ID: 1092408289

View in Genome Browser
Species Human (GRCh38)
Location 12:8235668-8235690
Sequence CTCTCACGGTACCACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 3, 2: 4, 3: 11, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092408289_1092408295 21 Left 1092408289 12:8235668-8235690 CCAGGCCTGTGGTACCGTGAGAG 0: 1
1: 3
2: 4
3: 11
4: 112
Right 1092408295 12:8235712-8235734 ATTGTGACCGAGCCTCCCGAGGG 0: 1
1: 3
2: 7
3: 5
4: 27
1092408289_1092408294 20 Left 1092408289 12:8235668-8235690 CCAGGCCTGTGGTACCGTGAGAG 0: 1
1: 3
2: 4
3: 11
4: 112
Right 1092408294 12:8235711-8235733 GATTGTGACCGAGCCTCCCGAGG 0: 1
1: 3
2: 6
3: 7
4: 33
1092408289_1092408293 -4 Left 1092408289 12:8235668-8235690 CCAGGCCTGTGGTACCGTGAGAG 0: 1
1: 3
2: 4
3: 11
4: 112
Right 1092408293 12:8235687-8235709 AGAGATGATGGCTGTGCTCTCGG 0: 1
1: 7
2: 2
3: 22
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092408289 Original CRISPR CTCTCACGGTACCACAGGCC TGG (reversed) Intergenic
903388783 1:22948708-22948730 CTCTCACAGTTCCAGAAGCCAGG + Intergenic
904624366 1:31793746-31793768 CTCCCACGGAACCACAGGACAGG - Exonic
906616125 1:47234064-47234086 CTCTAAGGGTCCCACAGCCCAGG - Intergenic
912502242 1:110130242-110130264 CTCTCACGGTCCCAAAGGATGGG + Intergenic
913009684 1:114670520-114670542 CTCTCGCGGCACCTCAGGCTTGG + Intergenic
918361677 1:183765103-183765125 CTCTCTACTTACCACAGGCCAGG + Intronic
923595949 1:235361050-235361072 CTCTCCCTGTGCCACAGGGCAGG - Intergenic
1063142831 10:3270863-3270885 CTCTCATGGAATCACAGGCCAGG - Intergenic
1064852565 10:19725437-19725459 GACTCACAGTTCCACAGGCCTGG - Intronic
1066704595 10:38164406-38164428 CTCTCACAGTTCCGCAGGCTGGG - Intergenic
1067743944 10:48919538-48919560 CTCTCACTGTTCCAGAGGCTGGG + Intronic
1068165127 10:53321045-53321067 CTCTCACTGTACTACAAGCTTGG - Intergenic
1070982728 10:80662793-80662815 ATATCACAGTATCACAGGCCTGG - Intergenic
1075263247 10:120980418-120980440 TTCGCAGGGGACCACAGGCCAGG - Intergenic
1077056494 11:596535-596557 CTGTCAGGATACCACAGGCTGGG + Intronic
1077580688 11:3415246-3415268 CTCCCATGGCATCACAGGCCTGG - Intergenic
1080559116 11:33445942-33445964 TTCTCACAGTTCCACAGGCCAGG - Intergenic
1084000260 11:66292113-66292135 CTCTCACGCCGCCCCAGGCCCGG - Intronic
1084237616 11:67798075-67798097 CTCCCACGGCATCACAGGCCTGG - Intergenic
1084794507 11:71496198-71496220 CCCTCACAGTTCCAGAGGCCAGG + Intronic
1084834787 11:71794753-71794775 CTCCCACGGCATCACAGTCCTGG + Intronic
1087909557 11:103737438-103737460 ATCTCTCTGTACCACAGCCCAGG - Intergenic
1088502055 11:110492477-110492499 TTCTCACTGTCCTACAGGCCAGG + Intergenic
1089498045 11:118917727-118917749 CTGTCCTGGCACCACAGGCCAGG - Intronic
1092408289 12:8235668-8235690 CTCTCACGGTACCACAGGCCTGG - Intergenic
1093646160 12:21587599-21587621 GTCTCACAGTTCCACAGGGCTGG - Intronic
1096856058 12:54484051-54484073 CTCTTGTGGGACCACAGGCCTGG + Intergenic
1097575524 12:61388549-61388571 GACTCACAGTACCACAGGACTGG + Intergenic
1101992957 12:109502301-109502323 CACTCACTGAACCACAGGCGGGG + Intronic
1102596774 12:113998910-113998932 TTCTCACTGTTCCAGAGGCCGGG - Intergenic
1103893954 12:124261070-124261092 CTCTCACGGTTCTGGAGGCCAGG + Intronic
1108015049 13:46065754-46065776 TTGCCACGGAACCACAGGCCTGG - Intronic
1108281476 13:48866394-48866416 CTCTCACAGTCCCGCAGGCTAGG - Intergenic
1108338979 13:49477390-49477412 CACACACTGTACCAGAGGCCTGG + Intronic
1113877065 13:113601283-113601305 AACTCAGGGCACCACAGGCCAGG - Intronic
1128714571 15:69898388-69898410 TTCTCTCAGTACCACAAGCCTGG + Intergenic
1129155422 15:73714348-73714370 GTCTCACTCTACCAGAGGCCAGG - Exonic
1129756648 15:78103000-78103022 CTCTCTGGGGACCACAGACCTGG + Intronic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1133349245 16:5090499-5090521 CTCCTACGGTACCACAGGCCTGG - Exonic
1136392404 16:29973916-29973938 CTCTCTCCGCACCACAGCCCCGG - Exonic
1136460529 16:30407627-30407649 CACTCGCGGTGCCCCAGGCCTGG - Exonic
1138415624 16:56869920-56869942 CTCTCCCGGAACCACAGGAGCGG - Intronic
1138717250 16:59037612-59037634 CTCTCCCGCTACCCCAGCCCCGG + Intergenic
1142153477 16:88522819-88522841 CTCCCAGGGTGCCACAGGCTCGG - Intronic
1142218988 16:88843761-88843783 ATAACACGTTACCACAGGCCAGG - Intronic
1142983012 17:3682184-3682206 CTCCCCCGATCCCACAGGCCAGG + Intronic
1143253579 17:5539723-5539745 CTCTCAGGTTACCGCAAGCCAGG - Intronic
1152517828 17:80836610-80836632 TTCTCGTGGTACCCCAGGCCTGG - Intronic
1159778000 18:72626027-72626049 CTCTCACTGGACCACAAGGCTGG - Intronic
1160563938 18:79775425-79775447 CTGTCACGGTACCAAAGTGCTGG - Intergenic
1164610741 19:29629929-29629951 CTGTCACTGTCCCTCAGGCCTGG - Intergenic
1168692010 19:58382989-58383011 TTCTGGTGGTACCACAGGCCTGG + Intergenic
926848059 2:17163848-17163870 CTCTCACCAAACCACAGCCCTGG + Intergenic
927893534 2:26767161-26767183 CTCTCACAGCTCCCCAGGCCAGG + Intronic
927928189 2:27027296-27027318 CTGTCACCCTCCCACAGGCCTGG + Intergenic
929164291 2:38865459-38865481 GACTCACAGTACCACAGGGCTGG - Intronic
934090575 2:88547169-88547191 CTCTCACGGGACCTCAGAACTGG - Intergenic
935050476 2:99521046-99521068 CTCACACAGTCCCACAGGGCCGG - Intergenic
935337277 2:102028165-102028187 CTCTCACTGTACAAGAGGACAGG - Intronic
936813894 2:116435762-116435784 GACTCACAGTACCACAGGACTGG - Intergenic
937228183 2:120381795-120381817 CACTCAAGGTCCCCCAGGCCAGG - Intergenic
947768614 2:232653583-232653605 CTCTAAAGCTACCACAGGCCGGG - Intronic
947907876 2:233778849-233778871 ATCTCACGGTTCCACTGGCCAGG + Intronic
947943917 2:234083424-234083446 CTCTCACAGTCCTAGAGGCCAGG + Intergenic
948417806 2:237827608-237827630 CTCACAGGGTTTCACAGGCCAGG + Intronic
1169273629 20:4218661-4218683 CTCTGACAGTCCCACATGCCAGG - Intergenic
1175202907 20:57290326-57290348 CTCTCACAGTTCCAGAAGCCTGG + Intergenic
1175965513 20:62658289-62658311 CGCTCACTCTCCCACAGGCCGGG - Intronic
1176372543 21:6071027-6071049 CCTTCATGGGACCACAGGCCAGG + Intergenic
1178579799 21:33828842-33828864 CTCCAGCGGTACCACAGACCAGG - Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179750933 21:43467218-43467240 CCTTCATGGGACCACAGGCCAGG - Intergenic
1184036835 22:41922421-41922443 TTCTCTGGGGACCACAGGCCAGG + Intergenic
1184432303 22:44448607-44448629 CTCTCGGGGTAAGACAGGCCTGG + Intergenic
1184743840 22:46444717-46444739 GTCTCACAGTCGCACAGGCCAGG + Intronic
953509418 3:43520322-43520344 TTCTCACAGTACCAGAGGCTGGG + Intronic
957053570 3:75427842-75427864 CTCCCATGGTACCACAGGCCTGG - Intergenic
957159256 3:76587402-76587424 GACTCACAGTTCCACAGGCCTGG + Intronic
961887238 3:130104233-130104255 CTCCCACGGTACCACAGGCCTGG - Intronic
962492447 3:135907611-135907633 TTCTCATGGTATGACAGGCCTGG + Intergenic
967207293 3:187135542-187135564 CGCTTACGGTACCACATGGCTGG - Intronic
968940128 4:3633421-3633443 CACTCACCGTCCCACTGGCCAGG + Intergenic
968996363 4:3948154-3948176 CTCCCACGGCACCACAGGCCTGG - Intergenic
969355012 4:6620137-6620159 CTCGCAAGGTCGCACAGGCCGGG - Intronic
969615808 4:8252066-8252088 CTCTCACGGTTCTGGAGGCCAGG + Intergenic
969757623 4:9160534-9160556 CTCCCATGGTACTACAGGCCTGG + Intergenic
969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG + Intergenic
971152394 4:24047167-24047189 CTCTGACGGGACCAAAGTCCAGG - Intergenic
971706439 4:30049228-30049250 CCCTCACCCCACCACAGGCCCGG - Intergenic
981324762 4:143433069-143433091 TACTCACAGGACCACAGGCCTGG + Intronic
984196084 4:176659849-176659871 CTCTCACAGTTCCAGAGGACAGG + Intergenic
984990180 4:185372756-185372778 TTCTCACAGTTCCAGAGGCCAGG - Intronic
988361973 5:30247907-30247929 TTCTCACAGTTCCAAAGGCCAGG - Intergenic
990459295 5:56016131-56016153 CACTCACAGTTCCACAAGCCTGG - Intergenic
992224923 5:74610904-74610926 CTTTCACTGTGCCACAGGTCAGG - Intergenic
998063589 5:139138448-139138470 CACTCCCGGTACCTCAGGCAGGG - Intronic
998398770 5:141836494-141836516 CTCTCCCAGTCCCAAAGGCCTGG - Intergenic
998818182 5:146034339-146034361 CTCTCCAGGCACCACAGGCTGGG + Intronic
1001274382 5:170339620-170339642 CACTCACAGTGACACAGGCCAGG - Intergenic
1003121176 6:3320050-3320072 TTCTCACGGCATCAGAGGCCTGG + Intronic
1003485156 6:6569171-6569193 GTCTCAAGGTTGCACAGGCCAGG + Intergenic
1006946442 6:37787612-37787634 TTCTCATGGTACCTCAGGGCTGG + Intergenic
1007697628 6:43743874-43743896 CTCCCAGGGTAGCAGAGGCCAGG - Intergenic
1018371852 6:163175678-163175700 GTTTCACAGTATCACAGGCCAGG - Intronic
1020320641 7:6936568-6936590 CTCCCACGGCATCACAGGCCTGG - Intergenic
1022797437 7:33743262-33743284 CTCTCTAGATACCAAAGGCCAGG - Intergenic
1024683496 7:51719111-51719133 TTCTCACGGTTCCAAAGGCTGGG + Intergenic
1026224798 7:68430801-68430823 GACTCACGGTTCCACAGGGCTGG - Intergenic
1030498783 7:110333370-110333392 CTCTCACAGTTCTAGAGGCCAGG + Intergenic
1032301238 7:130689277-130689299 TTCTCACAGTTCCAGAGGCCGGG - Intergenic
1034215037 7:149398660-149398682 CTCTCACCTTGCCTCAGGCCCGG + Intergenic
1036848699 8:12186767-12186789 CTCCCACGGTACCACAGGCCTGG - Exonic
1036870060 8:12429048-12429070 CTCCCACGGTACCACAGGCCTGG - Exonic
1037176398 8:15951510-15951532 TTCTCTCGGTGTCACAGGCCTGG - Intergenic
1039082182 8:33744350-33744372 CTCTCACAGTTCCACATGGCTGG + Intergenic
1043358384 8:79440632-79440654 TTCTCATAGTACCAAAGGCCAGG - Intergenic
1046687702 8:117245453-117245475 CACTCCCGGAACCAAAGGCCAGG - Intergenic
1050156283 9:2669674-2669696 CTCTCAGGGTAGGATAGGCCAGG - Intergenic
1053458304 9:38248780-38248802 CCCTCACTGCACCACAAGCCTGG + Intergenic
1056665428 9:88577451-88577473 CTCACATGATACCACAGGCTGGG + Intronic
1058681656 9:107445592-107445614 CACTCACTGTACCCCATGCCTGG - Intergenic
1058977424 9:110137680-110137702 GTCTCAGGATACCACAGTCCTGG + Exonic
1060395246 9:123312185-123312207 ACCTCAAGGTCCCACAGGCCAGG - Intergenic
1061326411 9:129867413-129867435 CTCTCACCTTCCCACAGACCTGG - Intronic
1061368366 9:130184299-130184321 CTCTCAGGGACCCACAGGCCTGG + Intronic
1061704689 9:132444017-132444039 CCCTCCCGGGCCCACAGGCCAGG + Intronic
1186785936 X:12955970-12955992 CTCTCAGGGAACCACAAGCCAGG + Intergenic
1188070802 X:25715866-25715888 TTCTCATGGTGACACAGGCCAGG - Intergenic
1189265747 X:39714907-39714929 CTCTCCAAGTTCCACAGGCCTGG - Intergenic
1190740013 X:53282488-53282510 CTTTCACGGTCCCAGAGCCCAGG + Intronic