ID: 1092407474

View in Genome Browser
Species Human (GRCh38)
Location 12:8230916-8230938
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 8, 1: 2, 2: 2, 3: 11, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092407465_1092407474 9 Left 1092407465 12:8230884-8230906 CCACAAATGATGCTGGAGCCGGG 0: 8
1: 4
2: 3
3: 4
4: 96
Right 1092407474 12:8230916-8230938 CTGCAGTTTAGGAAGTGATCAGG 0: 8
1: 2
2: 2
3: 11
4: 141
1092407471_1092407474 -9 Left 1092407471 12:8230902-8230924 CCGGGTGGGCCGGGCTGCAGTTT 0: 7
1: 6
2: 0
3: 20
4: 208
Right 1092407474 12:8230916-8230938 CTGCAGTTTAGGAAGTGATCAGG 0: 8
1: 2
2: 2
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092407474 Original CRISPR CTGCAGTTTAGGAAGTGATC AGG Intergenic
901121494 1:6898060-6898082 CTGCAGGTTAGCAAATGAACTGG - Intronic
906342044 1:44988834-44988856 CAGAAGTTTAGGAAGTGAGGCGG + Intergenic
906419526 1:45653123-45653145 CTCAAGTCTAGGAAGTGACCTGG - Intronic
906696473 1:47826895-47826917 ATGATGTTTAGGAAGTCATCGGG + Intronic
907410480 1:54280009-54280031 CTCCAGTTTTGGCAGTGTTCTGG + Intronic
908758985 1:67494752-67494774 CTGCAGTTCAGGAAGGCACCAGG - Intergenic
910072691 1:83238019-83238041 CTGCAGTTGAGGATATGAACTGG + Intergenic
910262115 1:85302940-85302962 CTACAGTTTGGGAAGTGGCCCGG + Intergenic
910920251 1:92338540-92338562 CTGAAGTTTAGGATTTGTTCAGG + Intronic
912399043 1:109373254-109373276 CTTCAGTTTAGGAAGAACTCTGG - Intronic
919588498 1:199469570-199469592 CAGGACTTTAGGAAGTGATTAGG - Intergenic
921404610 1:214765135-214765157 CTGCAGTGTAGGGAGGGAGCAGG + Intergenic
921431315 1:215069392-215069414 TTGCAATTCAGGAAGTAATCAGG - Intronic
922754823 1:228089880-228089902 GTGTAGTTCAGGAAGTGAACTGG + Intronic
923368550 1:233287360-233287382 CTGCAGTTTAAGATGAGATTTGG - Intronic
923495202 1:234518667-234518689 CTGTAGTTTAGGTATTGTTCAGG - Intergenic
1066413352 10:35195260-35195282 TTGAAGTTTAGGAAGTATTCAGG + Intronic
1068280743 10:54865598-54865620 CACCTGTTGAGGAAGTGATCTGG - Intronic
1068472487 10:57482635-57482657 CTGCAGTTTAGGACAACATCAGG - Intergenic
1070506119 10:77114343-77114365 ATGCAGTTTAGAAAGAGAGCAGG - Intronic
1074599857 10:114902530-114902552 CTGCATTTTGGGTAGTCATCCGG + Intergenic
1077522169 11:3042922-3042944 CTGCAGTGTCCGAAGTGATGAGG - Intronic
1077579550 11:3407968-3407990 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1078038252 11:7831791-7831813 CTGAAGTTAAGGAAGGGATGGGG - Intergenic
1079202265 11:18386152-18386174 CCCCATTTTGGGAAGTGATCAGG - Intergenic
1079509976 11:21199364-21199386 CTGGAGCTTAGGAAGTTATTAGG - Intronic
1084236575 11:67791506-67791528 CTGCAGTTTCGGAAGTGATCAGG + Intergenic
1084835852 11:71801487-71801509 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
1086098742 11:83076330-83076352 TTACAGCTTAGGAAGTGGTCTGG + Intergenic
1087653334 11:100894351-100894373 CTGCATTTTTGCAAGTGTTCTGG + Intronic
1087655227 11:100914636-100914658 CTGCTGTCTAAAAAGTGATCGGG + Intronic
1092407474 12:8230916-8230938 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1095241330 12:39862463-39862485 CTTCATTTTAGAAAGTGATATGG - Intronic
1095921794 12:47539346-47539368 CTGCAGTGTAGAAAGTGGGCTGG + Intergenic
1097388013 12:58973820-58973842 TTACAATTTAGGAAGTGATGGGG + Intergenic
1099710255 12:86214699-86214721 GTGCTCTTTAGGAAGTTATCAGG - Intronic
1100055437 12:90503407-90503429 CTGCACTTTAAGATGTGATTTGG + Intergenic
1100611430 12:96194475-96194497 ATGCAGTAAAGGAAGTGAGCCGG + Exonic
1100975499 12:100117885-100117907 CTCCATTTTAGGAAGTTATCTGG + Intronic
1106474410 13:30085867-30085889 ATGCAGTATAGGAAGTTTTCTGG - Intergenic
1106686668 13:32067425-32067447 CTGCAGTTTAGGGAGTTTCCAGG + Intronic
1112795635 13:103053980-103054002 CTGCTGTTTTGGGAGTGATATGG + Intronic
1113365124 13:109668884-109668906 CTGCAGTTTACTAAGAAATCAGG - Intergenic
1114680225 14:24478128-24478150 CTCAAGTTAGGGAAGTGATCTGG + Intergenic
1115006465 14:28491577-28491599 AGGCATTTTAGGAAGTGATTAGG - Intergenic
1118339569 14:64882725-64882747 CTGCAGATTTGGAAGAGTTCTGG + Intergenic
1120474850 14:84974283-84974305 CTGGAGTTTACCAAGTGATATGG + Intergenic
1126343373 15:47667858-47667880 CTCCAGTTTACGAAGCTATCTGG - Intronic
1127248416 15:57204137-57204159 CTGTAATTTAGAAAGTGATGAGG + Intronic
1131713957 15:95088221-95088243 CTCCAGTCTAGGAAGTGACCAGG + Intergenic
1133348168 16:5084028-5084050 CTGCGGTTGAGGAAGTGATCAGG + Intronic
1135692875 16:24557934-24557956 GTGAAGTTGAGGAAGTGAGCAGG - Intronic
1141157574 16:81607907-81607929 CTGCAGTCTAGGAACTTTTCAGG + Intronic
1144396902 17:14853071-14853093 AAGCAGATTAGGAAGAGATCTGG + Intergenic
1146420939 17:32685052-32685074 CTGCATTTTATCAAGTGACCAGG + Intronic
1146662771 17:34675638-34675660 CTGCAGTTTAGAAAGCAACCAGG + Intergenic
1147047921 17:37768432-37768454 CTGCAGATCAGGAAGAGATGAGG - Intergenic
1148079388 17:44959612-44959634 CTCCAGATTAGGAAGGGGTCTGG - Intergenic
1149480813 17:57001730-57001752 CTGCTCTTTAGGAAGGGAACTGG - Intronic
1151231069 17:72685482-72685504 CTGGAGTCTAGTAAGTGATGGGG + Intronic
1152170877 17:78747338-78747360 CTGGTATTTAGGAAGAGATCTGG + Intronic
1157698858 18:49746695-49746717 CTACAGTTTAAGAAGAGATTTGG - Intergenic
1158930622 18:62322360-62322382 GTGCTTTTTAGAAAGTGATCTGG - Intergenic
1161325630 19:3662387-3662409 CTGCAGATGTGAAAGTGATCTGG - Intronic
1165756983 19:38299317-38299339 CTGCAATTTAGGAAGATTTCTGG - Intronic
928922734 2:36542262-36542284 CTGCCATGTAGGAAGTGCTCAGG + Intronic
935089699 2:99883061-99883083 CCACAGTTTAGGAAGAGAACTGG + Intronic
936979960 2:118255216-118255238 TTGCAGTTTAGGAAGGGAGGAGG + Intergenic
937036871 2:118789378-118789400 AAGCAGTTTAAGAAGGGATCAGG + Intergenic
939683048 2:145162307-145162329 CTGCTGCTTATGAAGTGATGTGG - Intergenic
939799420 2:146689896-146689918 CTGCACTTTTGCAAGTAATCAGG - Intergenic
939802447 2:146726886-146726908 CTGGAGGTTAGGGAGTGATATGG + Intergenic
940648911 2:156421039-156421061 CTGCAGTTTAAGAAGTTTCCTGG - Intergenic
945400435 2:209375242-209375264 CTGAAGTTTAGGAAGAGTTTGGG - Intergenic
946159201 2:217825860-217825882 CTGCAGTTTAGGAGCTGAAGGGG - Intronic
946348131 2:219127778-219127800 CTGCAGTTTAAGAGGAGATAAGG - Intronic
946710221 2:222497800-222497822 CTACTGTTTAGGATGTGATGAGG + Intronic
946867154 2:224052172-224052194 CTGGAGTTTAGCTAGTGATAAGG - Intergenic
1169798156 20:9487397-9487419 CTGCAGTATATGAAGAAATCTGG - Intergenic
1170993451 20:21327507-21327529 CTGCAACTTAGCAAGTTATCAGG - Intronic
1171235189 20:23518958-23518980 CAGCAGTTTAGAAAGTCAGCAGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1174741081 20:53014924-53014946 ATGCAGTTTGGGAAGTTATTGGG - Intronic
1178312443 21:31540600-31540622 CAGAAGTTTAAGAAGTGAGCAGG - Intronic
1182411800 22:30193511-30193533 CTGCATTTCATGAAGTGGTCAGG + Intergenic
1185248187 22:49784618-49784640 CTGAACTTTAGGGAGTTATCTGG - Intronic
950252267 3:11475605-11475627 CTGCAGATCAGCAGGTGATCAGG + Intronic
950950999 3:16998400-16998422 CTGTAGTATAGGAAGTCAGCAGG + Intronic
952825717 3:37522887-37522909 CTACAGTTTAAGAAGTGTTCAGG + Intronic
953939467 3:47079403-47079425 ATGCTGTTTAGGAAGTGATTTGG - Intronic
955962815 3:64358347-64358369 CTGCTCTTTAGGAAGTGGCCAGG - Intronic
956577033 3:70763439-70763461 TTGCATTTTAGGAAATGATAGGG + Intergenic
957052517 3:75421290-75421312 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
959976307 3:112463861-112463883 CTGCAGTTTAGCAAGTTATTCGG + Intergenic
961302325 3:125930264-125930286 CTGCAGTTTAGGAAGTGATCAGG - Intronic
961758032 3:129142257-129142279 CTGCAGTACAGGACCTGATCTGG - Intronic
961886134 3:130097521-130097543 CTGCAGTTTAGGAAGTGATCAGG + Intronic
961933397 3:130557099-130557121 CGGCAGTTTAGGAATGGAGCTGG + Intergenic
962906979 3:139812831-139812853 CAGCAGTTGTGGAAGTGATCAGG + Intergenic
964404504 3:156334947-156334969 CTGGAGTCAAGGAAATGATCAGG - Intronic
965488389 3:169306948-169306970 CTGCACCTAAGGAAGTGGTCTGG - Intronic
968995327 4:3941672-3941694 CTGCAGTTTAGGAAGTGAGCAGG + Intergenic
969758668 4:9167128-9167150 CTGCAGTTTAGGAAGTTGTCAGG - Intergenic
969818632 4:9704591-9704613 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
969984574 4:11194475-11194497 GTGCAGGTTATGAAGGGATCAGG - Intergenic
970991582 4:22219149-22219171 CTTCAGGTTAGGAAGTGAAGTGG + Intergenic
976064234 4:81165354-81165376 ATGCAGTTTAGGAGTTGATTTGG - Intronic
976515013 4:85955131-85955153 CTGCTGTTTAGAAAGAGATCTGG - Intronic
976604197 4:86967396-86967418 CACCAGGTCAGGAAGTGATCTGG + Intronic
980175446 4:129338922-129338944 CTGGAGTTCAGGAAGAGACCTGG + Intergenic
980257697 4:130403226-130403248 CTGCAGTGTAGGAAGGTAGCAGG + Intergenic
980845796 4:138323058-138323080 ATTCACTTTAGGAAGTGAGCTGG - Intergenic
984389126 4:179105604-179105626 GTGAAGTTTAGGAAGTCTTCAGG + Intergenic
986480480 5:8181735-8181757 GAGCAGTTGAGGAAGTGAGCAGG + Intergenic
988010762 5:25480496-25480518 CTGCAGTTTCTGAAGTTTTCTGG + Intergenic
988551818 5:32207178-32207200 CTGCCGTTTTGTAAGAGATCTGG - Intergenic
991449021 5:66732087-66732109 CAGTAGTCTAGGAAGTGAACTGG - Intronic
993468363 5:88275860-88275882 CTGAAGTTTAGGGCCTGATCTGG - Intergenic
998787819 5:145731326-145731348 CTGCATTTTAGGAATGGAGCAGG - Intronic
999125099 5:149240588-149240610 TGGCAGTTTAGGAAGTGGTGAGG - Intronic
999852158 5:155553062-155553084 ATGCTGTTTAGGAATTGTTCGGG + Intergenic
1002285798 5:178161980-178162002 CTGGAATCTAGGAAGGGATCTGG + Intergenic
1005945809 6:30594875-30594897 CAGCAGGTTGGGATGTGATCAGG + Intronic
1007097996 6:39226210-39226232 CTGCAATTTAGGAAGAGGTTGGG + Intronic
1007652477 6:43432146-43432168 CTGCAGGGTAGGATGTAATCTGG - Exonic
1009786729 6:68349914-68349936 CTTCAGTTTAGGTATTGGTCAGG - Intergenic
1011000363 6:82581872-82581894 GGGGACTTTAGGAAGTGATCAGG - Intergenic
1012198286 6:96372707-96372729 CTGTGGTTCAGGAAGTGAACAGG + Intergenic
1014102586 6:117528099-117528121 CTGCAGTTTAGGAGGAGAAGGGG + Intronic
1017480446 6:154848708-154848730 CTGTAGCTTAAGAAGTGAGCTGG + Intronic
1018154606 6:160974147-160974169 CTGCAGTGTAGGTAGTGACGGGG + Intergenic
1018229414 6:161661483-161661505 CTGCGGTCTAGGAGGTGGTCAGG - Intronic
1020319599 7:6929989-6930011 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1020381966 7:7557054-7557076 CTGCAGTGTAGAAAGGGAGCAGG - Intergenic
1022579496 7:31536019-31536041 CTTCAGTTTAGGAAAATATCAGG + Intronic
1027290268 7:76700819-76700841 CTGCAGTTGAGGATATGAACTGG + Intergenic
1027290413 7:76703174-76703196 CTGCAGTTGAGGATATGAACTGG + Intergenic
1028617390 7:92783882-92783904 GTCCAGTTCAGGAATTGATCTGG - Intronic
1029480247 7:100807931-100807953 ATGCAGTTTAGGAAGTGGACGGG - Intronic
1032884340 7:136121768-136121790 CTGCAGCTTAGGGAGTGACCTGG + Intergenic
1036775879 8:11612974-11612996 CAGCAGCATAGGAAGTGCTCAGG + Intergenic
1037196949 8:16201969-16201991 CTGCAGTGTAGGCTGTGACCTGG + Intronic
1037596719 8:20360401-20360423 CTACAGTTTAGAACATGATCAGG + Intergenic
1039288436 8:36067976-36067998 CTGCAGTTTTGGAGGCCATCAGG - Intergenic
1041086714 8:54263266-54263288 CAGCACTTTAGGAAGTGAGGTGG - Intergenic
1044287701 8:90428345-90428367 AAGCAGTTTAGGTTGTGATCAGG + Intergenic
1046240870 8:111489916-111489938 CTGAAGTTTAGGAAATGAGTAGG + Intergenic
1046752216 8:117938097-117938119 CTGCAGTCTAGAAACTGTTCTGG - Intronic
1047865732 8:129022553-129022575 CTCCAGTTTACTAAGTGATATGG + Intergenic
1048022274 8:130550197-130550219 GTGAGGTTTAGGAGGTGATCAGG + Intergenic
1048026644 8:130593156-130593178 CTACAGTTCAAGAAGAGATCTGG - Intergenic
1049024127 8:139977083-139977105 CTTGAGGTTTGGAAGTGATCAGG - Intronic
1051053812 9:12959615-12959637 GTGCTGTTTAGGAGGTCATCTGG + Intergenic
1053426117 9:38011212-38011234 CTCCTGTTGAGGCAGTGATCAGG - Intronic
1056462578 9:86822678-86822700 CTGCACCTTAGGAGGTAATCTGG + Intergenic
1058179386 9:101778670-101778692 CTGCAGTTAAGGAATTAATCCGG - Intergenic
1059684281 9:116619776-116619798 CTGCACTTTAGGAGGTGAGGTGG - Intronic
1061787692 9:133040280-133040302 CTGTCCCTTAGGAAGTGATCAGG - Intronic
1061875539 9:133541751-133541773 CTGCAGCTTAGGAAGGGGACAGG - Intronic
1061930676 9:133831565-133831587 CTGTAGTTCAGGAAGTGTCCTGG + Intronic
1062250054 9:135589334-135589356 CTGCACTCCAGGAAGTGACCTGG - Intergenic
1188276131 X:28203562-28203584 CTGCATTCTAGGAAATGATTGGG + Intergenic
1198003544 X:132466721-132466743 CTGATGTTTAGGAAGCAATCTGG + Intronic
1199163501 X:144642950-144642972 CTTCATTATAGGAAGTGATGAGG - Intergenic