ID: 1092426090

View in Genome Browser
Species Human (GRCh38)
Location 12:8376892-8376914
Sequence CACGGTGACCACAGTCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092426080_1092426090 22 Left 1092426080 12:8376847-8376869 CCAGAGACACAAATGAGAATCAG No data
Right 1092426090 12:8376892-8376914 CACGGTGACCACAGTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092426090 Original CRISPR CACGGTGACCACAGTCTTGA AGG Intergenic
No off target data available for this crispr