ID: 1092413722

View in Genome Browser
Species Human (GRCh38)
Location 12:8273563-8273585
Sequence CCTCCTGGTGTTATTCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092413722_1092413729 8 Left 1092413722 12:8273563-8273585 CCACAATGAATAACACCAGGAGG No data
Right 1092413729 12:8273594-8273616 TTAAGGTCCATTGTGAAGGATGG No data
1092413722_1092413726 -9 Left 1092413722 12:8273563-8273585 CCACAATGAATAACACCAGGAGG No data
Right 1092413726 12:8273577-8273599 ACCAGGAGGTGGGAATATTAAGG No data
1092413722_1092413728 4 Left 1092413722 12:8273563-8273585 CCACAATGAATAACACCAGGAGG No data
Right 1092413728 12:8273590-8273612 AATATTAAGGTCCATTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092413722 Original CRISPR CCTCCTGGTGTTATTCATTG TGG (reversed) Intergenic
No off target data available for this crispr