ID: 1092399547

View in Genome Browser
Species Human (GRCh38)
Location 12:8162643-8162665
Sequence GCTCTCCGTGGGAGAAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092399547_1092399555 28 Left 1092399547 12:8162643-8162665 CCCTATCTTCTCCCACGGAGAGC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1092399555 12:8162694-8162716 AGAAAGCCACAAGGGAAAATGGG 0: 1
1: 0
2: 3
3: 46
4: 460
1092399547_1092399552 19 Left 1092399547 12:8162643-8162665 CCCTATCTTCTCCCACGGAGAGC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1092399552 12:8162685-8162707 AGGAGTCAAAGAAAGCCACAAGG 0: 1
1: 0
2: 3
3: 51
4: 426
1092399547_1092399554 27 Left 1092399547 12:8162643-8162665 CCCTATCTTCTCCCACGGAGAGC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1092399554 12:8162693-8162715 AAGAAAGCCACAAGGGAAAATGG 0: 1
1: 2
2: 6
3: 72
4: 766
1092399547_1092399553 20 Left 1092399547 12:8162643-8162665 CCCTATCTTCTCCCACGGAGAGC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1092399553 12:8162686-8162708 GGAGTCAAAGAAAGCCACAAGGG 0: 1
1: 0
2: 3
3: 32
4: 277
1092399547_1092399551 -1 Left 1092399547 12:8162643-8162665 CCCTATCTTCTCCCACGGAGAGC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1092399551 12:8162665-8162687 CAAGAAAAGTTAAAAGAAGTAGG 0: 1
1: 1
2: 7
3: 78
4: 801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092399547 Original CRISPR GCTCTCCGTGGGAGAAGATA GGG (reversed) Intronic
903812846 1:26044461-26044483 GCTCTCTGGGGGAGCTGATAAGG - Intronic
906307876 1:44732158-44732180 GGTCTTCATGGGAGAAGAGAAGG - Intergenic
906431197 1:45757020-45757042 GGTCTGCGTGGGAGAAGATGGGG + Intergenic
907144611 1:52220783-52220805 GGTCTACGTGGGAGAAGATGGGG + Intronic
907974286 1:59415834-59415856 GCTCTCTGTTGTAGAAGCTACGG - Intronic
912505778 1:110154925-110154947 GCTCTCTGTGGGAAAAGACCAGG - Intronic
915228274 1:154427384-154427406 GCCCACCGTGGGAGAAAGTAAGG + Intronic
918120124 1:181531040-181531062 GTTCTCCTTAGGAGAATATATGG - Intronic
918496945 1:185150783-185150805 GCTCTCAGTGGCAGAAAATTTGG - Intronic
918937938 1:190948569-190948591 CCTTTCAGTGGGACAAGATATGG + Intergenic
920680250 1:208066778-208066800 CCTCACAGTGGGACAAGATAAGG + Intronic
1063903477 10:10759750-10759772 CCTCTCCCTGCCAGAAGATAAGG + Intergenic
1064430995 10:15269729-15269751 GCTCTCCATTGGAGAGGAAAGGG + Intronic
1069118735 10:64540838-64540860 CCTCCCAGTGGGACAAGATATGG + Intergenic
1069153195 10:64991899-64991921 CCTCTCAGTGGGAGAAGATGTGG + Intergenic
1069266053 10:66459049-66459071 GCTGTCTCTGGGAGAAGATGAGG - Intronic
1072061354 10:91814148-91814170 CCTTCCAGTGGGAGAAGATATGG + Intronic
1072738556 10:97895923-97895945 ACTCTCCATGGGACAAGATGAGG + Exonic
1075881784 10:125858752-125858774 CCTCTCTGTGGGAGAAGACAGGG + Intronic
1079656889 11:22995871-22995893 GCTCTCTGGGAGAGAAGATAGGG + Intergenic
1085154135 11:74277841-74277863 GGTCTCCTGGGGAGACGATAAGG + Intronic
1085349352 11:75788612-75788634 GTTTCCCATGGGAGAAGATAAGG - Intronic
1087190519 11:95249603-95249625 GCACTCCGTGTGAGAAGACACGG - Intergenic
1089033741 11:115362293-115362315 ACTCTCAGTGGTATAAGATAGGG - Intronic
1092399547 12:8162643-8162665 GCTCTCCGTGGGAGAAGATAGGG - Intronic
1092499899 12:9034911-9034933 ACTCCCAGTGGGACAAGATAAGG + Intergenic
1092985047 12:13837258-13837280 GCTCTTGGTTGGAGGAGATAGGG - Intronic
1093272954 12:17088593-17088615 TCTCTCTGAGGGAGGAGATAAGG - Intergenic
1093904103 12:24669074-24669096 TCTCTCAGTGGGACAAGATGTGG + Intergenic
1094218728 12:27971246-27971268 GCTCTGCCTGGGAGAAGCGACGG + Intronic
1096648066 12:53048862-53048884 GGACTCCGTGGGAGAAGCCAGGG + Intronic
1097351642 12:58555683-58555705 GCTCTCCTTGGGAGATGCTGAGG - Intronic
1098342578 12:69468050-69468072 GCTCTCAGTGAAAGAAGATGAGG - Intergenic
1100810269 12:98330571-98330593 CCACCCCGTGGGAGAAGAAAGGG - Intergenic
1102205828 12:111090187-111090209 GCTCTCCGTGGGGCCAGATGAGG + Intronic
1102939484 12:116926699-116926721 GCTCTCTGTGGGCAAAGAGAAGG - Intronic
1103236865 12:119380380-119380402 GCTCTCCAGGGGAGAAGGAAAGG - Intronic
1103447513 12:121003916-121003938 GCCCTCCGTGGGAGCACAGAGGG + Exonic
1103536129 12:121634922-121634944 GCTCTCCGAGGAAGAGGAAAGGG - Intronic
1104289149 12:127452951-127452973 GCACTAGGTGGGAGGAGATATGG + Intergenic
1108256649 13:48617829-48617851 GGTTTCCGTGGGACCAGATAAGG + Intergenic
1110227913 13:73139398-73139420 GCTCTCAGTGGGGGACGACAAGG - Intergenic
1112812007 13:103229487-103229509 TCTCTCTGTGGGAGAAGTTTTGG + Intergenic
1114262496 14:21048078-21048100 GCTCTCCCAAGGAGAAGAGAAGG - Intronic
1115520765 14:34231060-34231082 GCTCTTCCTTGGAGAGGATAAGG - Intronic
1115861934 14:37696183-37696205 GCCCTCCTTGGGAAAAGCTATGG - Intronic
1120926376 14:89801276-89801298 GCACTCCCTTGGTGAAGATAGGG - Intronic
1128078654 15:64843295-64843317 TCTCTCAGTGGGTGAAGGTAGGG + Intronic
1131113130 15:89777403-89777425 CGGCTCCGTGGGAGAAGAGATGG + Intronic
1138155970 16:54703040-54703062 GCGCTCCGTGGGTAATGATATGG - Intergenic
1140898600 16:79347886-79347908 TCTCTCCGTGGTGGAAGAAAGGG + Intergenic
1141363243 16:83417268-83417290 GCTGTTCTGGGGAGAAGATAAGG - Intronic
1142059574 16:88020721-88020743 GCTCCTCGGGGGAGAAGACAGGG + Intronic
1144766086 17:17733332-17733354 GCACTGCGTGGGGAAAGATAAGG + Intronic
1149340611 17:55682373-55682395 GCTCTCTGTAGGAGAAGTTTTGG + Intergenic
1155093994 18:22538325-22538347 GCACTCAGTGGGGGAAGTTAGGG - Intergenic
1157951800 18:52046852-52046874 GCTATCCATGAGAAAAGATAAGG - Intergenic
1159945796 18:74443931-74443953 GCTCTCCCTGGGAGATGAGAAGG - Intronic
1160031152 18:75261070-75261092 TGTCTCCGTGGGAGGAGATGTGG - Intronic
1161806127 19:6444080-6444102 GCTCTACTTGGGAGAAGCTGGGG + Intronic
1162515011 19:11142608-11142630 GCTCTCAGAGGGAGAACAAACGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1163348920 19:16763103-16763125 GGTCTCGGGGGGAGAAGAGAAGG - Intronic
1163501193 19:17677306-17677328 GCTCAGTGTGGGAGAAGATTGGG - Intronic
1165271542 19:34711884-34711906 GCTTTCTGTCGGAGAAGAAATGG - Intergenic
927523808 2:23719756-23719778 GCTTTCTGTGGGTTAAGATAAGG - Intergenic
929075337 2:38075553-38075575 ACTCTCCCTTGGAGAAGAGAAGG + Intronic
929096389 2:38267031-38267053 GCTATCCCTGGGAGGTGATATGG - Intergenic
931461008 2:62450130-62450152 GCTCTCCATGGGAAATGACATGG - Intergenic
934883690 2:98006120-98006142 GCTCTCAGAGGGAGAACAAACGG - Intergenic
935499472 2:103820596-103820618 CCTCTCCTTCTGAGAAGATAGGG - Intergenic
935958600 2:108402039-108402061 GCTTTCTGGGGGAGAAGATAGGG - Intergenic
944317518 2:198299091-198299113 CCTTCCAGTGGGAGAAGATATGG + Intronic
947066161 2:226227776-226227798 GCTTTGCTTGGAAGAAGATAGGG + Intergenic
948645087 2:239399730-239399752 GCTCTCCGTGAGGGAGGAAAGGG - Intronic
1170705414 20:18740012-18740034 GCTCTCGGTGGGAGGGGATAGGG + Intronic
1173329725 20:42064934-42064956 ACTCACTGTGGGTGAAGATATGG + Intergenic
1177737932 21:25116319-25116341 CCTTTCAGTGGGAGAAGATGTGG - Intergenic
1178521612 21:33292049-33292071 GCTCTCAGTGGGAGTTAATATGG + Intronic
1179253694 21:39696974-39696996 CCTCTCAGTAGGAGAAGAGAAGG + Intergenic
1183240877 22:36657465-36657487 GCTCTGCCTGGGAGAAGAAGAGG + Intronic
949242490 3:1889208-1889230 GGTCTGCGTGGGAAAAGATGGGG - Intergenic
950144030 3:10635097-10635119 CCTCTCTGTGGGAGACAATACGG + Intronic
954693357 3:52407458-52407480 GCTCTACGGGGAAGAAAATAAGG + Exonic
955510546 3:59676400-59676422 GCTCTCCTTAGGAGATGAGAGGG + Intergenic
956742568 3:72286721-72286743 GGACTCCGAGGGAGAAGATGTGG - Intergenic
956890999 3:73613890-73613912 GATCTCCCTGGGAGAAGCTTAGG + Intronic
961040067 3:123671914-123671936 GCTCTCCAGGGAAGAAGAGAGGG + Intronic
962266114 3:133945462-133945484 GCTCCCAGTGGCAGAAGAAATGG - Intronic
962314530 3:134350904-134350926 GCTCCCTCTGGGAGAGGATAGGG - Intergenic
964174057 3:153804250-153804272 GCTTTCAATGGGAGATGATAAGG - Intergenic
967426255 3:189330711-189330733 GTACTCCTTGGGAGAAGATCTGG + Intergenic
967879982 3:194294973-194294995 GGTCTCCCTGGGAGAGGTTAAGG - Intergenic
970457406 4:16238716-16238738 GCCCTCCGTGGATGAAGATAAGG - Intergenic
971791298 4:31173160-31173182 CCTCTCAGTGGGACAAGATGTGG + Intergenic
972614608 4:40686076-40686098 AATCTCCGTGGCAGAAGACAAGG + Intergenic
972875480 4:43353392-43353414 ACACTTCGTGGGAGATGATAAGG + Intergenic
980850886 4:138380014-138380036 GCTCTCAGTTGGAGAAAATTAGG + Intergenic
984937048 4:184898541-184898563 GGCCTCCGTGGGAGAAGCTGAGG + Intergenic
988104630 5:26728671-26728693 ATTCTCCTTGGGAGAAGACAAGG - Intergenic
988160757 5:27516367-27516389 ACTCTCCGTGGAAGGAGAAATGG - Intergenic
990813924 5:59761651-59761673 GCTTCCAGTGGGACAAGATATGG - Intronic
991149648 5:63352111-63352133 GCACTCAGTGGGATGAGATAGGG + Intergenic
991950622 5:71943822-71943844 GCTCTTCGTGAAAGAAGAAATGG - Intergenic
993894243 5:93512161-93512183 GCTCCCAGTGGGACAAGATGTGG + Intergenic
995354342 5:111221678-111221700 GCTTTCAGTGGGACAAGATGTGG + Intergenic
998197688 5:140089447-140089469 CAAATCCGTGGGAGAAGATAAGG + Intergenic
1000363937 5:160473538-160473560 GCTCCACGGCGGAGAAGATATGG - Intergenic
1004540908 6:16549028-16549050 CCTCTCAGTGGGACAAGATGTGG - Intronic
1006049712 6:31332415-31332437 GATCTGCTTGAGAGAAGATAGGG + Intronic
1013332956 6:109124103-109124125 GCTCTATGTGAGAGATGATAAGG - Intronic
1017971504 6:159315849-159315871 CCTCCCCGTGGGAGAGGATCAGG - Intergenic
1019297428 7:285559-285581 TCTTTCCCTGGGAGAGGATAAGG + Intergenic
1019316314 7:388548-388570 GCTCTTCGCGGGAGAAGTGAGGG + Intergenic
1019997269 7:4732768-4732790 GCTTTCCGTTAGAGAAGACAGGG + Intronic
1020416356 7:7950603-7950625 GCTCTAAGTGGGAGAAGGTAAGG + Intronic
1025815555 7:64907825-64907847 GCTCACCCTGGGAGGAGACATGG - Intronic
1026826740 7:73587197-73587219 GCGCTCAGAGGGAGAAGTTAGGG + Intergenic
1028601325 7:92603564-92603586 CCTTCCCGTGGGACAAGATATGG + Intergenic
1033347965 7:140540221-140540243 GATTTCTGTGGGAGAAGAGAAGG - Intronic
1034438749 7:151076156-151076178 TCTCTCGGTCGGTGAAGATACGG - Exonic
1034465655 7:151227044-151227066 GCTCTGCGAGGGGGAAGATAGGG - Intronic
1037195405 8:16182678-16182700 TCTTTCAGTGGGAGAAGATATGG - Intronic
1037504010 8:19512634-19512656 GTTCTCCGTTTGAGAAAATAAGG + Intronic
1039125958 8:34202153-34202175 CCTCCCAGTGGGACAAGATATGG - Intergenic
1041385579 8:57298512-57298534 GGCCTCCGTGGGAAAAGGTATGG + Intergenic
1046341771 8:112868170-112868192 TCTGTCCGTGGGACAAGATGTGG - Intronic
1050321580 9:4458182-4458204 GCTCTACTTGGGAGAAAACATGG + Intergenic
1053709182 9:40788031-40788053 GCTTTCAGTGGTAGAAGTTAAGG - Intergenic
1055163280 9:73158081-73158103 GCTCTCCATAGGAAAACATAAGG - Exonic
1056093835 9:83231237-83231259 GCTCCCCCTGGAGGAAGATAGGG + Intergenic
1056943977 9:90978030-90978052 GCTCTCCTTGGGAGAAGAGCAGG + Intergenic
1062065120 9:134522562-134522584 GCTCTCCGAGGGAGCAGAGCCGG - Intergenic
1062633278 9:137477025-137477047 GCACTCCGTGGGAGATGGGAGGG + Intronic
1188337352 X:28953303-28953325 GATTTCCCTGGGAGAAGAAATGG + Intronic
1189904945 X:45748623-45748645 GCTCTTGGTGGGGGAGGATAAGG + Intergenic
1190125155 X:47698323-47698345 GCTCTCAGTGGGAGCTGAAAAGG - Intergenic
1190260111 X:48792135-48792157 GCTCCCGGTGGGAGAAAAGAAGG - Exonic
1194253721 X:91610613-91610635 CCTTTCAGTGGGACAAGATATGG - Intergenic
1198025451 X:132701609-132701631 GAGCTCTGTGGGAGAAGATGGGG - Intronic
1200133661 X:153864469-153864491 TCTCTCCCTGGCAGAAGAGAAGG - Exonic
1200572506 Y:4850190-4850212 CCTTTCAGTGGGACAAGATATGG - Intergenic
1201915654 Y:19179081-19179103 GGTCTTTGTGGGAGAAGATGGGG - Intergenic