAAGGCGCAGATGAAGACAGG + Intronic
969904812 4:10383961-10383983 CAGAAGGCAAGGAGGAACAAAGG - Intergenic
970124125 4:12790225-12790247 TAGAATAAAAAGATGAACAAAGG - Intergenic
971037918 4:22715275-22715297 AAGAAGACACAGAGACACAAGGG + Intergenic
972112570 4:35583324-35583346 CTGAAAAAACTGATGAACAAAGG - Intergenic
972128194 4:35796992-35797014 AAGAAGACACACATGAAACAAGG + Intergenic
972812616 4:42607224-42607246 CAGAATACAGAAATGAAGAAAGG + Intronic
972895751 4:43617797-43617819 CAGAAAACATAGAAGAACAAGGG + Intergenic
974637912 4:64589601-64589623 CAGAAGACTCAGAAGAAAACAGG + Intergenic
975534004 4:75429646-75429668 CAGAAGACAGAGATCTACAGGGG + Intergenic
976670552 4:87647982-87648004 GAGAAGACACAGATAAATATGGG - Intergenic
976729371 4:88246337-88246359 AAGGATACACTGATGAACAAAGG - Intergenic
977224219 4:94375372-94375394 CAGAAGAGACTGATGAGCAGTGG - Intergenic
977451202 4:97200550-97200572 CAAAGGACATATATGAACAATGG - Intronic
977651053 4:99469826-99469848 CAGAAGACACAGACATCCAAAGG + Intergenic
977689574 4:99891740-99891762 TAGAAGAAACAGATGACCAAGGG + Intronic
978329405 4:107596454-107596476 CAGAAAATACATATGAACTAGGG + Intronic
978435740 4:108682376-108682398 AAGAAGAGACAGATGAACTAAGG + Intergenic
978514132 4:109553312-109553334 TAGAAGACACTGATGAAGAAGGG - Intergenic
981584002 4:146280815-146280837 CAGAAGCCAAATATGATCAAGGG + Intronic
982186529 4:152807592-152807614 AAGAAAACACAAATGAAAAATGG - Intronic
983554572 4:169048292-169048314 AAGAAGACACAACTGAAGAAGGG + Intergenic
984375773 4:178926955-178926977 AAGAAGACATAGAGGAACCAGGG - Intergenic
984496829 4:180508685-180508707 CAGTAGACACAGCTATACAATGG - Intergenic
984641462 4:182168847-182168869 CAGAAGATATAAATGAAAAATGG - Intronic
984812782 4:183809489-183809511 CAGAAGAATCACTTGAACAAGGG - Intergenic
985377089 4:189353226-189353248 AGGAAGACACATACGAACAATGG - Intergenic
985443954 4:190009273-190009295 CAGAACACACATATGCACCATGG + Intergenic
985742647 5:1627814-1627836 CAGAGGAAAAAGAGGAACAAAGG + Intergenic
986116104 5:4776369-4776391 GAGACGACAGAGATGCACAATGG - Intergenic
986165370 5:5267961-5267983 TAGGAGACACGGATGAACCATGG + Intronic
986419337 5:7562683-7562705 CAGACGACATTGATGAACACAGG + Intronic
986988214 5:13522779-13522801 CAGAACACACACATGTAGAAAGG - Intergenic
987863155 5:23509989-23510011 CAGAAGATTCTGATGAAGAATGG + Exonic
988002085 5:25361932-25361954 CAGAAGACAAGGAAAAACAAAGG + Intergenic
988123036 5:26992413-26992435 GTGAAGACACAGCAGAACAATGG + Intronic
988752096 5:34198147-34198169 CAGAAGAAACAGTTGAACCCAGG + Intergenic
988863599 5:35310138-35310160 CAGAAAACAAAGACAAACAAGGG + Intergenic
989228493 5:39058973-39058995 CTGAAGACACAGAAGAGAAATGG + Intronic
990607022 5:57421252-57421274 CAAAAGACAAAGACTAACAAAGG - Intergenic
990846465 5:60145864-60145886 CACAAGATACCTATGAACAAAGG - Intronic
991218622 5:64185855-64185877 CATAAGTAACAGATGAACAAAGG + Intronic
992553954 5:77885298-77885320 GGGAAGACAAAGATGAAAAAGGG + Intergenic
992720108 5:79552119-79552141 GAGGAGAAAAAGATGAACAAAGG + Intergenic
992853535 5:80836491-80836513 GAGAACACACAGAGGAATAAAGG + Intronic
993461900 5:88192349-88192371 CAGAAGACATATATGTAAAAAGG + Intronic
993477680 5:88385152-88385174 CAGAAGAAGAAGATGACCAAAGG - Intergenic
993643981 5:90440199-90440221 AGGAAGACACAGGTGAACCAGGG + Intergenic
994244703 5:97466702-97466724 CTGAAGAGAGAGAGGAACAAAGG - Intergenic
995217550 5:109612961-109612983 TAGAAAATACAGATGAATAAAGG - Intergenic
995934947 5:117499416-117499438 ATGAAGACACAGGTGAACTAGGG - Intergenic
996429608 5:123358261-123358283 GAGAAGACACAGTTGAGAAAGGG + Intronic
996861665 5:128073966-128073988 AAGAAGAAACAGATGCAGAAAGG + Intergenic
997830960 5:137149431-137149453 CATAAGACATTTATGAACAAAGG + Intronic
998410958 5:141910769-141910791 GAGAAGACACAGAGGAGAAAAGG - Intergenic
998563468 5:143193968-143193990 TAGACTCCACAGATGAACAAGGG + Intronic
999954403 5:156684966-156684988 CAGAAGAGAAAGAAAAACAAAGG + Intronic
1000108717 5:158086412-158086434 CAGCAGGGATAGATGAACAAAGG - Intergenic
1000198964 5:158988673-158988695 AAGCAGACTCAGAAGAACAATGG - Intronic
1000288254 5:159846465-159846487 CACAAGATCCAGATGAACCATGG + Intergenic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1000876799 5:166649583-166649605 CAGAAGAATCAGTTGAACCAGGG + Intergenic
1001774527 5:174319095-174319117 CAGATGACAAAGATGAAACAGGG - Intergenic
1002668829 5:180848482-180848504 CATAAAACACAGATGAGGAAAGG - Exonic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1002951968 6:1822604-1822626 TAGATGACAAAGATGAAAAAAGG + Intronic
1005922823 6:30416625-30416647 CAGAGGACCCAGGTGAAAAAAGG + Intergenic
1006140698 6:31927893-31927915 AGGAAGACACAGATGAGAAAAGG - Intronic
1007492723 6:42236473-42236495 CAGAACTCACAGATCAACAGAGG + Intronic
1007670981 6:43553571-43553593 CAGAAGACACAGAGAGACAATGG + Intronic
1009210719 6:60860099-60860121 CACAAGACAAAAATGAATAAAGG + Intergenic
1010196236 6:73242361-73242383 GAGAAGACAAGGATGAAGAAGGG + Intronic
1010292517 6:74154437-74154459 TAGAAGACACATTTGTACAAAGG - Intergenic
1010451659 6:76010835-76010857 CAGTAGAGACAGATGAAAAAAGG - Intronic
1010620483 6:78068116-78068138 CAGAAGACAAATATTAACATGGG - Intergenic
1010846358 6:80713609-80713631 TGGAAGGCAAAGATGAACAATGG + Intergenic
1011312337 6:85993710-85993732 CACTAGACACAGATGCAAAAGGG - Intergenic
1011986378 6:93451773-93451795 CAGAAGGGACTGTTGAACAAAGG - Intergenic
1012493476 6:99808986-99809008 CAGATAACACGGATGGACAATGG + Intergenic
1012842122 6:104342574-104342596 AAGAAGACACAAATGACAAATGG + Intergenic
1013093995 6:106927664-106927686 CAGAAGGCAAAGAAGAACAATGG - Intergenic
1014042282 6:116842511-116842533 TGGAAAACACAGATGATCAAAGG + Intergenic
1014771325 6:125460436-125460458 CAGAAGACATATTTGAATAAGGG - Intergenic
1015357527 6:132296564-132296586 CAACAGACTCAGATAAACAAGGG + Exonic
1015500361 6:133926153-133926175 CAGAAGACCCAGTAGAAAAATGG - Intergenic
1016291806 6:142535565-142535587 CAGGAGACAGAGAAGAGCAAAGG - Intergenic
1016325931 6:142901038-142901060 CAGAATACGAAGATGAGCAACGG - Intronic
1016794316 6:148101571-148101593 CTGAAGGCACAGATGATCATTGG + Intergenic
1016814467 6:148290774-148290796 CAGCAGATAAACATGAACAAAGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017196434 6:151705466-151705488 AAGATGACTCAGATGTACAAAGG + Intronic
1018080435 6:160255078-160255100 CAGGAGAGACACATTAACAAGGG - Intronic
1018860732 6:167709094-167709116 CACAACAGACAGATGGACAAAGG + Intergenic
1019137209 6:169917618-169917640 CATAACACACAGATGCACATGGG - Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1022279732 7:28895242-28895264 CAGAAGGCTCAGATGATCATTGG - Intergenic
1022318340 7:29264713-29264735 CAGCAGACAAACGTGAACAAAGG - Intronic
1022478117 7:30725174-30725196 CAGAAGACACAGACACACAGCGG + Intronic
1023497229 7:40810706-40810728 CAGAATAAACAGATGACCTATGG - Intronic
1024056785 7:45664525-45664547 GAGAACACAAAGATGCACAAGGG + Intronic
1024666382 7:51551159-51551181 CAGAAGACACTGGGGAACATTGG - Intergenic
1026358983 7:69585417-69585439 CAGAAGACACAGTGGGACCAGGG - Intergenic
1026443474 7:70463726-70463748 CAGCAAACACACAAGAACAAAGG - Intronic
1026525302 7:71148047-71148069 GGAAAGACAGAGATGAACAAGGG - Intronic
1026946973 7:74322707-74322729 CAAAAAACAAAGATAAACAATGG - Intronic
1028004474 7:85546167-85546189 CAAAGGACACAGAGGAAAAAGGG - Intergenic
1028078139 7:86540054-86540076 AAGAAGACACAGGTTAAAAATGG + Intergenic
1028266412 7:88732201-88732223 CAGAAGACACAAAAGAAAAAAGG - Intergenic
1029912617 7:104170813-104170835 CTGAAGACAGAAAAGAACAATGG - Intronic
1031474075 7:122201981-122202003 AAGAACACAAACATGAACAAGGG + Intergenic
1031692882 7:124812651-124812673 CTGAAAGCACAGATGAACACAGG - Intergenic
1032428730 7:131843293-131843315 CAGAACTCACAGAGGAATAAAGG + Intergenic
1033786844 7:144742241-144742263 CAGAAATGACAGATGATCAATGG - Intronic
1034454866 7:151163460-151163482 CAGTAGCCACAGGTGAACAGTGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034775767 7:153825197-153825219 TAGAAGACACAGACGAGCACAGG - Intergenic
1034877272 7:154736144-154736166 AAGAAAACTCAGATGAACATAGG - Intronic
1035009531 7:155701778-155701800 CAGAAGACTCAGTTGAACCTGGG - Intronic
1035278340 7:157761729-157761751 CAGAAGACAAAATTGACCAATGG + Intronic
1035347969 7:158219059-158219081 TAGAAGACCCAGTTGATCAAGGG - Intronic
1036010381 8:4715407-4715429 TAGAAAACAGAGATGAATAAAGG - Intronic
1036296199 8:7540140-7540162 CAGAGGACAGAGATTAACAATGG - Intronic
1036326367 8:7780879-7780901 CAGAGGACAGAGATTAACAATGG + Intronic
1036422935 8:8614664-8614686 CTAAAGACACAATTGAACAATGG - Intergenic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1036606936 8:10315514-10315536 CATAAGACATAAATGTACAAAGG - Intronic
1036680926 8:10873105-10873127 CCAAAGACACAGAAAAACAAGGG + Intergenic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1037228032 8:16619506-16619528 CAGAAGCAACAGATTAACACTGG - Intergenic
1038210520 8:25515287-25515309 CCGAATACTCAGTTGAACAAGGG - Intergenic
1039308201 8:36286944-36286966 CAGAAGAATCAGTTGAACTAGGG + Intergenic
1039345512 8:36700193-36700215 GAGAAGACACACATAAATAAAGG - Intergenic
1039683741 8:39772592-39772614 CAGAAAACACAAAGGAATAATGG - Intronic
1041139653 8:54803334-54803356 TAGATGTCACAGATGAACACGGG + Intergenic
1041851300 8:62396208-62396230 CAGAAGACCCTTATGCACAAAGG + Intronic
1041884905 8:62797496-62797518 CAGGAGACACAGGTAAACAATGG - Intronic
1041993639 8:64026314-64026336 AAGAAGAAAAAGATGAAGAAAGG - Intergenic
1042047638 8:64671789-64671811 CAGAAAACCCAGATGATAAAAGG + Intronic
1042102060 8:65284518-65284540 CAGAAGCCAAAGATAAACAATGG - Intergenic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042884230 8:73530405-73530427 AAGAACACACAAAGGAACAAAGG + Intronic
1043152544 8:76736933-76736955 CAGATGACACATGTGAATAATGG + Intronic
1043198909 8:77338296-77338318 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1043200186 8:77359536-77359558 CATTAGACACAGTTGAAGAAAGG - Intergenic
1045442934 8:102232836-102232858 CAGAAGGCTAAGATGAACAAAGG - Intronic
1046759887 8:118010043-118010065 ATGAAGACACTGATGGACAAAGG - Intronic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1046975254 8:120268043-120268065 TAGAAGACACAAATAAACAGAGG + Intronic
1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG + Intergenic
1047733048 8:127742075-127742097 CATTAGACCCAGATGAACCAAGG - Intergenic
1047906415 8:129477744-129477766 CAGAATTCACAGTTGAACAAAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049884933 9:20459-20481 CAAAGGGCACAGTTGAACAATGG + Intergenic
1050771994 9:9213881-9213903 CAAAAAACAAAGCTGAACAAGGG - Intronic
1051119127 9:13732395-13732417 CAGAAGAGACAGGTGCATAAAGG - Intergenic
1051828105 9:21244083-21244105 CAGGAAACACAGGTGAATAAAGG - Intergenic
1052189897 9:25647811-25647833 CCAAAGACAAAGATGAACATTGG - Intergenic
1053294217 9:36901401-36901423 CAGATGTCACAGGTGCACAACGG - Intronic
1055001723 9:71458227-71458249 AAGGAGACCCAGAAGAACAAAGG + Intergenic
1055049754 9:71966547-71966569 CATAATACATAGATTAACAAGGG + Intronic
1055170445 9:73251996-73252018 CAAAAGACAGAGATTAACAGAGG + Intergenic
1057868691 9:98701724-98701746 CGGGAGACACACATGAATAAAGG + Intronic
1058538975 9:105992454-105992476 CAGTGGAAACAGATGTACAATGG - Intergenic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1059292901 9:113243289-113243311 CAGAAGACATAGGTGACCTAGGG + Intronic
1059710948 9:116867198-116867220 CATAAGAAACAGATGAAAAGAGG + Intronic
1060166525 9:121421712-121421734 CAGAAGAGACAAAAGAAAAAAGG - Intergenic
1060316158 9:122512767-122512789 AAGAAGTCACAGATGGACACTGG - Intergenic
1061429469 9:130522217-130522239 CAGAAGGCAAAGAGGAAGAAAGG + Intergenic
1061833096 9:133308834-133308856 CAAAAGAGACTGAAGAACAAAGG - Intergenic
1062247414 9:135576264-135576286 CAAAAGCCACAGATGAGCATTGG - Intergenic
1062666148 9:137673694-137673716 TTGAAGACACTGATGAACACTGG - Intronic
1185861360 X:3582524-3582546 GGGAAGAAACAGATTAACAAGGG - Intergenic
1185954816 X:4478071-4478093 AAGAAGAGACAGATGAAGAAAGG + Intergenic
1186011445 X:5138785-5138807 CAGAAGACAACGAAGAACCATGG + Intergenic
1186635846 X:11403966-11403988 AAAAAGACACAGATGCAGAAAGG + Intronic
1187489770 X:19739989-19740011 CAGAAGACACAGAGATAGAAAGG + Intronic
1187878927 X:23828371-23828393 GAGAACACATAGAAGAACAAGGG - Intergenic
1188197503 X:27255547-27255569 AAGAAAACAAAGATGGACAAAGG - Intergenic
1190496791 X:51034128-51034150 CAGAAGCCTCAGATCAGCAATGG - Intergenic
1190509178 X:51159809-51159831 CAGAAGCCTCAGATCAGCAATGG + Intergenic
1191107681 X:56781873-56781895 CAAAAGAAAAAGATGAAAAACGG - Intergenic
1191175370 X:57494498-57494520 CAGATGCCACAGAAGCACAAAGG + Intergenic
1192062356 X:67840912-67840934 CAAAAGACACAGAATAGCAAAGG + Intergenic
1193407120 X:81115039-81115061 AAGAAGACAAAGATGAAAAAGGG - Exonic
1193455462 X:81726153-81726175 CAGAAGAGACAAAAGAAAAAAGG + Intergenic
1194767190 X:97855403-97855425 CAGAAGAGACAAATAAACACAGG - Intergenic
1195060357 X:101188377-101188399 CACAAAGCACAGCTGAACAATGG + Intergenic
1195170089 X:102259159-102259181 AAGAAGGCAGTGATGAACAATGG - Intergenic
1195188768 X:102427941-102427963 AAGAAGGCAGTGATGAACAATGG + Intronic
1196664208 X:118299241-118299263 CACAAAGCACAGCTGAACAATGG + Intergenic
1196739910 X:119015650-119015672 CAAAAGATACAGATCAGCAATGG + Intronic
1196841998 X:119867616-119867638 GAGAAAACACAGATGATAAAAGG - Intergenic
1197470145 X:126857054-126857076 CAGAGGACACAAAAGAAAAAAGG + Intergenic
1198516723 X:137416063-137416085 AAGAAGACACAAATTACCAATGG + Intergenic
1199133065 X:144217370-144217392 CACAAAACACAGATAAGCAATGG + Intergenic
1200384625 X:155878279-155878301 CAGATGGCTCAGATGAACAAAGG + Intergenic
1200575995 Y:4890111-4890133 CAAAAGTCAAAGATGAAGAAAGG - Intergenic
1201261460 Y:12162901-12162923 CAGAAGAGAGGGAGGAACAATGG - Intergenic
1201762094 Y:17551659-17551681 CAGAACACACATATGTACCATGG + Intergenic
1201839458 Y:18354329-18354351 CAGAACACACATATGTACCATGG - Intergenic
1201855859 Y:18540800-18540822 AAGAAGACACAGATGAATACTGG + Intergenic
1201877462 Y:18779585-18779607 AAGAAGACACAGATGAATACTGG - Intronic