ID: 1092427372

View in Genome Browser
Species Human (GRCh38)
Location 12:8385633-8385655
Sequence GCAGCACTTTCGGCCCGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092427364_1092427372 -10 Left 1092427364 12:8385620-8385642 CCAACCTGTGCAGGCAGCACTTT No data
Right 1092427372 12:8385633-8385655 GCAGCACTTTCGGCCCGGGGGGG No data
1092427362_1092427372 -3 Left 1092427362 12:8385613-8385635 CCATCCACCAACCTGTGCAGGCA No data
Right 1092427372 12:8385633-8385655 GCAGCACTTTCGGCCCGGGGGGG No data
1092427360_1092427372 10 Left 1092427360 12:8385600-8385622 CCTGCTCAAAGGACCATCCACCA No data
Right 1092427372 12:8385633-8385655 GCAGCACTTTCGGCCCGGGGGGG No data
1092427363_1092427372 -7 Left 1092427363 12:8385617-8385639 CCACCAACCTGTGCAGGCAGCAC No data
Right 1092427372 12:8385633-8385655 GCAGCACTTTCGGCCCGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092427372 Original CRISPR GCAGCACTTTCGGCCCGGGG GGG Intergenic
No off target data available for this crispr