ID: 1092423736

View in Genome Browser
Species Human (GRCh38)
Location 12:8356343-8356365
Sequence CTGTGTTTAAGGTGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092423736_1092423744 12 Left 1092423736 12:8356343-8356365 CCCACTTCTCACCTTAAACACAG No data
Right 1092423744 12:8356378-8356400 TCCCATTGTTCCAAACCTGGGGG No data
1092423736_1092423741 9 Left 1092423736 12:8356343-8356365 CCCACTTCTCACCTTAAACACAG No data
Right 1092423741 12:8356375-8356397 CCTTCCCATTGTTCCAAACCTGG No data
1092423736_1092423743 11 Left 1092423736 12:8356343-8356365 CCCACTTCTCACCTTAAACACAG No data
Right 1092423743 12:8356377-8356399 TTCCCATTGTTCCAAACCTGGGG No data
1092423736_1092423742 10 Left 1092423736 12:8356343-8356365 CCCACTTCTCACCTTAAACACAG No data
Right 1092423742 12:8356376-8356398 CTTCCCATTGTTCCAAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092423736 Original CRISPR CTGTGTTTAAGGTGAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr