ID: 1092388842

View in Genome Browser
Species Human (GRCh38)
Location 12:8057196-8057218
Sequence CAGAAAAATGAGAAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 620}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092388839_1092388842 16 Left 1092388839 12:8057157-8057179 CCAGAAATTTCAGACGTTTGACA 0: 1
1: 1
2: 0
3: 5
4: 151
Right 1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG 0: 1
1: 0
2: 0
3: 55
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092388842 Original CRISPR CAGAAAAATGAGAAGGTGGT AGG Intergenic
900731614 1:4265617-4265639 CCGAAAAAAAAGAAGGGGGTTGG - Intergenic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
901410626 1:9080942-9080964 CATCAAAATGAAAAAGTGGTGGG + Intronic
902964221 1:19986699-19986721 GAGGAAAATGAGAAGATAGTAGG - Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903764568 1:25725851-25725873 CTGAAGAATGAGAGGGTGCTCGG + Intronic
903767668 1:25745075-25745097 CAGAAAACTGTGAAGGTGGAGGG - Intronic
903873089 1:26451360-26451382 AAGAAAAATGAGGAGTTGGATGG - Intronic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
904567736 1:31437781-31437803 CAGAAAAATAGGAAGTTGGCTGG + Intergenic
904975472 1:34452697-34452719 CAGATAAATGCCCAGGTGGTAGG - Intergenic
905421882 1:37852648-37852670 CAACAAAATGAGAATCTGGTTGG - Intronic
906013345 1:42550475-42550497 CAGCAAGATGAGGAGGAGGTAGG - Intronic
906381967 1:45338412-45338434 TTGAAAAATGATAAGGTGTTAGG - Intronic
906504290 1:46366548-46366570 CTAAAAAAAGAGAAGGGGGTTGG + Intergenic
906829037 1:49012371-49012393 CAGAATTATGAGCAGGTGGTTGG + Intronic
907123456 1:52028275-52028297 CAGAGACATGAGAAGGAAGTAGG - Intronic
907503735 1:54902414-54902436 CAGAAAAGTGGGAAAGGGGTAGG + Intergenic
908154369 1:61337308-61337330 AAAAAAAATTAAAAGGTGGTAGG - Intronic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
909788429 1:79643298-79643320 CAGAAAAGTGGGAAAGGGGTCGG + Intergenic
909868862 1:80712755-80712777 CAGCAAAATAAGGTGGTGGTTGG - Intergenic
910184198 1:84518614-84518636 CAGAAAAATAAGGAGGTAGAGGG - Intergenic
910201752 1:84707151-84707173 CAGAAAAATGATGTGGTAGTTGG - Intergenic
910260336 1:85288133-85288155 TTAAAAAATGAGAAGGTGGCTGG + Intergenic
910578538 1:88795168-88795190 CAAAAAAATTAGCAGGTGATAGG - Intronic
910738238 1:90486188-90486210 CAGAAAGATGGGCAGGGGGTGGG + Intergenic
910996124 1:93106058-93106080 GGAAAAAATGAGGAGGTGGTGGG + Intronic
912296310 1:108474123-108474145 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
913225040 1:116691700-116691722 CAGAAAAGAGAGAATGTGGGTGG - Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914803665 1:150977301-150977323 GAGACAAAAGAGAAGGTGGATGG + Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915676266 1:157535017-157535039 CAGAAACCTGAGAAGTTGCTTGG - Intronic
916472731 1:165139776-165139798 AAGAAAAAAGAAAAGGAGGTGGG + Intergenic
916486313 1:165262785-165262807 CAGATAAATGAAAAGGTAGCTGG - Intronic
916692389 1:167202887-167202909 GAAAAAAATGAGAGGGTGGGAGG - Intergenic
916954099 1:169813674-169813696 CAGAAAAAGGAGAAGGTTAGCGG + Intronic
917973650 1:180224924-180224946 GAGACAAATGACAAAGTGGTGGG + Intergenic
918231123 1:182533207-182533229 CAGAAAAATAATTAGGAGGTAGG - Intronic
918346942 1:183614804-183614826 CCGAAAAGTGGGAAGGGGGTCGG - Intergenic
918661353 1:187092541-187092563 AAGAAAGAAGTGAAGGTGGTAGG + Intergenic
918772252 1:188576320-188576342 CAGAAAGATGAGGAACTGGTAGG - Intergenic
919854848 1:201698254-201698276 TAGAAAAGTGATAAGGTGGGTGG - Intronic
920226953 1:204446155-204446177 CACGGAAAGGAGAAGGTGGTGGG + Intronic
920383940 1:205554009-205554031 AAGACAGATGAGAAGGTGGAGGG + Intergenic
920798165 1:209160715-209160737 CAGCAAAATGAAAAGATGGTAGG - Intergenic
921036958 1:211389087-211389109 CAGAAAAATGGCATAGTGGTTGG - Intergenic
921077600 1:211712391-211712413 AAGACATATGAGAAGGTGGGGGG + Intergenic
921509100 1:216009159-216009181 CAGAAAAGTGGGAAAGAGGTTGG - Intronic
922934653 1:229413555-229413577 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
923907329 1:238399801-238399823 CAAACACAAGAGAAGGTGGTAGG + Intergenic
923962623 1:239102498-239102520 CAGAAAAGCGAGAAAGGGGTCGG - Intergenic
924180486 1:241435131-241435153 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
924394456 1:243604189-243604211 TATAAAAATGATAAGGTTGTCGG - Intronic
924753368 1:246918878-246918900 CAGAAAAAAGAAAAAGTGATTGG + Intronic
1063053252 10:2475987-2476009 CAGAACAATGAGAAGGGCATGGG - Intergenic
1063518086 10:6715883-6715905 AAGAAAAATAAGATGGTGTTTGG + Intergenic
1064531030 10:16309655-16309677 CAGAAAAGTGGGATGGGGGTTGG + Intergenic
1064969690 10:21052374-21052396 CAGAAAAATTGGGAAGTGGTTGG - Intronic
1064985172 10:21202759-21202781 AAGAAAAATTAGAAGGTGGAAGG - Intergenic
1066674199 10:37871515-37871537 CAGAGAAATGACAATGTGGCAGG - Intergenic
1066720445 10:38331668-38331690 TAGAAAAAAGAGAAGCTGGCTGG - Intergenic
1066782144 10:38963069-38963091 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1067757938 10:49019342-49019364 GAGAAAAATGTGAAGGGGTTTGG + Exonic
1067846064 10:49722349-49722371 CAGAAAAATTAGCAGGACGTGGG + Intergenic
1068757936 10:60675376-60675398 CAGAAAACTGGGAAGATGGGTGG - Intronic
1069465555 10:68635664-68635686 GTGAAGAATGAGAAGGTAGTAGG + Intronic
1070299587 10:75193522-75193544 CAAAAAAAGGAGAATGTGTTTGG - Intergenic
1070352655 10:75608333-75608355 CAGGGAAATGGGAAGGTTGTTGG + Intronic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071159870 10:82733366-82733388 CAAAAAAATGAGATGGTATTAGG - Intronic
1071231985 10:83598550-83598572 CAGAAAAATGAGAATGTGTGTGG - Intergenic
1071960953 10:90808606-90808628 CAGAAAAGTGGGAAAGGGGTCGG - Intronic
1072108566 10:92296468-92296490 GAGAAAAATGAGAATGTCGGTGG - Intronic
1072632982 10:97159515-97159537 CAGAAAAATGAGAAAGTCTTGGG - Intronic
1072643345 10:97231493-97231515 CAGAAAGTAGAGAAGGTGGTTGG - Intronic
1072800186 10:98387323-98387345 CAGAGAAATGAGATGGTGTTAGG + Intronic
1074931512 10:118131354-118131376 GAGCAGAATGTGAAGGTGGTTGG + Intergenic
1075121169 10:119666069-119666091 CAGAAAAATGAGAGGCATGTGGG - Intronic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075570129 10:123535704-123535726 TAGAAAAATGAGAAGCGGCTGGG + Intergenic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076338993 10:129729604-129729626 CAGAGAAATGAGAAGCTCTTTGG - Intronic
1076637823 10:131893881-131893903 CAGAAAAAAGAAAGGGAGGTAGG - Intergenic
1077349811 11:2087405-2087427 CAGGAAGGTGAGAAGGTGATGGG - Intergenic
1077518754 11:3018569-3018591 CACATGTATGAGAAGGTGGTTGG + Intronic
1077766557 11:5164867-5164889 CAGAAAAATGGGCAAGGGGTTGG + Intronic
1077856120 11:6127793-6127815 CAGAAAAATCTGGATGTGGTTGG + Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078368854 11:10728679-10728701 CAGAAAAATGGGGTGGAGGTGGG + Intergenic
1078641952 11:13104983-13105005 GAGAAAAATGAGAACCTGTTGGG + Intergenic
1078733988 11:14002910-14002932 CAGAGAAATGAGGTAGTGGTTGG - Intronic
1078811030 11:14763449-14763471 CAGAGAAATGAGATAGTGGCCGG + Intronic
1079639399 11:22785277-22785299 TGGAAAAAAGAGGAGGTGGTAGG - Intronic
1080180912 11:29425065-29425087 TAGAAAAATGAAATGGTAGTTGG - Intergenic
1080525648 11:33114358-33114380 CAGAAAAATGTGAATTTTGTCGG - Intronic
1080997642 11:37623440-37623462 CACAAAAATGAGCATGTGGATGG - Intergenic
1081006003 11:37740775-37740797 TGGATACATGAGAAGGTGGTTGG - Intergenic
1081249221 11:40809117-40809139 CAGAGAATTGAGATGGTTGTTGG - Intronic
1081475330 11:43424470-43424492 TAGAAACATGAAAAGGTGGCTGG + Intronic
1081632439 11:44699090-44699112 CACTAAACTGAGCAGGTGGTGGG - Intergenic
1081747057 11:45480767-45480789 CAGGATGATGGGAAGGTGGTGGG + Intergenic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1083069617 11:59963741-59963763 GAGAAAAAAGACATGGTGGTAGG + Intergenic
1083608240 11:63991913-63991935 GAGAAAAATGAAAAGGGGATCGG + Intronic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1084705162 11:70811856-70811878 CAGAAAAATGATAAGATGGATGG - Intronic
1087315793 11:96600694-96600716 CAGAAGAATGTGTAGTTGGTAGG - Intergenic
1087779721 11:102289512-102289534 CAGAAAAAGAAGAAAGTTGTAGG + Intergenic
1088496325 11:110434903-110434925 AATAAAAATGAGATGGTTGTAGG - Intronic
1089953081 11:122547719-122547741 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1090030515 11:123202239-123202261 CAGAAAAATCACAAGGTGTCTGG - Intergenic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090899336 11:131013559-131013581 CAGAGGAATGACATGGTGGTGGG + Intergenic
1091141300 11:133237318-133237340 CAGAAAAGTGATCAGGTGATGGG - Intronic
1091166459 11:133480396-133480418 CAGAAAAAGCAGAAGGCAGTGGG - Intronic
1091823629 12:3493482-3493504 TAGAAAAATGAGCCGGGGGTGGG - Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092474321 12:8806092-8806114 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1092902114 12:13069724-13069746 CAGAGAGATGAGAATGAGGTCGG + Intronic
1093672289 12:21891435-21891457 CAGAAAAATCAAATGGTGTTGGG + Intronic
1093911922 12:24758139-24758161 CAAAATAATGAGGAGATGGTTGG - Intergenic
1093938450 12:25026466-25026488 AAGGATAATGAAAAGGTGGTCGG + Intronic
1094169220 12:27474436-27474458 CATAAAAAAGAAAAGGTGGCAGG - Intronic
1094416098 12:30216464-30216486 CAGAAAAATGAAATGTTGGGTGG - Intergenic
1095190914 12:39257171-39257193 TAGCAAAATGAGAAAGTGATAGG + Intergenic
1095740034 12:45596912-45596934 CAGGAAGATGAGAATGAGGTGGG - Intergenic
1096422728 12:51474170-51474192 CTGAAAAATTAGAATGTGATGGG + Intronic
1097604830 12:61740526-61740548 CAGAAGGATGGGAAGGTGGGAGG + Intronic
1097611650 12:61830589-61830611 CAGAAAAATGGGAATGAGATGGG + Intronic
1098175143 12:67782282-67782304 CAGAAAAATGTGAAAGGGCTAGG + Intergenic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1098647513 12:72921832-72921854 GAGAAAAAAGAGAATGTGATTGG + Intergenic
1098958785 12:76716184-76716206 CAGAAAAATGAAAAGAGGCTGGG + Intergenic
1099292259 12:80787632-80787654 CAGAAAAGTGGGAAAGGGGTTGG + Intergenic
1099902404 12:88727978-88728000 CAGAATAATGAGGAGATAGTAGG + Intergenic
1100257955 12:92903299-92903321 TAGAAAAATGAGAATGCAGTCGG + Intronic
1100858864 12:98783692-98783714 CCTAGAAATGAGAATGTGGTGGG + Intronic
1101060453 12:100965725-100965747 CTGAAAGATGAGACGGTGTTAGG - Intronic
1101241815 12:102846772-102846794 GAAAAAAATCAGAATGTGGTGGG - Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103277390 12:119723992-119724014 CTTAAAAAAGAGAAGGTGGCCGG + Intronic
1103399468 12:120633274-120633296 CATAAAAATGAAAAGGTGTATGG - Intergenic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103586449 12:121959784-121959806 CAGAAAACTGAAAAGGTAGCGGG - Intronic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1105226479 13:18439140-18439162 CAGAAGGGTGAGAAGGTGGGAGG + Intergenic
1105962641 13:25356046-25356068 AAGAAAAATGAGAACGGGGAGGG - Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106566174 13:30886564-30886586 CAGAAAAATGTGAAGGTCTGAGG + Intergenic
1107216597 13:37927821-37927843 CAGTAAAATGAAAAGCTGATTGG + Intergenic
1107561097 13:41558328-41558350 CAGATAAATGAGTGGGTGGGTGG - Intergenic
1107905670 13:45058809-45058831 CATAAAAGTGAGAACGTGGCTGG + Intergenic
1108464813 13:50704838-50704860 CTTGAAAATGAGAAGGTGATTGG + Intronic
1108720699 13:53128637-53128659 CAGAAAGATGAAAAGCTGCTGGG + Intergenic
1108910515 13:55545406-55545428 GAGAAAAAGGAGAAAATGGTAGG + Intergenic
1108983640 13:56554499-56554521 AAGAAAAATAAGAAGGTGGAGGG + Intergenic
1109341333 13:61064018-61064040 CAGAACCATGAGAATGTGCTTGG + Intergenic
1109392219 13:61707981-61708003 CAGTCAAATGGGAATGTGGTGGG - Intergenic
1109499125 13:63214281-63214303 CAGAAAAGCGGGAAGGGGGTCGG - Intergenic
1109779676 13:67092814-67092836 CAGAAAAATAATAAGGTGCAAGG + Intronic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1111828130 13:93294828-93294850 CAGAATAATCAGTAGGTAGTTGG - Intronic
1112066900 13:95802749-95802771 CAGAAGAATGAGAGTGGGGTGGG - Intronic
1112187598 13:97142911-97142933 CAAAAAAATGAGAAGGTAGCAGG + Intergenic
1112742501 13:102490994-102491016 TATAAGAATTAGAAGGTGGTAGG - Intergenic
1113059250 13:106303501-106303523 CAGAAGACTGAGCAGGTGGAGGG + Intergenic
1113351711 13:109535935-109535957 CAGACCAATGAGGAGGTGATTGG + Intergenic
1113386607 13:109854561-109854583 CACAAAGAGGAGAAGCTGGTGGG - Intergenic
1113904634 13:113813471-113813493 GAGAAAAAAGATAAGGTGGAGGG + Exonic
1114820474 14:26012092-26012114 GAGAAAAATAAGAAGATGGATGG + Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115447287 14:33505856-33505878 CAGACAAGGGAGAGGGTGGTGGG - Intronic
1115590061 14:34855736-34855758 CAGAAAAATTAAAAGGTAGCTGG + Intronic
1115904644 14:38191948-38191970 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1116509632 14:45727650-45727672 AAGAAAACTAAGAAAGTGGTTGG + Intergenic
1117202868 14:53410370-53410392 CAGACAAACGAGGAGGTGATAGG - Intergenic
1117471386 14:56049832-56049854 CACAAAAATGAGAGTGTGCTAGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117491062 14:56248689-56248711 CTGCAACATGAGAAGCTGGTTGG + Intronic
1117498318 14:56327722-56327744 CAGACCAATGAGAAGCTGCTAGG - Intergenic
1118054271 14:62063038-62063060 CAACAAAATGAGCAGGTGTTGGG + Intronic
1118900113 14:69979385-69979407 GGCAAAAATGAGAAAGTGGTTGG + Intronic
1120382083 14:83793449-83793471 CTGAAAAATGAGGATGTGATCGG + Intergenic
1121069854 14:91008568-91008590 CAAAAAAATGAGAGGATGGCTGG + Intronic
1122393213 14:101404795-101404817 CAGAATAGTGGGGAGGTGGTGGG + Intergenic
1122712906 14:103673242-103673264 CAGTTAAATGAGAAAGTGTTTGG - Intronic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1125433536 15:39622841-39622863 CAGAAAAATGAGCAGCAGTTGGG - Intronic
1125433852 15:39625418-39625440 CAGAAAAGTGTGGAGGTGCTCGG + Intronic
1125880202 15:43186746-43186768 GACAAAAATGAGAAAGTGGGTGG - Intronic
1126531954 15:49720250-49720272 AATAAAAGTGAGAAGGTGTTAGG + Intergenic
1126752442 15:51890784-51890806 CTTAAAAATGAGAAGGGGGATGG - Intronic
1126843582 15:52739748-52739770 CAGAAAAGTGGGAAAGTGGTCGG - Intergenic
1127271717 15:57407675-57407697 CAGAAAAAAGGCAGGGTGGTGGG + Intronic
1127298934 15:57633897-57633919 GGGAAAAATGAGAACGTTGTTGG - Intronic
1128178497 15:65579228-65579250 GAGAAGGATGTGAAGGTGGTTGG - Exonic
1128296614 15:66526058-66526080 TAGAAAAATGTGAAGATGGTTGG - Intronic
1128328640 15:66741481-66741503 CTGTAAAATGAGGAGGAGGTGGG + Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129765037 15:78159291-78159313 AAGAAAAAGGAGGAGGGGGTAGG - Intronic
1130020432 15:80226180-80226202 CAGTAAAAAGAGAATGAGGTGGG + Intergenic
1130352422 15:83104570-83104592 AAGAAACAAGAGAAGATGGTAGG + Intergenic
1131557654 15:93413722-93413744 CAGAGAAAGGAGAAGCTGCTGGG - Intergenic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1131776138 15:95800935-95800957 CAGAAAGATGAGAAGGAGCATGG + Intergenic
1132262843 15:100441434-100441456 CAGAAAAGCGAGAAAGGGGTTGG - Intronic
1132340246 15:101073698-101073720 CAGAAAAGTGGGAAAGGGGTCGG - Intronic
1133191937 16:4140243-4140265 CAGAAAAATGAGAAGAGCCTGGG + Intergenic
1134076182 16:11293072-11293094 CAGAAAAACGGGAATGTGGCTGG + Intronic
1134680684 16:16122892-16122914 CAAAAAAAGGAGATGGGGGTGGG + Intronic
1134926219 16:18162643-18162665 CAAAGCAACGAGAAGGTGGTTGG + Intergenic
1135494486 16:22939679-22939701 CAGAAGAGTGAGAATGTGGGAGG + Intergenic
1135494597 16:22940291-22940313 CAGAAGAGTGAGAATGTGGGAGG + Intergenic
1136007435 16:27340720-27340742 AAAAAAAAAGAGAAGGTGATGGG + Intronic
1137507376 16:49065878-49065900 TAGAAAAAAGAGCAGGTGGAAGG - Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138549478 16:57739786-57739808 CAGTATAATCAGATGGTGGTGGG - Intronic
1138759276 16:59522186-59522208 CAGAAAAGTGGGAAAGGGGTTGG + Intergenic
1139730280 16:68938244-68938266 AAGAACAATGAGAAGGTTGGAGG + Intronic
1141193813 16:81844287-81844309 AAGAAAAATGAAAAGGTGCCCGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141236750 16:82225491-82225513 TAGAAAGATGATAAGGTGGATGG + Intergenic
1141475878 16:84273032-84273054 GAGTAAAATGAGAAGATGGGTGG - Intergenic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1143126528 17:4644720-4644742 CAGAAAAATCAAAATGTGGTGGG + Intergenic
1143374468 17:6459074-6459096 CAGGTGAATGAGAAGGTGGAAGG - Intronic
1143430764 17:6881524-6881546 CAAAAAAATTAGAAAGTGTTGGG - Intronic
1143934975 17:10474203-10474225 CAGAACAATGAAAAAGTGGAGGG + Intergenic
1144431130 17:15192567-15192589 AAGAGAAATGAGAAGAAGGTGGG - Intergenic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145324032 17:21783580-21783602 AAGACAAATGAGAAGGGGGCAGG - Intergenic
1145326580 17:21835215-21835237 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1146090680 17:29874290-29874312 CAAAAAAATGGGGAGGGGGTGGG + Intronic
1147336782 17:39730822-39730844 CAAAAGAAAGAGAAAGTGGTGGG + Intergenic
1147697938 17:42370558-42370580 CAAAGAAATGAGAAGATGGCTGG - Intronic
1147936864 17:44016832-44016854 CAGATAAATGAAAAGGTGTTGGG + Intronic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1149570181 17:57666795-57666817 CAGCAACATGAGAGGGTGGCTGG + Intronic
1150052678 17:61980258-61980280 AAGGAAATTGAGAAGGAGGTTGG - Intronic
1150342232 17:64377700-64377722 CAGATGAATGAGAGGGTGATGGG + Intronic
1150552955 17:66227874-66227896 GAGAGAAATGAGAAGGTCTTGGG - Intronic
1151030138 17:70728021-70728043 AAGACAAATTAGGAGGTGGTTGG + Intergenic
1151255529 17:72873590-72873612 CAGAAAAAAGAGACCCTGGTGGG + Intronic
1152832787 17:82508972-82508994 CAAAAAAATGAGCTGGTGGCCGG + Intergenic
1152945931 17:83197318-83197340 CAGAAAAAGCAGCAGGCGGTTGG + Intergenic
1203190770 17_KI270729v1_random:185806-185828 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153757651 18:8300245-8300267 CAGGCAAAAGAGAAGGTCGTAGG + Intronic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1154989182 18:21583997-21584019 GAGAAAAAGGAGATGGTGGAAGG + Intronic
1155559031 18:27055390-27055412 TAGAAAAAGTGGAAGGTGGTAGG + Intronic
1155941376 18:31804933-31804955 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1156279826 18:35626118-35626140 CACAAAAAAGAGAAACTGGTGGG - Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156618930 18:38825582-38825604 CAGAAAAGTGGGAAAGTGGGAGG - Intergenic
1156692246 18:39722263-39722285 CTGATAATTCAGAAGGTGGTGGG + Intergenic
1157326098 18:46669701-46669723 AAGAAAAAAGGGCAGGTGGTGGG - Intronic
1157906576 18:51574624-51574646 CAGAAAAGTGGGAAAGGGGTTGG + Intergenic
1159028873 18:63210877-63210899 CAGAACAATGAGATGGTGAATGG - Intronic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159157790 18:64606771-64606793 GAGAAAAATGAGAAAATGGCTGG + Intergenic
1159164301 18:64682791-64682813 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1161585518 19:5103405-5103427 CAGGAAAATGAGAAAGCGGGCGG - Intronic
1162085650 19:8247412-8247434 AAAAAAGATGAGAAGGTTGTGGG - Intronic
1163251936 19:16131245-16131267 CAGATAAGTGAGAGAGTGGTTGG + Intronic
1163664833 19:18598340-18598362 AGGAAAAATGAGAAGGTGCAGGG + Intronic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164459394 19:28434425-28434447 CAGAAAAGTGGGAAAGAGGTGGG + Intergenic
1164533366 19:29064860-29064882 TAGAAAAATGGGAAGGTTGAGGG + Intergenic
1165006976 19:32815213-32815235 CAGAAATATGGGCAGGTGGTGGG - Intronic
1165127883 19:33613591-33613613 CACCAAAAATAGAAGGTGGTTGG - Intergenic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166429422 19:42711689-42711711 AAGAAAAATGGGAAGGTGAAAGG + Intronic
1166443054 19:42833016-42833038 AAGAAAAATGGGAAGGTGAAAGG + Intronic
1166450836 19:42899430-42899452 AAGAAAAATGGGAAGGTGAAAGG + Intronic
1166462742 19:43003775-43003797 AAGAAAAATGGGAAGGTGAAAGG + Intronic
1166468884 19:43060233-43060255 AAGAAAAATGGGAAGGTGAAAGG + Intronic
1166480030 19:43163754-43163776 AAGAAAAATGGGAAGGTGAAAGG + Intronic
1166489851 19:43249285-43249307 AAGAAAAATGGGAAGGTGAAAGG + Intronic
1167099236 19:47393836-47393858 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1167283691 19:48586621-48586643 CAGAAAAATGAAATGGGGTTGGG + Intronic
1167901984 19:52628934-52628956 CAGAAAAGTGGGAAAGCGGTTGG - Intronic
1168561034 19:57383513-57383535 CAGAAGAATGGGATGGTGGGGGG - Intronic
924992112 2:321137-321159 CAGAAAAATGAGAAGTGAGATGG - Intergenic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
926635923 2:15179738-15179760 CAGAAAAATGAAAATGTGTTTGG + Intronic
926848740 2:17171343-17171365 CAGTAAGATGCGAGGGTGGTAGG - Intergenic
927789992 2:26002259-26002281 CAGACAAATGGGAAGGAAGTTGG - Intergenic
928220358 2:29398190-29398212 GAGAGAAATGAGAAGATGGGAGG - Intronic
928238242 2:29564047-29564069 CAGCAATCTGAGAAGATGGTGGG - Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928660882 2:33500638-33500660 TAAAAAAATGAGAAGGAGGTGGG + Intronic
928800087 2:35078878-35078900 GAGAAAACTAGGAAGGTGGTAGG + Intergenic
928856998 2:35814240-35814262 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
929908263 2:46065439-46065461 CGGACAAATGAGAAGATGGAAGG - Intronic
930063266 2:47308579-47308601 AAAAAAAAAGAGAAGGTGGCAGG - Intergenic
930663218 2:54076217-54076239 CAGAGAAATGAAAAGGTACTGGG + Intronic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
931069813 2:58633174-58633196 GTGAAAAATTAAAAGGTGGTTGG + Intergenic
931174075 2:59835325-59835347 AAGAAAAAAGAGAAGGGGGAAGG - Intergenic
931197237 2:60064307-60064329 CAGAAAGATAAGAAGATGGTGGG + Intergenic
931793925 2:65691360-65691382 CAGAAAACTAACCAGGTGGTCGG - Intergenic
931948098 2:67332754-67332776 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
934076320 2:88431639-88431661 CAAAAAAAAAAAAAGGTGGTGGG - Intergenic
934169619 2:89329711-89329733 CAGGAAAATGAGGAGGTTCTAGG - Intergenic
934197673 2:89852874-89852896 CAGGAAAATGAGGAGGTTCTAGG + Intergenic
935172431 2:100620824-100620846 CAGCAATATGAGAACTTGGTGGG - Intergenic
935272091 2:101443639-101443661 TAGAGAAATGACAATGTGGTGGG + Intronic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
937202127 2:120210422-120210444 CTGAAAACAGAGAAGGTGGCTGG + Intergenic
937777855 2:125801922-125801944 AACATAAAGGAGAAGGTGGTGGG + Intergenic
937996352 2:127697642-127697664 CTCAAAAATGAGGGGGTGGTTGG + Intergenic
939083312 2:137687519-137687541 CAGAAAAGTGGGAAAGGGGTCGG + Intergenic
939215700 2:139235720-139235742 CAGAAAAATGAGAAGATCTGTGG - Intergenic
939582992 2:143973492-143973514 TAGAAAAATGAGAAATTGGCCGG + Intronic
940395045 2:153179037-153179059 CAGAAAAATGGGATTGTGGCTGG - Intergenic
942444716 2:176070470-176070492 GAGAAAAATGAGGTGGAGGTGGG - Intergenic
943276703 2:185876513-185876535 CAGCAAAATGCTCAGGTGGTGGG - Intergenic
943328995 2:186536476-186536498 CAGAAAAATGAGATGGTGACTGG + Intergenic
943526756 2:189026107-189026129 CATAAATGTGAGAAGGTAGTAGG - Intergenic
943951464 2:194135459-194135481 CAGAAAAGTGGGAAAGGGGTCGG + Intergenic
944125149 2:196284044-196284066 CATAAAAAGGAAAAGATGGTAGG - Intronic
944387277 2:199180534-199180556 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
944962719 2:204893362-204893384 CAAAGAAATGAGAAAGTGCTTGG + Intronic
945173285 2:207018381-207018403 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
945361481 2:208900383-208900405 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946462738 2:219884023-219884045 CAGAGACATGGGGAGGTGGTGGG + Intergenic
946893109 2:224297847-224297869 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
947478201 2:230471250-230471272 CAGAAAAATGAGAAGTGAGAAGG + Intronic
948127475 2:235575163-235575185 GAGAATAAAGAGATGGTGGTTGG + Intronic
948183885 2:236003779-236003801 CAGAAAAAAAAAAAAGTGGTAGG - Intronic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
1168940347 20:1706258-1706280 CAGAAAAATTAGAAAGTGCAGGG - Intergenic
1169041613 20:2500106-2500128 CAAGAAAATGAGGAGGTGGGGGG + Intronic
1169371829 20:5033907-5033929 AAGAAAAATCAGAAAGTGGGTGG - Intergenic
1169712441 20:8580056-8580078 CAGCCTAATGAGAAGGTGGTGGG + Intronic
1170253916 20:14318425-14318447 CATAAAAATGAGATAGGGGTAGG + Intronic
1171147159 20:22794949-22794971 CAGGAAGCTGGGAAGGTGGTAGG + Intergenic
1173055051 20:39603942-39603964 CAGAATAGTGAAAAGGTGGATGG - Intergenic
1173704344 20:45098929-45098951 GAGAAAAATGAAATGGGGGTGGG - Intronic
1173781504 20:45760602-45760624 CAGAAAAGTGGGAAAGGGGTTGG - Intronic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174373364 20:50109355-50109377 AAGAGAAAAGAGAATGTGGTGGG + Intronic
1174536849 20:51257932-51257954 CAGAAAAAAAAGAAAGTGCTAGG + Intergenic
1175322517 20:58099479-58099501 CAGGAAAATGAAAAGGCCGTGGG - Intergenic
1176770530 21:13068165-13068187 CAGAAGGGTGAGAAGGTGGGAGG + Intergenic
1177100459 21:16893328-16893350 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1177207983 21:18032517-18032539 GAGATAAATGAGAAAGGGGTAGG - Intronic
1177659335 21:24062619-24062641 TAGAAAATGGAGATGGTGGTCGG - Intergenic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178482819 21:32994428-32994450 CAGATAAATGGGATGGGGGTGGG + Intergenic
1178537779 21:33424578-33424600 CAGAGGAGTGAGATGGTGGTTGG + Intronic
1179387391 21:40956109-40956131 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1179498100 21:41787505-41787527 AAGAACAATGAGAACGTGGATGG - Intergenic
1180371251 22:12039292-12039314 AATAAAAATAAGAAGGAGGTTGG + Intergenic
1180675321 22:17582376-17582398 AAAAAAAAGGAGAATGTGGTAGG + Intronic
1181873993 22:25925606-25925628 CAGAAACTTGAGCAGGTGGCTGG + Intronic
1182011855 22:27007785-27007807 CAAACAAATGTTAAGGTGGTGGG - Intergenic
1182773926 22:32817068-32817090 AAAAAAAAAGAAAAGGTGGTTGG + Intronic
1182779241 22:32854543-32854565 CACAAAAATAAGAAGTTGCTCGG + Intronic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184728211 22:46358226-46358248 CAGAAACATGAGTAGGTGGGAGG + Intergenic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
949356600 3:3187055-3187077 CAGAGCAATGAGCAGTTGGTAGG + Intergenic
949571149 3:5294390-5294412 CAGAAAAATGAGAATTTTCTGGG - Intergenic
949705604 3:6813463-6813485 TAGGACTATGAGAAGGTGGTAGG - Intronic
949827275 3:8178177-8178199 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
950730622 3:14953444-14953466 AAGAGAAATGAGAGGCTGGTAGG + Intronic
951278021 3:20713206-20713228 CAGAGATCTGAGAAGGAGGTTGG + Intergenic
951367913 3:21806980-21807002 CAGAAAAATAAGAGGGAAGTTGG - Intronic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951935722 3:28020860-28020882 AAGAAAGATGAGAAGTTGGTGGG + Intergenic
952108434 3:30095208-30095230 TAGAAAAATGAGCAGGAGATAGG + Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952895434 3:38075591-38075613 CAGAAAAGTGGGAAAGGGGTCGG + Intronic
953044505 3:39282500-39282522 CAGAGAAATGAGAGTGTGGTGGG + Intergenic
953077299 3:39582351-39582373 CAGAAAAGTGGGAAAGGGGTCGG + Intergenic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953397862 3:42587385-42587407 AAAAAAAATGAGATGGTGTTAGG - Intronic
953529365 3:43726281-43726303 CAGAAATATGGTAAGCTGGTTGG - Intronic
953762193 3:45697570-45697592 CATAAAAAAGAAAAAGTGGTTGG - Intronic
954912745 3:54122542-54122564 CAGAAAAAGGAGCGGGTGGGGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955806024 3:62735761-62735783 CAAAGAAAAGAAAAGGTGGTAGG - Intronic
956657573 3:71567162-71567184 AAGAAAAATGAGAAAGTGGACGG + Intronic
956901090 3:73716895-73716917 CAGAGAAATGGGACAGTGGTAGG - Intergenic
957399841 3:79696037-79696059 AATAAAAATGAGAATGTGGGAGG + Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958097952 3:88972002-88972024 CAGAAAATTGATGAGGTTGTAGG + Intergenic
958436347 3:94100632-94100654 CAAAAGAATGATAAGTTGGTGGG + Intronic
958479506 3:94628537-94628559 CAGAAAGCTGAGAAGGAAGTAGG + Intergenic
958531963 3:95344466-95344488 CAGCAAAAAGAGAAAGTAGTGGG - Intergenic
958975248 3:100660170-100660192 TAAAGAAATGAGAAGGTTGTGGG + Intronic
959485935 3:106927265-106927287 CAGAAAAGTGAGAAAGGGGTTGG + Intergenic
959825222 3:110786341-110786363 CAGAAAAAGAACAAAGTGGTAGG - Intergenic
960328762 3:116330555-116330577 AAGAAAAATAAAAAGGTTGTGGG - Intronic
961144519 3:124583239-124583261 CAGAAAAAAGGGAAGTTTGTGGG - Intronic
961332915 3:126153592-126153614 GAGAAATATCAGAAGATGGTGGG + Intronic
961744803 3:129057751-129057773 CAGAAAAATCAGATGGTAATTGG + Intergenic
961880889 3:130060431-130060453 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
962366557 3:134789854-134789876 CAGAGAATTGGGATGGTGGTTGG - Intronic
963425044 3:145114107-145114129 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
963521451 3:146363205-146363227 CAGAAAAGTGAGAAAGGGTTCGG - Intergenic
964042167 3:152274383-152274405 CAAAAAAATAAGAATCTGGTAGG + Intronic
964067647 3:152598151-152598173 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
964125635 3:153231269-153231291 CAGAAAAGTGGGAAAGGGGTCGG + Intergenic
964181725 3:153895612-153895634 CAGAATAATGAGAATGTGGAAGG - Intergenic
964676972 3:159294112-159294134 CACAAACATGATAAGGAGGTTGG + Intronic
964909253 3:161758072-161758094 GAGAAAGAGAAGAAGGTGGTTGG + Intergenic
965105399 3:164346703-164346725 CAGAAAAGTGGGAAAGGGGTTGG + Intergenic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966374948 3:179286852-179286874 CAGAGAAATGAGAAAGTTGGGGG + Intergenic
966468649 3:180262184-180262206 CAGACATATGAAAAGGTGCTGGG + Intergenic
966852906 3:184175479-184175501 CAGAGTAATGAGAGGGTGGTAGG - Intronic
967336687 3:188352045-188352067 AAGAAAAATGACAAGGGGGGAGG - Intronic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
968299740 3:197603499-197603521 CAGAAACAAGTGGAGGTGGTGGG - Intergenic
968993219 4:3928536-3928558 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
969003978 4:4004777-4004799 CAGAAAAGCGAGAAAGGGGTTGG + Intergenic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969809953 4:9640048-9640070 CAGAAAAGCGAGAAAGGGGTTGG - Intergenic
970536691 4:17037356-17037378 AAGAAGACAGAGAAGGTGGTAGG + Intergenic
970602296 4:17650108-17650130 CAGAAAAATGAGTGGATGGATGG - Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971303114 4:25457975-25457997 CACAAAAATGAAAAGCTGGCAGG - Intergenic
971328396 4:25662914-25662936 CAGAACAATGAAAAGGGGGAGGG - Intronic
972949224 4:44298409-44298431 CAGAAAAATAAAGAGGTGGGGGG - Intronic
973095835 4:46198193-46198215 CTGAATGATGAGAAGGTGTTGGG - Intergenic
973299154 4:48560432-48560454 AGGAAGAATGACAAGGTGGTGGG + Intronic
973818246 4:54638993-54639015 CAGCAAAATGAGGAGATGGGAGG + Intergenic
974607349 4:64170767-64170789 CAGAAAAATGAGAATTTGCAAGG + Intergenic
976283604 4:83349278-83349300 GAGAAAAATGAGTAGGAGGATGG - Intergenic
976467599 4:85388379-85388401 CAGAGAATGGAGAAGGTGCTTGG + Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977861681 4:101968583-101968605 CAGACAAGTAAGAAGGTGATGGG + Intronic
978247531 4:106592545-106592567 CAGAAATAGGAAAAGGTAGTTGG + Intergenic
978336179 4:107672063-107672085 AATAAAAATGAGATGGAGGTGGG + Intronic
978438447 4:108710182-108710204 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
978447320 4:108791846-108791868 AAGAGAAATGGGAACGTGGTGGG - Intergenic
978998466 4:115185329-115185351 CAGGAAACTGAGAAGGTTGTGGG + Intergenic
979114032 4:116798060-116798082 CAGGAAAATGCCAAGGTGATAGG + Intergenic
979146452 4:117253245-117253267 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
979610593 4:122685017-122685039 CAGCCAAATGAGGAGGTGGGCGG + Intergenic
980388756 4:132119358-132119380 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
980447239 4:132926073-132926095 CAGAAAAGTGAGAAAGTTTTTGG - Intergenic
980774248 4:137418901-137418923 CAGAAAGGTGAGACGGTGGGAGG + Intergenic
980903762 4:138929031-138929053 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
981023408 4:140052092-140052114 GAAAAAAATGAGAATGTGGGAGG + Intronic
981040088 4:140214722-140214744 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
982253524 4:153431214-153431236 CAGAAAAAGGAGTAGGTTGTAGG + Intergenic
982589459 4:157287733-157287755 CAGAATTGTGAAAAGGTGGTCGG - Intronic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983575181 4:169253754-169253776 CAGAGAAATTATAAGGTGTTTGG + Intronic
985820978 5:2160359-2160381 CAGAAAAATGGATAGGTGGATGG - Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986630938 5:9773036-9773058 CAGAAAAATAACAAAGTGGCAGG - Intergenic
986982428 5:13464537-13464559 AATAGAAATGAGAAGATGGTGGG + Intergenic
987216909 5:15747102-15747124 CAGAAAGATGAGAAGGGAGGTGG + Intronic
987281870 5:16421163-16421185 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
987490768 5:18578047-18578069 GAGAGAAAAGAGAAGGTAGTAGG + Intergenic
987736058 5:21845230-21845252 CAAAGAAATGACAAGTTGGTAGG + Intronic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
989813802 5:45711062-45711084 CAGACATACGAGAAGGTGGTTGG - Intergenic
989946935 5:50247218-50247240 CAGAAAAATTAGAAGCATGTTGG - Intergenic
990066417 5:51720977-51720999 AAGAAAAAAAAGCAGGTGGTGGG + Intergenic
990208149 5:53452455-53452477 AAGAAATATGAGAAGGTGACAGG + Intergenic
990686360 5:58306117-58306139 AACAAAAATGAGAAGGTTATTGG - Intergenic
990743666 5:58937156-58937178 CAGAAAAATGATTTGGTTGTGGG + Intergenic
991153032 5:63394633-63394655 GAAAACAATGTGAAGGTGGTAGG + Intergenic
991331706 5:65499602-65499624 CAGAAAGAGGAGAAAGTGGGTGG - Intergenic
991602579 5:68368224-68368246 CAGAAAAATGAGCTGGTTGACGG + Intergenic
992125112 5:73631924-73631946 GTAAAAAATGAGAGGGTGGTAGG - Intronic
992308746 5:75471767-75471789 AAAAAAAAAGAAAAGGTGGTAGG + Intronic
992331883 5:75725494-75725516 CAGACAAATGAGGAGATGGGAGG + Intergenic
993174515 5:84466268-84466290 CAGGAGAATGAGAATGTGGTAGG + Intergenic
994079317 5:95688712-95688734 CAGAAAGGTGAGAAGGTAGAAGG + Intronic
994377879 5:99035926-99035948 CAGAAGGATGGGAAGGTGGGAGG - Intergenic
994406190 5:99348121-99348143 AGGAAAAATGAGAGGGTGGATGG + Intergenic
995345694 5:111114310-111114332 GAGAAAAATGAGAAGGAAGGTGG + Intronic
995448566 5:112274444-112274466 CAGAAGAATAAGAAGAGGGTAGG - Intronic
995676514 5:114668510-114668532 CAGAAAGAAGTGAAGGTGGTGGG - Intergenic
995978282 5:118069733-118069755 CAGAATAATGAGAAGCCAGTAGG - Intergenic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996650240 5:125867001-125867023 TAGACAAAAGAAAAGGTGGTTGG + Intergenic
997020179 5:129991075-129991097 GAGTAAAATGAGAAGGGGTTGGG + Intronic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997746235 5:136302458-136302480 CAGAAAAGTGGGAAAGGGGTCGG - Intronic
998319913 5:141219656-141219678 CAGCAGAATGAGAAGGTTATAGG - Intergenic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
1001186127 5:169574601-169574623 AAAAAAAATGTGAAGGGGGTTGG + Intergenic
1001290495 5:170454664-170454686 AAGAAAAATGAGTAGGAAGTTGG + Intronic
1001331623 5:170766568-170766590 CAGAAAAGTGGGAAAGAGGTTGG + Intronic
1001493148 5:172169496-172169518 CAGAAGAATGGGAGGGTGGGTGG + Intronic
1002545275 5:179938558-179938580 AAGAGAAATGAGAATGTGTTTGG - Intronic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003256055 6:4475836-4475858 CAGCAAACTGAGAAGATGGTGGG + Intergenic
1003500452 6:6698638-6698660 CAGAAAGAAAGGAAGGTGGTGGG + Intergenic
1003999193 6:11579141-11579163 CAGGAAAATGAGAATTTGGAGGG - Exonic
1004050542 6:12073851-12073873 CGGAAAAATAAGATGGTGCTGGG + Intronic
1004436550 6:15600701-15600723 CTGAGAACTGAGCAGGTGGTAGG + Intronic
1004439431 6:15634612-15634634 CAAAAAAAATAGAAAGTGGTTGG - Intronic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1005884544 6:30086621-30086643 GAGAAAACTGAGAAGATGGGGGG - Intergenic
1006901307 6:37503788-37503810 CAGAAACAAGAGAATGGGGTGGG + Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007322307 6:41036426-41036448 CAACAAATTGAGAAGGTGGAAGG + Intronic
1007492206 6:42232241-42232263 CAGAAGTAAGCGAAGGTGGTAGG + Intronic
1007978951 6:46130408-46130430 AAGAAAAATTAGCAGGTGCTGGG + Intronic
1008408999 6:51151081-51151103 CAAAGAAATGTGAGGGTGGTAGG - Intergenic
1008604003 6:53122627-53122649 TAGAAAAATGTGAAAGGGGTTGG - Intergenic
1010863617 6:80944453-80944475 CAGTAAAATGAGTAGGAGCTGGG - Intergenic
1010921590 6:81688717-81688739 CAGAAAAGTGAGAAGGTTTAAGG - Intronic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1012034287 6:94111670-94111692 CAGAAAGAAGAGACGGTGGGAGG - Intergenic
1012272945 6:97237083-97237105 CAGAAAAATGAAAAGGTCAATGG + Intronic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1013549936 6:111197687-111197709 CAGAAAACTGAGCAGATGCTGGG - Intronic
1013550721 6:111205190-111205212 GAGAAAAAGGAGATGGTGTTGGG + Intronic
1013564423 6:111342859-111342881 CAGCAAAATGAGAGGCTGGAAGG + Intronic
1014194872 6:118543513-118543535 CAGATAAATCTGAAGTTGGTGGG - Intronic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1015788841 6:136945953-136945975 CAGTGAAATGAGAACGTGGGTGG - Intergenic
1016204371 6:141453980-141454002 CAGAAAATTGAGAAAGGGGTCGG - Intergenic
1016671210 6:146710781-146710803 CTGAAAAATGAGGAGGTGTAGGG - Intronic
1016879634 6:148898207-148898229 AAAAAAAATGAGAGGGTGGAAGG - Intronic
1017224880 6:152009179-152009201 AGGAAAAATGAGAAAGTGGGTGG - Intronic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1017378779 6:153802444-153802466 CAGCCAAATGAGGAGATGGTAGG - Intergenic
1017415104 6:154211958-154211980 AACAAACATGAGAAGGTGCTTGG + Intronic
1017555779 6:155565915-155565937 CGGAAAAATGAAAAGGTAGAAGG - Intergenic
1017698313 6:157041738-157041760 CAGAAAACAGAGAAGGTGCTGGG - Intronic
1018052348 6:160022233-160022255 CAGAAAGGTGAGAGGGTGGGAGG + Intronic
1018412294 6:163563344-163563366 CGGAAAAATGAGAAGGGAGTAGG - Intronic
1018441101 6:163814116-163814138 GAGAAGAAAGAGAAAGTGGTGGG - Intergenic
1019680104 7:2342945-2342967 CAAAAAAATTAGCCGGTGGTGGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020315877 7:6904947-6904969 CAGAAAAGTGGGAAAGGGGTGGG - Intergenic
1020339755 7:7097122-7097144 AAGAAAAAAGAGAAGGTTGGAGG + Intergenic
1020932180 7:14411757-14411779 CAGAAAAAAAAGAAAGAGGTAGG - Intronic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1021637142 7:22704415-22704437 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1021677992 7:23100131-23100153 CAGACAAAAGACCAGGTGGTGGG - Intergenic
1022029929 7:26483270-26483292 AAGAAAGATGAGAAGGTGCAGGG + Intergenic
1022311696 7:29202467-29202489 CAACAAAATGGGAAGGTGGAAGG + Intronic
1022987582 7:35673617-35673639 TATATAAATGAGAAAGTGGTTGG + Intronic
1023344599 7:39258716-39258738 AAGAAGAAGAAGAAGGTGGTAGG + Intronic
1023720371 7:43087475-43087497 CAGAAAGGTGAGAGGGTGGGAGG + Intergenic
1024409734 7:49026474-49026496 CAGCCAAATGAGGAGGTGGGAGG - Intergenic
1025562304 7:62382692-62382714 AAGAAAAATGGGAAGCAGGTAGG - Intergenic
1026341263 7:69436175-69436197 AAGAAAAATAAGAAGGTGGATGG - Intergenic
1026832933 7:73621459-73621481 CAGAGAGTTCAGAAGGTGGTGGG - Intronic
1027230580 7:76269434-76269456 CAGAAAAGTGAGATGGGGGATGG + Intronic
1027927272 7:84482630-84482652 GGGAAAAATGTGAATGTGGTGGG - Intronic
1028131507 7:87181002-87181024 CAGAAAAATTAGCTGGTGGCAGG - Intronic
1028191776 7:87862148-87862170 CAGAAAAAAGATAAGTAGGTTGG - Intronic
1028275471 7:88851120-88851142 AAGAAAAATGAGTAGATTGTTGG + Intronic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1029312439 7:99679612-99679634 CACCAAAATTAGAAGGTGGATGG + Intronic
1029314576 7:99699752-99699774 CACCAAAATTAGAAGGTGGCTGG + Intronic
1031041845 7:116846738-116846760 CAGACAAATAAGAAGGGGCTGGG + Intronic
1031148784 7:118028488-118028510 AAGGAAAATGAGCAGCTGGTTGG + Intergenic
1031750242 7:125562709-125562731 CAGCAATAGAAGAAGGTGGTGGG + Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032719400 7:134538388-134538410 CTGGAAAATGATAGGGTGGTGGG - Intronic
1032724370 7:134577157-134577179 CTGGAAAATGATAGGGTGGTGGG - Intronic
1032846939 7:135759132-135759154 CAGAAAAAAGAAAAGGGGATGGG - Intergenic
1032950388 7:136902487-136902509 CGTAAAAATTAGAAGCTGGTGGG + Intronic
1033486867 7:141798893-141798915 CAGAAAAATGAGAAAGGCTTTGG + Intergenic
1033778763 7:144644687-144644709 CAGAAAATTAACATGGTGGTAGG + Intronic
1034001022 7:147413388-147413410 AAGGAAAATGAGAATGTGGTAGG + Intronic
1034278488 7:149835261-149835283 TAAAAAAGTGAGAAAGTGGTGGG - Intergenic
1034753522 7:153592745-153592767 CAGAGAAGTGTGAAGGTGCTGGG + Intergenic
1035660220 8:1342103-1342125 CAGAAAAATCAGCTGGGGGTAGG - Intergenic
1036639325 8:10572416-10572438 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1037146885 8:15582881-15582903 AAGAACAAAGAGAAGGTTGTAGG - Intronic
1038779742 8:30559751-30559773 AAGAAAAATGAGAAGAGGGAGGG + Intronic
1038950480 8:32408884-32408906 CAGAAAGATGGGAGGGTGGGAGG - Intronic
1040536101 8:48312130-48312152 CAGATATATGAAAAGGTGCTTGG + Intergenic
1041538398 8:58954888-58954910 AAGAAAAAAGAGAAGATAGTGGG + Intronic
1042391567 8:68241726-68241748 CAGAAAGATGGGAGGGTGGAAGG - Intergenic
1042552200 8:70004092-70004114 GAGAAAAGGGAGAAAGTGGTAGG + Intergenic
1042861854 8:73322352-73322374 TAGAAAGAGGAGAAGGTGTTTGG - Intronic
1043334816 8:79162379-79162401 CAAAATAATTACAAGGTGGTTGG - Intergenic
1045711969 8:104995467-104995489 TAGAAAGATGAGAAAGTTGTTGG - Intronic
1046230268 8:111346850-111346872 CAGAAAGATGAAAAGGTCCTTGG + Intergenic
1047211244 8:122842190-122842212 TTGGAAAATGAGAAGGTTGTAGG + Intronic
1047329615 8:123874870-123874892 CAGAGAAATGAGATGGTAGCTGG - Intronic
1047348216 8:124049035-124049057 AAGAAAAAAAAAAAGGTGGTGGG - Intronic
1047856205 8:128915562-128915584 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1048010132 8:130448793-130448815 CAGAGAAGGGAGTAGGTGGTGGG + Intergenic
1048526698 8:135209275-135209297 CAGCAAAGTGAGAAGTTGGAGGG + Intergenic
1049742235 8:144246742-144246764 CTGAAAAGGGAGCAGGTGGTGGG + Intronic
1050831170 9:10015710-10015732 CAGAAAGAAGAGAAAGAGGTGGG + Intronic
1051078773 9:13272477-13272499 CAGAAAACTGTGAATGTGATGGG + Intronic
1051173582 9:14343295-14343317 GAGAAAAATGAGAAAGTAGGGGG - Intronic
1051234714 9:14987162-14987184 AGAAAAAATTAGAAGGTGGTTGG - Intergenic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1052228769 9:26121576-26121598 CAGGAAAAAGGGAAGGTGTTTGG + Intergenic
1052720811 9:32169073-32169095 CAGAAAAGTGGGAAAGGGGTTGG + Intergenic
1052881971 9:33606839-33606861 CAGAAACATGAGGACTTGGTTGG + Intergenic
1052977063 9:34419193-34419215 CAGCAAAATAAGAAGGTGTGTGG + Intronic
1053102553 9:35383004-35383026 GATAAAGAAGAGAAGGTGGTTGG + Intronic
1053188633 9:36040355-36040377 CCGAAGGCTGAGAAGGTGGTGGG + Intronic
1053330434 9:37201346-37201368 GAAAAGAATGAGAAGGTGGAAGG - Intronic
1053494347 9:38539025-38539047 CAGAAACATGAGGACTTGGTTGG - Intergenic
1055786920 9:79881157-79881179 CAGAATAATGTTAAGATGGTAGG + Intergenic
1055810610 9:80143678-80143700 TAGAAAAAAGAGAAGTTGGTCGG + Intergenic
1056105680 9:83344031-83344053 CAGAAAAATAGCAAGGTGGGAGG + Intronic
1056138465 9:83651446-83651468 CAAAAAAATTAGAATTTGGTAGG + Intergenic
1056804502 9:89718205-89718227 CAGAAAAATCAGAAAGAGTTTGG + Intergenic
1056874152 9:90311917-90311939 CATAGAAATGAGAAGGTTGTGGG - Intergenic
1057021146 9:91698642-91698664 GAGAAAAAGGAGCAGGTGGAAGG - Intronic
1057997397 9:99830532-99830554 CAGAGAAATGAGAAAATGTTTGG + Intronic
1058770555 9:108227129-108227151 TGGAAAAAGGAGAAGGTGCTGGG - Intergenic
1059187325 9:112286324-112286346 AAAAAAAATGACAAGATGGTGGG - Intronic
1059268448 9:113057489-113057511 AAGAAAAAAGAAAAGGTGGGAGG + Intergenic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1060699758 9:125740484-125740506 GATAAAAATTAGAAGGTGGTGGG + Intergenic
1060738053 9:126079195-126079217 CAGAAAAATGGGAAAGGGGTTGG + Intergenic
1061025235 9:128044158-128044180 TAGAAAAATGGAAAGGTGGCTGG + Intergenic
1061113581 9:128593135-128593157 CAGAAAGATGAGGTGGTGGGAGG + Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1062189060 9:135237985-135238007 CAAAATAATCAGCAGGTGGTGGG - Intergenic
1062434942 9:136542846-136542868 GAGAATAATGAGGAGGTGTTTGG - Intronic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1187148328 X:16657907-16657929 CAGAAAAATAGAAAGGTGGCCGG + Intronic
1187742269 X:22368809-22368831 AAAAAAAAAGAGGAGGTGGTTGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188072041 X:25729039-25729061 CAGAAAAATAGGAAGATGGATGG - Intergenic
1188697084 X:33207107-33207129 CAGACAAATGAGAATGAGGAAGG - Intronic
1189090773 X:38080399-38080421 CAGAAAGATGAGAACCTAGTTGG - Intronic
1189523361 X:41794136-41794158 CAAAGAAATTAGAAGGTGCTTGG - Intronic
1189718196 X:43886202-43886224 GAGGTCAATGAGAAGGTGGTAGG + Intergenic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1192202941 X:69078425-69078447 AAGAAAGAAGAGAAGGAGGTGGG - Intergenic
1193302577 X:79908063-79908085 CAGAAGGGTGAGAGGGTGGTAGG - Intergenic
1194366935 X:93024089-93024111 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1195031616 X:100932104-100932126 CTGAAAATAGAGAAGTTGGTGGG - Intergenic
1195063423 X:101218235-101218257 AAAAAAAATGATAAGTTGGTGGG + Intergenic
1195317627 X:103694206-103694228 AAGAAACAATAGAAGGTGGTGGG + Intergenic
1196753670 X:119139362-119139384 CAGGAAAGTGGGAAGGTGGGAGG + Intronic
1197446248 X:126554117-126554139 CAGAAAAATAAAGAGGGGGTTGG - Intergenic
1197641414 X:128972307-128972329 AACAAAATTGAGAAGATGGTTGG + Intergenic
1197883901 X:131197755-131197777 CAGAAAAGTGAAAAGATGTTTGG - Intergenic
1197917226 X:131549105-131549127 CAGCAAAATGAGACAGTTGTAGG + Intergenic
1198129659 X:133680990-133681012 CATAAAAATGAGAGGGGGGTAGG + Intronic
1198237307 X:134747351-134747373 AAGATAAATGAGGAGGGGGTGGG + Intronic
1198414061 X:136401931-136401953 CACAAATTTGAGAAGGTGGGAGG - Intronic
1198551490 X:137749785-137749807 TGAAAAATTGAGAAGGTGGTGGG + Intergenic
1198875153 X:141216742-141216764 CAGGACAAAGGGAAGGTGGTTGG + Intergenic
1199576311 X:149316832-149316854 CAGAAAAGTGGGAAAGGGGTCGG - Intergenic
1199869031 X:151879875-151879897 CAAAAAAATGACAAGGTCCTAGG - Intergenic
1200675157 Y:6140345-6140367 CAGAAAAGTGGGAAAGGGGTTGG - Intergenic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic
1201480131 Y:14429661-14429683 CAGAAACATGTGATGTTGGTGGG - Intergenic