ID: 1092389127

View in Genome Browser
Species Human (GRCh38)
Location 12:8059922-8059944
Sequence ACTTGGCTCTCCAGGGACAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 222}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092389127_1092389137 15 Left 1092389127 12:8059922-8059944 CCACTGTCCCTGGAGAGCCAAGT 0: 1
1: 0
2: 0
3: 25
4: 222
Right 1092389137 12:8059960-8059982 GCAAGGAGAGGCAGCAGAGGAGG 0: 1
1: 0
2: 5
3: 110
4: 867
1092389127_1092389139 30 Left 1092389127 12:8059922-8059944 CCACTGTCCCTGGAGAGCCAAGT 0: 1
1: 0
2: 0
3: 25
4: 222
Right 1092389139 12:8059975-8059997 AGAGGAGGTCCGCCAAGGTGAGG 0: 1
1: 0
2: 2
3: 9
4: 126
1092389127_1092389136 12 Left 1092389127 12:8059922-8059944 CCACTGTCCCTGGAGAGCCAAGT 0: 1
1: 0
2: 0
3: 25
4: 222
Right 1092389136 12:8059957-8059979 AGGGCAAGGAGAGGCAGCAGAGG 0: 1
1: 1
2: 13
3: 130
4: 1186
1092389127_1092389138 25 Left 1092389127 12:8059922-8059944 CCACTGTCCCTGGAGAGCCAAGT 0: 1
1: 0
2: 0
3: 25
4: 222
Right 1092389138 12:8059970-8059992 GCAGCAGAGGAGGTCCGCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 153
1092389127_1092389130 -8 Left 1092389127 12:8059922-8059944 CCACTGTCCCTGGAGAGCCAAGT 0: 1
1: 0
2: 0
3: 25
4: 222
Right 1092389130 12:8059937-8059959 AGCCAAGTGAGCCAGCGAGAAGG 0: 1
1: 0
2: 2
3: 9
4: 192
1092389127_1092389131 -7 Left 1092389127 12:8059922-8059944 CCACTGTCCCTGGAGAGCCAAGT 0: 1
1: 0
2: 0
3: 25
4: 222
Right 1092389131 12:8059938-8059960 GCCAAGTGAGCCAGCGAGAAGGG 0: 1
1: 0
2: 1
3: 10
4: 127
1092389127_1092389133 -2 Left 1092389127 12:8059922-8059944 CCACTGTCCCTGGAGAGCCAAGT 0: 1
1: 0
2: 0
3: 25
4: 222
Right 1092389133 12:8059943-8059965 GTGAGCCAGCGAGAAGGGCAAGG 0: 1
1: 0
2: 0
3: 29
4: 341
1092389127_1092389135 3 Left 1092389127 12:8059922-8059944 CCACTGTCCCTGGAGAGCCAAGT 0: 1
1: 0
2: 0
3: 25
4: 222
Right 1092389135 12:8059948-8059970 CCAGCGAGAAGGGCAAGGAGAGG 0: 1
1: 0
2: 2
3: 33
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092389127 Original CRISPR ACTTGGCTCTCCAGGGACAG TGG (reversed) Exonic
900179619 1:1305504-1305526 TGCTGGCTCTCCAGGGACACGGG - Intronic
900379042 1:2374549-2374571 CCTTCTCTCTGCAGGGACAGTGG - Exonic
901227308 1:7621231-7621253 CCTTGGCTCTCTTGGGCCAGTGG - Intronic
902853182 1:19177926-19177948 ACTTGGCCAGCCAGGCACAGTGG + Intronic
904893602 1:33797749-33797771 CCTGGGCTCTGCAGGGACTGAGG + Intronic
905255333 1:36678072-36678094 ACTTGGCTCCACATGGGCAGTGG + Intergenic
907840414 1:58151767-58151789 AATTAACTCTCCAGGGAAAGGGG - Intronic
908319918 1:62969094-62969116 ACCTGGCCCTTCAGGGCCAGTGG - Intergenic
908347006 1:63244101-63244123 ACTTGGCTCTCATGGAGCAGAGG - Intergenic
909133019 1:71763333-71763355 TCTTTGGTCTCAAGGGACAGGGG + Intronic
910451895 1:87355742-87355764 ACTTGGTTCTCCACGTACATGGG - Intergenic
913130466 1:115834156-115834178 ACCTTCCTCTCCAGGGAGAGGGG - Intergenic
914329021 1:146648713-146648735 ACCTGGGTCTCCAGGACCAGTGG - Intergenic
914417868 1:147501090-147501112 ACTTGGCTCTCATGGCACAGAGG - Intergenic
919359792 1:196578319-196578341 ACTTGTCTTTCCAGGTACTGAGG - Intronic
919755067 1:201061549-201061571 TCTTGGCTCTCCACAGCCAGTGG - Intronic
924303670 1:242665316-242665338 GCTTGGCACTCCAAGGACTGGGG - Intergenic
924334639 1:242974995-242975017 ACTTGGCTCTCGTGGCGCAGAGG - Intergenic
1063244181 10:4201648-4201670 ACCTGCCTCTCCAGGGACATGGG - Intergenic
1064349166 10:14560607-14560629 ACATGGCTCACCTGCGACAGGGG + Intronic
1067561615 10:47308613-47308635 ACTGGGCTCTCTAGGGGCATGGG - Intronic
1068687430 10:59883402-59883424 AGTTGGCTCATCAGGGACATCGG - Intronic
1068852467 10:61759730-61759752 ACTTGGTTCTCCACCTACAGAGG + Intronic
1070550747 10:77488831-77488853 ACTTGGTTTTCCAGGGCCATAGG + Intronic
1070698675 10:78582752-78582774 GCCTGGAACTCCAGGGACAGAGG + Intergenic
1070787397 10:79169937-79169959 ACTTCCCTCTCCAGAGACAATGG + Intronic
1072467550 10:95680557-95680579 ACCTGGATCTCCAGGGAAACTGG + Exonic
1073438198 10:103535233-103535255 ACTTTACTCCCCAGGGAGAGGGG + Intronic
1073632420 10:105162002-105162024 ACTTGCCCCTGCAGGGGCAGGGG - Intronic
1074520242 10:114214205-114214227 ACTTGGCTCTTCTTGGAAAGAGG - Intronic
1074754048 10:116611289-116611311 GGTTGGATCTCCAGGGGCAGGGG + Intergenic
1074976798 10:118587577-118587599 ACCTCGCCCTCCAGGGACAGAGG + Intergenic
1075875116 10:125799691-125799713 GCTTGGCTCTGCAGGCACACAGG + Intronic
1075965682 10:126609781-126609803 ACGTGGCTCTGCATGGGCAGGGG + Intronic
1076228278 10:128798838-128798860 GCTTGGCTCTGCAGGAACTGGGG + Intergenic
1077286328 11:1767620-1767642 CCTCAACTCTCCAGGGACAGAGG - Intergenic
1078356436 11:10635442-10635464 ATTTGGCCCACCAGGGAAAGTGG - Intronic
1078842475 11:15091644-15091666 ACTGTACTCTCCAGGGAGAGGGG + Intergenic
1079935223 11:26608581-26608603 GCCTGGGTCCCCAGGGACAGGGG - Intronic
1083911575 11:65713034-65713056 TCCTGGCTCTCCAGAGAGAGAGG + Exonic
1084572627 11:69968728-69968750 ACTTGGACCTCCAAGGGCAGAGG + Intergenic
1085695958 11:78704968-78704990 CCCTGGCTCTGCAGGGACAGAGG - Intronic
1085764849 11:79273903-79273925 GCCTGGCCCTCCAGGGGCAGCGG + Intronic
1086753531 11:90529680-90529702 AGCTGGCTCTCCAGGGTCATTGG - Intergenic
1087423962 11:97966748-97966770 ACTGGGGTCTCCAGGCACAATGG + Intergenic
1088560966 11:111115987-111116009 ACATGGCTCTCCAGGGAAAAGGG - Intergenic
1088910358 11:114186412-114186434 ACCTTGTTCTCCAGGCACAGGGG + Intronic
1089322836 11:117638076-117638098 GCTGGGCTCTCCTGGGGCAGGGG + Intronic
1089614717 11:119688736-119688758 CCTTGTTTGTCCAGGGACAGAGG + Intronic
1090388152 11:126368543-126368565 CCGTGGCTCTCCTGGGACACAGG + Intronic
1092389127 12:8059922-8059944 ACTTGGCTCTCCAGGGACAGTGG - Exonic
1093468125 12:19471402-19471424 ACTAGACTCACCAGGCACAGTGG - Intronic
1093917882 12:24825922-24825944 TCTTCGCTGGCCAGGGACAGTGG + Intronic
1095125049 12:38466999-38467021 AGTTGGCTCTCATGGCACAGAGG + Intergenic
1096539788 12:52300509-52300531 ACTTGACTCTCCTGGGAAATAGG - Intronic
1097264805 12:57738672-57738694 AATTGGGACTCAAGGGACAGGGG + Intronic
1098230532 12:68368409-68368431 AATTGGCTTGCCAAGGACAGGGG - Intergenic
1100277414 12:93083663-93083685 ACTTGGCTCTCATGGCACAGAGG + Intergenic
1100458486 12:94775831-94775853 CCTTCGCTCTCCAGGGAAAGGGG + Intergenic
1101630882 12:106493295-106493317 ACTGTTTTCTCCAGGGACAGAGG - Intronic
1101828059 12:108236210-108236232 ACTGAGGTCTCCAGGGGCAGGGG - Intronic
1102585321 12:113919072-113919094 AATTGGCTCTGCAGGTTCAGTGG - Intronic
1103352059 12:120290924-120290946 CCTGGGCTGTCCATGGACAGAGG - Intergenic
1107448829 13:40490609-40490631 ACTTAGCTTTCCAGAGACTGAGG + Intergenic
1112781211 13:102903157-102903179 ATATCGCCCTCCAGGGACAGAGG - Intergenic
1113470188 13:110538844-110538866 TCTTGCCTGGCCAGGGACAGTGG - Intronic
1113679036 13:112229524-112229546 ACTTGGCGCCCCCGAGACAGGGG + Intergenic
1114549576 14:23525235-23525257 ACTTCGCTCTTCAGGGGCACGGG + Exonic
1116012953 14:39372221-39372243 ACTTGGCTTTCTAGGAAAAGAGG - Intronic
1117022695 14:51587944-51587966 ACTTGACTCTCAGGGGTCAGGGG - Intronic
1118603656 14:67487909-67487931 ACATGGCTGGCCAGGCACAGTGG - Intronic
1119657434 14:76427183-76427205 GGCTGCCTCTCCAGGGACAGAGG - Intronic
1119670142 14:76512247-76512269 TCTTGCCTTTCCAGGGATAGTGG + Intergenic
1122202503 14:100131058-100131080 ACCTAGCTCTCCAGGCACAGGGG - Intronic
1124274630 15:28315683-28315705 ACTTGGCTCTCATGGCGCAGAGG - Intronic
1125477462 15:40056761-40056783 TCTCGGCTCTCCCAGGACAGGGG - Intergenic
1125815947 15:42584319-42584341 ACGGGGCTCCCCAGGGACAAAGG + Intronic
1127539095 15:59919672-59919694 CCTCGACTCTCCAGGGACTGGGG + Intergenic
1128053369 15:64682414-64682436 ACAGGGCTCCCCAGGGACACTGG + Exonic
1129220255 15:74128280-74128302 ACTGGGCTCTCCAGGGTCGAAGG + Exonic
1129856041 15:78825934-78825956 TCTGGGCTCTCCAGGGACTCCGG + Intronic
1130967485 15:88708150-88708172 GCCAGGCTCTCCATGGACAGGGG + Intergenic
1131118897 15:89810957-89810979 ACTTGTGTCTCCAGGGCAAGTGG - Intronic
1131345744 15:91646711-91646733 ACTTGGCAATGCAGGGCCAGTGG + Intergenic
1133246356 16:4451365-4451387 ATTTGGAGCTCCAGGGGCAGGGG + Intronic
1135916994 16:26614222-26614244 ACGTGGCCCTCCAGTGCCAGAGG - Intergenic
1136061837 16:27731945-27731967 GCCTGGCTCTCCAGTGACAACGG - Intronic
1137269617 16:46894622-46894644 CCCTGGCTCTCCAGACACAGTGG + Intronic
1137520563 16:49191590-49191612 AACTGGGTCTCCAGGGAAAGGGG + Intergenic
1139176808 16:64699135-64699157 ATTTGGCTCTGCAAGGTCAGAGG + Intergenic
1140004545 16:71062230-71062252 ACCTGGGTCTCCAGGACCAGTGG + Exonic
1141187618 16:81799006-81799028 TCTTGCCTCCCCAGGGACACGGG - Intronic
1142247571 16:88976937-88976959 CCTCGGCTTTCCAGGGACAGAGG - Exonic
1142263556 16:89053482-89053504 ACCTGCGTCTCCAGGGTCAGAGG - Intergenic
1142321556 16:89386456-89386478 TCTTTTCTCACCAGGGACAGTGG + Intronic
1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG + Intergenic
1142990893 17:3730125-3730147 ACCTGGCTCCCCAGGGTCACTGG + Intronic
1143109068 17:4543453-4543475 ACTTGTCTCTCATGGGGCAGTGG + Intronic
1143778918 17:9219270-9219292 ACTGGGCTGTCCAGAGAGAGTGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144266819 17:13577483-13577505 ACTTCTCCCTCCCGGGACAGAGG + Intronic
1146680560 17:34804532-34804554 AATTGTTTCTCCAGGAACAGAGG + Intergenic
1147253470 17:39167182-39167204 ACTTGGTTCTCCAGCCACATGGG + Intronic
1148804632 17:50257957-50257979 ACGTGGCTCTCTAGGCCCAGTGG + Intergenic
1150902100 17:69291823-69291845 ACTAGGCTGGCCAGGCACAGTGG + Intronic
1151068539 17:71180925-71180947 TCTTGGGTTTACAGGGACAGAGG - Intergenic
1151473079 17:74329988-74330010 TCTGGGCTCCCCAGGGGCAGGGG + Intronic
1151576317 17:74954169-74954191 GCCTGGCTCTGCAGGGGCAGCGG + Exonic
1152442569 17:80317956-80317978 AAATGGCTCTCCATGGAGAGGGG + Intronic
1153962032 18:10148042-10148064 ACTGGGCTCTGCAGGGTCAGAGG - Intergenic
1154409166 18:14127033-14127055 ACTTAGCTGGACAGGGACAGGGG - Intronic
1155062182 18:22238372-22238394 TCTTGGCTTCACAGGGACAGTGG + Intergenic
1156511091 18:37637455-37637477 CCTGGGCTCTCCAGGCACAGTGG - Intergenic
1158063510 18:53377006-53377028 ACTAGGCAGTCCAGGGAAAGTGG - Intronic
1160630816 18:80246077-80246099 ACTTGCCTCCCCAGAGACAGGGG + Intronic
1163751669 19:19081820-19081842 GAATGGGTCTCCAGGGACAGAGG - Intronic
1164884872 19:31769978-31770000 AATTGGGCCTCCAGGGACACAGG - Intergenic
1166297314 19:41895453-41895475 TCTGGGCTGTCCAGGGACAGAGG - Exonic
1167145527 19:47679413-47679435 CCTGGGCTCTCCTGCGACAGGGG + Exonic
925331490 2:3062323-3062345 ACGTGGCTCTCCAGAGGAAGGGG - Intergenic
925443759 2:3910140-3910162 ACCTTCCTCTCCAGGCACAGAGG + Intergenic
926306045 2:11637848-11637870 TCATGGTTCTTCAGGGACAGCGG - Exonic
928399947 2:30970692-30970714 TCTTTACTCTGCAGGGACAGAGG - Intronic
930971881 2:57406327-57406349 ACTGGGCTCTCCTGAGAGAGAGG + Intergenic
931909450 2:66881172-66881194 ACTTGGCTCTCATGGTGCAGAGG + Intergenic
933150458 2:78909073-78909095 AGTTGGCTTTCCAGGTACAAAGG - Intergenic
933655364 2:84882074-84882096 ACTTGGCTCTTCAAAGCCAGGGG - Intronic
933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG + Exonic
934969568 2:98751957-98751979 ACCTCACCCTCCAGGGACAGTGG + Intergenic
935333458 2:101994327-101994349 ACTCTGCTCTCCAGGGGGAGGGG - Intronic
936040013 2:109142523-109142545 CCTGGGCTCCCCAGGGACAACGG + Intronic
936682032 2:114785048-114785070 TGTTGGCTCTCTAGGGAAAGTGG + Intronic
936920457 2:117683561-117683583 ACTGGGGACTCCAAGGACAGGGG + Intergenic
937246100 2:120494765-120494787 ACTGGGCTCTCCAAGGACCCAGG - Intergenic
940063282 2:149596798-149596820 ACTTGGCTCTTATGGCACAGAGG + Intergenic
941670228 2:168284913-168284935 ATATGGCTCTCCAGGGCCAGTGG - Intergenic
941975138 2:171395982-171396004 ATTTGGCTGGCCAGGCACAGTGG + Intronic
943529907 2:189066398-189066420 AGTTGGTCCTCCAGGGCCAGTGG - Exonic
943912328 2:193584485-193584507 AGTTGGCTCTCCAGGAAGGGAGG - Intergenic
945772607 2:214063213-214063235 TCTTGCCTCTCCAGGCACATTGG + Intronic
947145476 2:227060154-227060176 ACCTGGCACACCAGGAACAGCGG - Exonic
947267923 2:228303123-228303145 ACTGGGGTCTCCAAGCACAGTGG + Intergenic
948426028 2:237887002-237887024 ACTTGGCTGTCCTGGGACACAGG + Intronic
949035409 2:241813823-241813845 ACGGGGCTCTCTGGGGACAGGGG - Intronic
949035426 2:241813882-241813904 ACGGGGCTCTCTGGGGACAGGGG - Intronic
949035443 2:241813941-241813963 ACGGGGCTCTCTGGGGACAGGGG - Intronic
1169527561 20:6446708-6446730 ACTTTGCCCTACAGGTACAGAGG - Intergenic
1171040134 20:21755260-21755282 ACTTGGCTCTCATGGCGCAGAGG - Intergenic
1171453769 20:25255038-25255060 ACTTGGCTTCCCATGAACAGTGG - Intronic
1173015903 20:39225542-39225564 AGCTGACTCTCCAGGGTCAGTGG + Intergenic
1175364749 20:58445063-58445085 ACCAGACTCTCCAGAGACAGAGG - Exonic
1178638504 21:34326813-34326835 AGTGGGCTTTCAAGGGACAGAGG - Intergenic
1178668043 21:34566107-34566129 AATGGGCTGTCTAGGGACAGAGG + Intronic
1178730505 21:35097955-35097977 ACATTGTTCTCCATGGACAGTGG - Intronic
1178876213 21:36416089-36416111 TTTTGCCTCTCAAGGGACAGTGG - Intronic
1179727107 21:43346798-43346820 ACGAGGCCCTCCAGGGACAGTGG - Intergenic
1180869482 22:19138204-19138226 ACTTTTCTCACCAGGGGCAGGGG + Exonic
1180937200 22:19633544-19633566 ACTCAGCTCTCCAGAGACGGAGG - Intergenic
1181808519 22:25389969-25389991 ACTTGGCTGATCAGTGACAGGGG + Intronic
1181993376 22:26855498-26855520 ACCTGTCTCTCCAGCCACAGAGG - Intergenic
1182684851 22:32114113-32114135 ACTTCACTCTGTAGGGACAGAGG + Intergenic
1183131220 22:35838645-35838667 ACTTGGCTCTCATGGCACAGAGG + Intronic
1183303742 22:37071022-37071044 ACATGGCACCCCTGGGACAGAGG + Exonic
1183483520 22:38077523-38077545 ACTTGGGTGTCCAGGGCCAGGGG - Intergenic
1183663947 22:39236693-39236715 CCTTGGGTCTCCTGGGACTGTGG - Intronic
1183709985 22:39497491-39497513 ACTTAGCTCTCGTGGCACAGAGG + Intergenic
1183866829 22:40710833-40710855 ACTTGGCTCCCCACGGCCACAGG + Intergenic
1184911778 22:47540132-47540154 TCCTGTCTCCCCAGGGACAGAGG + Intergenic
1184992837 22:48182254-48182276 CCTTGGCTCTGTAGGGAGAGAGG - Intergenic
1185375948 22:50482644-50482666 ACCGGGCCCTCCAGGCACAGAGG + Exonic
949503697 3:4706190-4706212 ACTTGGCTGTCCAGGTCCACGGG - Exonic
951077374 3:18412186-18412208 ACTTTAATCTCCAGGGACACTGG + Intronic
953240087 3:41140963-41140985 ACTTGGGTCTCCTGGTACTGTGG - Intergenic
955878700 3:63521485-63521507 ACTTGGCAATCCAGTGACATTGG + Intronic
958165886 3:89877377-89877399 CCTTGACTCTGCAGGGACGGGGG + Intergenic
959274130 3:104255862-104255884 ACTTGTAACTGCAGGGACAGGGG + Intergenic
959860238 3:111207839-111207861 TCTTGGTTTTCCAGTGACAGGGG - Intronic
961033990 3:123629618-123629640 TCTTGTCTCTCCAGAGTCAGTGG - Exonic
962257214 3:133880746-133880768 ACCTGGCTCTGCAGGGGCAGGGG - Intronic
962924175 3:139976595-139976617 ACTTGGCACTCTGGGCACAGTGG - Intronic
964643667 3:158935750-158935772 ACTGCACTCTCCAGGGACAGTGG + Intergenic
968489381 4:881879-881901 GCGTGGCCCTCCGGGGACAGGGG - Intronic
968508212 4:982159-982181 CCCAGGCTCTCCTGGGACAGAGG + Intronic
968729989 4:2265061-2265083 ACTGGGCTCCCCAGGGAAGGAGG - Intergenic
969499793 4:7545698-7545720 ACCAGGCTCTCCAGGGCCTGTGG - Intronic
973265684 4:48208070-48208092 ACTTGGCTTCCCAGAGGCAGGGG + Intronic
973910793 4:55578220-55578242 ACATGGATGTACAGGGACAGAGG - Intronic
976078999 4:81333493-81333515 ACTTTTCTGTCCAGTGACAGAGG + Intergenic
976264552 4:83178293-83178315 ACTTGGTTGGCCAGGCACAGTGG + Intergenic
977994257 4:103483311-103483333 ACCTGGCTCTACAGGGGCATGGG + Intergenic
978171069 4:105670871-105670893 ACTTGGCTCTACAGGGACTTTGG + Intronic
979242472 4:118460289-118460311 ACTTGGCTCTCATGGCGCAGAGG + Intergenic
984800471 4:183711125-183711147 ACTTGTCACTCTAAGGACAGTGG + Intronic
985976914 5:3426625-3426647 ACTAGAGCCTCCAGGGACAGGGG - Intergenic
986008131 5:3684947-3684969 CCTGGGCTCCCCAGAGACAGAGG - Intergenic
986284861 5:6351685-6351707 CTTTGGCTCTCCAGGGAGTGCGG - Intergenic
992233781 5:74687354-74687376 CCTGGGCTCTTCAGAGACAGGGG - Intronic
995416843 5:111922246-111922268 ACTGGGGTCTCCAGGCACAATGG + Intronic
997475432 5:134139770-134139792 ACTTGGCTCCCCAAGGAGATCGG + Intronic
999812743 5:155143177-155143199 AATTTGATCTCCAGGGTCAGAGG - Intergenic
1001312331 5:170620168-170620190 ACAAGGCTCTCTAGGGACAAGGG - Intronic
1001428709 5:171642854-171642876 GCTTGGCTCAGCAGGGCCAGGGG - Intergenic
1001783922 5:174395330-174395352 ACTGGGATCTCCATGCACAGTGG - Intergenic
1002528947 5:179832347-179832369 ACGTGACTCACCAGGGACAGAGG - Intronic
1003196273 6:3918057-3918079 ACTAGACTCGCCAGGCACAGTGG + Intergenic
1004309853 6:14535493-14535515 ACTTGGCTCTACTGAGACATTGG - Intergenic
1006295974 6:33170289-33170311 ACATTGGTCTCAAGGGACAGGGG + Intronic
1016092108 6:139992724-139992746 ACTGGGCTTGCCAGGCACAGGGG + Intergenic
1017768733 6:157628362-157628384 AGTTGCCTACCCAGGGACAGTGG - Exonic
1019660806 7:2223037-2223059 AGTTGCCTCTGCAGGGAGAGGGG + Intronic
1020507608 7:9013496-9013518 AATTGACTCTAAAGGGACAGAGG - Intergenic
1026904735 7:74056493-74056515 GCTCGGCTCTGCAGGGGCAGTGG + Intronic
1028205572 7:88012960-88012982 CCTTGGCTCTAGAGGGAAAGAGG - Intronic
1028880703 7:95876423-95876445 ACTTGGCTCTCAAACTACAGTGG + Intronic
1029714761 7:102319881-102319903 TTTTGGCTCTGCAGGGACAGAGG + Intronic
1031084356 7:117287571-117287593 TCTTGTCTCCCCAGGGACAGGGG + Intronic
1032614958 7:133458441-133458463 ACATGTCACTCCAGGGACACAGG + Intronic
1033001826 7:137513849-137513871 ACTTGGCTCTCATGGCGCAGAGG - Intronic
1034692737 7:153027051-153027073 ACTGAGCTCTCCAGAGAAAGCGG + Intergenic
1036210519 8:6836572-6836594 ACTAGACTCTGCAGGAACAGAGG + Intergenic
1037385616 8:18337139-18337161 ACTTTGCTTTTCAGGCACAGAGG - Intergenic
1038849171 8:31257565-31257587 AGCTTCCTCTCCAGGGACAGTGG - Intergenic
1041279795 8:56198307-56198329 ACGTGGCTGTGCAGGCACAGAGG + Intronic
1045510326 8:102807987-102808009 ACTCGGTTCCCCAGGGGCAGCGG - Intergenic
1046613187 8:116447754-116447776 ATTTTGCTCTACAGTGACAGAGG - Intergenic
1046759754 8:118009093-118009115 CATTGGCTTACCAGGGACAGAGG + Intronic
1047675470 8:127196997-127197019 ACTTGACTATCAAGGAACAGAGG + Intergenic
1050331830 9:4553652-4553674 AGTGGGCTCTCCAGGTGCAGTGG - Intronic
1053365656 9:37520835-37520857 ATTTGGTACTGCAGGGACAGGGG + Intronic
1055938314 9:81623945-81623967 ACTAGGATGTCCAGAGACAGAGG + Intronic
1056186553 9:84140613-84140635 ACCTGGCTCCCCAGGCAAAGCGG + Intergenic
1056190568 9:84180506-84180528 ATGAGGCTCTCCAGGCACAGAGG + Intergenic
1056803403 9:89709764-89709786 ACTTGGCTCTCGCGGTGCAGAGG - Intergenic
1058102410 9:100931874-100931896 TCTTGCTTCTCCAGGGAGAGTGG - Intergenic
1060645302 9:125273866-125273888 ACTTGGCTGTCATGGCACAGAGG + Intronic
1061572448 9:131486099-131486121 ACATGGCCATCCAGGTACAGGGG - Exonic
1062320766 9:135989596-135989618 TCGTGGCTCTCCAGGGACCTGGG - Intergenic
1062339620 9:136088155-136088177 CCTTGGCTGTGCAGGGTCAGCGG + Intronic
1062635463 9:137488315-137488337 TCTCGCCTCTCCAGGGACTGAGG + Intronic
1185702459 X:2241587-2241609 ACGAGTCTCTGCAGGGACAGAGG - Intronic
1186122996 X:6383414-6383436 AAGTGGCTCTCCAGGGGCACTGG - Intergenic
1189337962 X:40182266-40182288 CCAGGGCTCTCCAGGGACTGGGG - Intergenic
1190992540 X:55566773-55566795 CCTTGACTCTCCAGAGTCAGGGG - Intergenic
1194141755 X:90217752-90217774 ACTGGACTCTCCAGAGACATGGG + Intergenic
1200238223 X:154479339-154479361 ACTGGGGCCTCCAGGGACAAGGG - Intergenic
1200487508 Y:3786853-3786875 AGTGGACTCTCCAGGGACATGGG + Intergenic
1202390214 Y:24362397-24362419 ACTTGGCTCTCATGGCGCAGAGG + Intergenic
1202480570 Y:25307719-25307741 ACTTGGCTCTCATGGCGCAGAGG - Intergenic