ID: 1092426474

View in Genome Browser
Species Human (GRCh38)
Location 12:8379507-8379529
Sequence TCTGCACCCTGGTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092426474_1092426481 1 Left 1092426474 12:8379507-8379529 CCCCCAGGACACCAGGGTGCAGA No data
Right 1092426481 12:8379531-8379553 TGGTGTGAGTAAAAGAGAGGCGG No data
1092426474_1092426480 -2 Left 1092426474 12:8379507-8379529 CCCCCAGGACACCAGGGTGCAGA No data
Right 1092426480 12:8379528-8379550 GACTGGTGTGAGTAAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092426474 Original CRISPR TCTGCACCCTGGTGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr