ID: 1092427568

View in Genome Browser
Species Human (GRCh38)
Location 12:8386890-8386912
Sequence GCCCCCACCACCACCATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 1, 2: 13, 3: 47, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092427562_1092427568 29 Left 1092427562 12:8386838-8386860 CCTAGAGGATGGAGACCAGGGAT 0: 1
1: 8
2: 26
3: 38
4: 362
Right 1092427568 12:8386890-8386912 GCCCCCACCACCACCATGAATGG 0: 1
1: 1
2: 13
3: 47
4: 342
1092427567_1092427568 -6 Left 1092427567 12:8386873-8386895 CCTACAATACACAGGATGCCCCC No data
Right 1092427568 12:8386890-8386912 GCCCCCACCACCACCATGAATGG 0: 1
1: 1
2: 13
3: 47
4: 342
1092427564_1092427568 14 Left 1092427564 12:8386853-8386875 CCAGGGATGGTGCTAGCCATCCT 0: 1
1: 0
2: 33
3: 253
4: 1137
Right 1092427568 12:8386890-8386912 GCCCCCACCACCACCATGAATGG 0: 1
1: 1
2: 13
3: 47
4: 342
1092427566_1092427568 -2 Left 1092427566 12:8386869-8386891 CCATCCTACAATACACAGGATGC No data
Right 1092427568 12:8386890-8386912 GCCCCCACCACCACCATGAATGG 0: 1
1: 1
2: 13
3: 47
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092427568 Original CRISPR GCCCCCACCACCACCATGAA TGG Intergenic
900124782 1:1064548-1064570 GCCCCCACCTTCCCCATCAATGG - Intergenic
900157099 1:1207474-1207496 GCCCCCACCCCCAGCATTCATGG - Intergenic
900394013 1:2445687-2445709 GCCCCCACCACCACCTAGGAGGG - Intronic
900584197 1:3424685-3424707 GCCCCCAAGCCCTCCATGAATGG + Intronic
901184542 1:7364404-7364426 GCCCCCTCCTCCACCATGTGAGG - Intronic
901376269 1:8841834-8841856 GCCCCCTCCTCCACCATGTGAGG + Intergenic
902385805 1:16075025-16075047 GCGCCCACCACCACCATGCCTGG - Intergenic
903379560 1:22887262-22887284 CCAGCCACCACCACCAGGAAGGG + Intronic
903810772 1:26033904-26033926 GACCCCACCCCCACCCCGAACGG + Intronic
904396374 1:30225063-30225085 GCCCTCACAACCACCCTGACAGG + Intergenic
904843911 1:33393791-33393813 GCCCACATCACCATCAGGAATGG + Intronic
905435078 1:37950409-37950431 GCGCCCAGCACCACCATGCCCGG + Intergenic
905860062 1:41344427-41344449 CTCACAACCACCACCATGAAGGG - Intergenic
906783225 1:48590930-48590952 GCCCACTCCACCATGATGAATGG - Exonic
907243823 1:53094740-53094762 GGCTCCACCACCACCACGCACGG + Intronic
907515876 1:54993220-54993242 GCCCACCCCACTTCCATGAAAGG + Intergenic
907881728 1:58555825-58555847 GCCTCCCCCACCACCAAGAGTGG + Intergenic
908623910 1:66018272-66018294 GCGCCCGCCACCACCATGCCCGG - Intronic
911135283 1:94432998-94433020 GCACGCACCACCACCATGCCCGG + Intronic
912253061 1:108030990-108031012 GCACCCACCACCACCACGCTGGG + Intergenic
912863155 1:113232763-113232785 GCCCCCAGTACCACCCTGTATGG + Intergenic
913689884 1:121269067-121269089 GACTCCACCACCACCATCACTGG - Intronic
914147716 1:145011205-145011227 GACTCCACCACCACCATCACTGG + Intronic
915129568 1:153687386-153687408 GCCCCCAGCACCACCCAGTAGGG + Intronic
915729478 1:158043116-158043138 GCCCCCACCCTCATGATGAAGGG - Intronic
915897761 1:159824836-159824858 GCCCTCTCCACCCCCATGACAGG + Intergenic
916547578 1:165820870-165820892 GTCTCCTCCACCACCCTGAAAGG + Intronic
916755794 1:167769150-167769172 GCCCTCACAACCACCCTGCAAGG - Intronic
917601531 1:176579014-176579036 GCCCCCACCACCCTAATGAGGGG - Intronic
919103659 1:193122787-193122809 ACCCCCACCCCAACAATGAAAGG - Intronic
919586994 1:199451326-199451348 CCCCCCACCACCACCATCTTTGG + Intergenic
920477207 1:206287544-206287566 GACTCCACCACCACCATCACTGG - Intronic
920490881 1:206414175-206414197 GCACTCACCACCACCATGCCCGG + Intronic
923235173 1:232025895-232025917 GCCGCTACCACCACCATACATGG - Intronic
923558251 1:235018913-235018935 GCCCCCTCCTCCATAATGAATGG + Intergenic
923619361 1:235565356-235565378 GCGCCCATCACCACCATGCCCGG - Intronic
924472081 1:244351386-244351408 ATCTCCACCACCACCATGGAAGG - Intergenic
1063452041 10:6156628-6156650 CCTCCCACCACCACCATGCCCGG + Intronic
1065539809 10:26751691-26751713 TCCCCCACCACCACCACCAGTGG - Exonic
1065784025 10:29196413-29196435 CCCCACACCACCAACATGAAAGG + Intergenic
1065922409 10:30404175-30404197 GCGCCCACCACCACCATGCCAGG - Intergenic
1068847381 10:61693305-61693327 GCCCCTACCTCCTCCATGAAAGG - Intronic
1070257821 10:74826231-74826253 GCCCCCTCCACCTCTAGGAAAGG - Intronic
1071019840 10:81040129-81040151 CCCGCCTCCACCACCATCAAGGG - Intergenic
1071209209 10:83318022-83318044 GCCACCACCACCACCACCACAGG - Intergenic
1071488112 10:86116701-86116723 CCCCCCACCACCACCATTTATGG + Intronic
1071517129 10:86305626-86305648 CCCCCCACCACCACCATAATAGG + Intronic
1071988425 10:91075717-91075739 GCCCCCACCACCTCCAAACATGG - Intergenic
1072469282 10:95697286-95697308 ACCCCCACCACCACCTTTAGGGG - Intergenic
1072727094 10:97821569-97821591 GCCTCCACCACAACCCTGCAGGG - Intergenic
1073477258 10:103762514-103762536 GCCCCCACCACCACTCTTCAGGG + Intronic
1073612299 10:104956571-104956593 TCCACCACCACCACCATGGTGGG - Intronic
1074404156 10:113166032-113166054 CCCCCCACCCCCACCTTGAAAGG + Exonic
1075055809 10:119217614-119217636 GTCCCCACCACCACCACCCATGG - Intronic
1075266249 10:121001607-121001629 TCCCTCACCACCATCCTGAAAGG + Intergenic
1075310299 10:121408085-121408107 GGCCCCACAACCACCCTGAGAGG + Intergenic
1075778361 10:125002170-125002192 GCCCCCACCCCCAAAATGCAGGG + Intronic
1076426992 10:130373920-130373942 GCCCACACCAACACCAGGCAGGG + Intergenic
1076583641 10:131531490-131531512 GCCACCACTTCCACCATGAGTGG + Intergenic
1077379190 11:2220734-2220756 CCCCTCACCTCCACCATGAGTGG - Intergenic
1077503595 11:2920107-2920129 GCCCCCACCCCCACCCTGGCGGG - Intronic
1077601418 11:3577531-3577553 CCCCCCACCACCACCACGAATGG + Intergenic
1077659998 11:4059288-4059310 GTCACCAACACCACCATGACAGG + Exonic
1081009146 11:37786079-37786101 ACCCCCACCTCCACCCAGAAAGG - Intergenic
1081658257 11:44872067-44872089 GCACCCACCACCACCACGCCTGG + Intronic
1081838509 11:46177421-46177443 GCACCCACCACCCCCAGCAACGG - Intergenic
1082685199 11:56229638-56229660 GCGCCCACCACCACCATGCCCGG - Intergenic
1083155686 11:60821578-60821600 GCTCTCACCACACCCATGAATGG - Intergenic
1083191935 11:61058398-61058420 GCGCCCGCCACCACCATGCCCGG + Intergenic
1083214700 11:61211082-61211104 GCCCTCAGCATCACCATGAACGG + Exonic
1083217584 11:61229911-61229933 GCCCTCAGCATCACCATGAACGG + Exonic
1083220582 11:61249661-61249683 ACCCTCAGCATCACCATGAACGG + Exonic
1084815444 11:71643161-71643183 CCCACCACCAGCACCACGAATGG - Intergenic
1084892700 11:72244289-72244311 GCCCCGACCCCCACCCCGAAGGG + Intronic
1084965306 11:72741438-72741460 GCTCCCACCACCAGCAAGACAGG + Intronic
1084998528 11:73007478-73007500 GCCACCACTACCACCATGCTTGG - Intronic
1085260668 11:75202985-75203007 GACCCCATCACCACCACCAATGG - Intronic
1085429674 11:76437283-76437305 ACCCCCACCCCCACCAGCAAAGG + Intergenic
1086215656 11:84377341-84377363 GAAAGCACCACCACCATGAAAGG + Intronic
1087426814 11:97998882-97998904 TCCACCACCACCACCATGCCAGG + Intergenic
1089532813 11:119142552-119142574 CACCCCACAACCACCAGGAAGGG + Intergenic
1090941788 11:131393597-131393619 GCCCCCACCACCACCTCCCAGGG + Intronic
1091053049 11:132392086-132392108 GCCCCCACCACAAACATTCAGGG - Intergenic
1091549016 12:1523820-1523842 GCCCCCTCTACCAACAGGAACGG + Intergenic
1092135544 12:6144503-6144525 GCACCCGCCACCACCATGCCCGG + Intergenic
1092427568 12:8386890-8386912 GCCCCCACCACCACCATGAATGG + Intergenic
1092428833 12:8393868-8393890 CCCCCCACCACCACCATGAATGG + Intergenic
1092923090 12:13249836-13249858 GCCCCCACCACCACCCCAACAGG + Intergenic
1093455137 12:19357554-19357576 ACCATCACCACCACCATAAAAGG - Intronic
1093543367 12:20315563-20315585 GCCACCACCACCATCATCATGGG - Intergenic
1093715966 12:22382063-22382085 ACTCCCACCACCACCATGTATGG - Intronic
1093994381 12:25625779-25625801 GGCCTCACCACCACCAAGACAGG + Intronic
1094747532 12:33362826-33362848 GCACCCACCACCACCAGGCCTGG - Intergenic
1095936653 12:47691084-47691106 GCTACCACCACCACCGTGATCGG - Intronic
1097571060 12:61333113-61333135 GCCCCAACCACCACTTTTAACGG + Intergenic
1098567605 12:71953413-71953435 ACCCCCACCAGCACCATGGCAGG - Intronic
1098659267 12:73072444-73072466 GCCCCTGCCACCAGCATGGAGGG + Intergenic
1100019316 12:90050297-90050319 CTCCCCACCACCCCCAGGAATGG - Intergenic
1100253528 12:92858066-92858088 GCCACCAACACCAACATGAACGG + Intronic
1100870726 12:98907555-98907577 TCCCCCACCACCACCATTGGGGG - Intronic
1102046981 12:109835553-109835575 ACCCCAACCCCCACCATGGAGGG - Intergenic
1103714355 12:122935331-122935353 GCCTCCACCACCATCTCGAAAGG + Exonic
1103953507 12:124564813-124564835 GCCTCCACATCCAGCATGAATGG + Intronic
1104013756 12:124949337-124949359 GGCCCCACCAGCCCCAGGAAGGG + Intronic
1104787303 12:131457869-131457891 GCCCCCACCGCCGCCACCAAGGG + Intergenic
1104962265 12:132493855-132493877 ACCACCACCACCACCATTTAGGG - Intronic
1104963384 12:132498545-132498567 GCCCCCACCACCCCCATGTGGGG + Intronic
1105482714 13:20793697-20793719 GTGCCCACCACCACCATGCCTGG + Intronic
1105652083 13:22389940-22389962 TTCCCCACCACCACCATCAGTGG - Intergenic
1105899426 13:24742748-24742770 GCACCCACCACCCACCTGAATGG + Intergenic
1106269328 13:28138593-28138615 GCCGCCGCCACCACCATAGACGG - Exonic
1106940607 13:34774871-34774893 TATCTCACCACCACCATGAAGGG + Intergenic
1107532988 13:41302170-41302192 GTACCCACCACCACCATGTCTGG + Intergenic
1108455317 13:50607723-50607745 GGCCCCAGCACCACCATGGCTGG - Intronic
1108895088 13:55316333-55316355 ACAACCACCTCCACCATGAATGG - Intergenic
1109791878 13:67259466-67259488 ACTCCCACCAGCACCATGACAGG - Intergenic
1112391329 13:98987080-98987102 ACCACCACCACCACCATCAATGG + Intronic
1112412732 13:99178109-99178131 GCCACCACCACCACCATCCGCGG + Intergenic
1113787461 13:113010118-113010140 CCCCCCACCCGCACCATGAGAGG + Intronic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1114447011 14:22796392-22796414 GCCCCCACCAGCACCCTGAAAGG + Intronic
1114643173 14:24238227-24238249 GCCCCTGCCACCATCATGGAGGG - Exonic
1115473115 14:33788966-33788988 CCCCCCACCCCCACCAAGACTGG - Intronic
1117063627 14:51987356-51987378 GCCCCGGCCACCACCAGGAGTGG - Intergenic
1117420699 14:55542285-55542307 GCCCCCATCCCCACCTTGACTGG - Intergenic
1117827990 14:59723469-59723491 GCGCCCACCACCACCACGCCCGG - Intronic
1118523262 14:66611314-66611336 GCCCCTACCACCACTACCAATGG - Intronic
1119671615 14:76524091-76524113 ATCCTCACCACCACCATCAAAGG - Intergenic
1121009057 14:90509298-90509320 GCCACCTCCACCACCAAGAGGGG + Intergenic
1121103096 14:91263621-91263643 GCCCCCACCATCAACATTCAAGG - Intergenic
1122789066 14:104176800-104176822 GCCTCCCCCACCAGCAAGAAGGG + Exonic
1123156252 14:106229301-106229323 GCCCCATCCACCCTCATGAATGG - Intergenic
1123737024 15:23195479-23195501 GCGCCCACCACCACCAGGCCAGG - Intergenic
1124211741 15:27770090-27770112 ACCCCCAGCACCACCAAGCATGG + Intronic
1124287722 15:28418455-28418477 GCGCCCACCACCACCAGGCCAGG - Intergenic
1124288243 15:28424156-28424178 GCGCCCACCACCACCAGGCCAGG - Intergenic
1124294982 15:28493171-28493193 GCGCCCACCACCACCAGGCCAGG + Intergenic
1126337668 15:47604840-47604862 GCGCCCACCACCACCATGCCTGG + Intronic
1126629120 15:50715595-50715617 TCCCCCACCCCCACCCTTAACGG - Intronic
1126757214 15:51936342-51936364 GGCCCCAGCACCACCATGCCAGG + Intronic
1128313865 15:66647775-66647797 ACCCCCACCACCTCCATGCTAGG - Intronic
1128785530 15:70394170-70394192 TCTCCCACCACCACCATCAGGGG - Intergenic
1129220405 15:74128862-74128884 GCCCCCACCCCCACCTTGTTCGG + Intronic
1129451121 15:75651870-75651892 TCACCCACCACCACCAGGGAGGG + Intronic
1129459975 15:75695648-75695670 CCCCCCACCACCTCCAAGACAGG - Intronic
1129541366 15:76350414-76350436 ACCCCCACCCCCACCAAGTAAGG + Intronic
1129612523 15:77071803-77071825 ACCCCCACCACAACCCTGGATGG + Intronic
1129703359 15:77780773-77780795 CCCCCCACCCCCACCATGTGAGG + Intronic
1130157224 15:81362029-81362051 GCCCCCACCACCTACCAGAATGG - Intronic
1130432172 15:83859671-83859693 GGTACCACCACCCCCATGAATGG - Intronic
1131236887 15:90704441-90704463 GCCCCCACACCCAGCAGGAAAGG - Intergenic
1131460572 15:92614765-92614787 ACCACCAGCACCACCAGGAATGG - Intergenic
1131823209 15:96293760-96293782 CCCCCCACCCCCACCATGTTAGG - Intergenic
1131942842 15:97585669-97585691 GCCCCCACCCCCACAACCAAAGG - Intergenic
1132435866 15:101802094-101802116 GCATCCTCCACCACCATGTAAGG + Intergenic
1132605468 16:792037-792059 GCCCCCACCACCCTCAAGACGGG - Intronic
1132673710 16:1113113-1113135 GCCACCAGCAGCACCATGGAAGG - Intergenic
1132692233 16:1186823-1186845 GCCGTGACCACCACCATGACCGG + Intronic
1132889638 16:2197248-2197270 GCCCCCACCACCCCCACTGAGGG + Intergenic
1133112879 16:3559782-3559804 ACACCCACCACCACCACGACTGG + Intronic
1133370676 16:5243489-5243511 GCCCCCACCAGCACCACGAATGG - Intergenic
1133636927 16:7675758-7675780 GTCCTCACCATCACCATAAAGGG - Intronic
1135376898 16:21954907-21954929 GCGCCCACCACCACCACGCCCGG - Intronic
1135667764 16:24350438-24350460 GCACCCACCACCACCATGTCTGG + Intronic
1136084168 16:27872752-27872774 ACTCCCACCAGCACCATGAGAGG + Intronic
1136612640 16:31376478-31376500 GCACACACCACCACCATGCCTGG - Intronic
1136646650 16:31624938-31624960 ACCACCACCACCACCACCAAAGG + Intergenic
1138202494 16:55100657-55100679 CCTCCCACTACCACCCTGAAGGG - Intergenic
1138356329 16:56383889-56383911 ACCCCCACCACCACCACCAGGGG - Intronic
1138815088 16:60194500-60194522 GCGCCCACCACCACCACGCCTGG - Intergenic
1139792075 16:69446467-69446489 GCACCCACCACCACCATGCCTGG + Intronic
1139847152 16:69929242-69929264 CCCCCCACCACCAACAAGGAAGG + Intronic
1140997933 16:80279137-80279159 GCCCCCACCCCCACCTCAAAAGG - Intergenic
1141163378 16:81644216-81644238 GGCACCAGCACCACCATGACTGG - Intronic
1141948803 16:87327508-87327530 GCACCCACCACCACCATGCTTGG - Exonic
1142191350 16:88719686-88719708 GCCCGCAGCTCCACCAGGAACGG + Exonic
1142722389 17:1785278-1785300 GCGCCCGCCACCACCATGCCCGG - Intronic
1143176394 17:4957634-4957656 GGTCCTGCCACCACCATGAAGGG + Intergenic
1143409314 17:6698894-6698916 GCACCCACCACCACCATGCCTGG - Intronic
1144549588 17:16228195-16228217 GCACCCACCACCACCATGCCCGG + Intronic
1144847893 17:18229551-18229573 GGCCCCACCTGCTCCATGAAGGG - Intronic
1146016954 17:29241408-29241430 GCACCCACCTCCCCCATGAGGGG - Intergenic
1147282530 17:39374077-39374099 GCGCCCACCACCACCACGCCTGG - Intronic
1147856315 17:43483164-43483186 GCGCCCACCACCACCACGCCCGG + Intergenic
1147992858 17:44345625-44345647 CCACCCACCACCACCAGGAGAGG - Intronic
1148081559 17:44969804-44969826 GACCCCACCACCACCAAGGAGGG + Intergenic
1148482851 17:47971266-47971288 GTCCCAACCACCACCCTGCAGGG - Intronic
1148587297 17:48790210-48790232 GCCCTCACTACCAAGATGAAAGG + Intronic
1152113749 17:78372172-78372194 GCCACCGCCACCACCATGCCTGG + Intergenic
1152567007 17:81104921-81104943 GCCCCAACCACCTCCCTGCAGGG + Intronic
1152756782 17:82090335-82090357 GCCCCCAGCACCTCCAAGAAAGG - Intronic
1153006197 18:500507-500529 GTCCCCACGGTCACCATGAAAGG - Exonic
1156815765 18:41309190-41309212 ACCCCCAACAACACCATGACTGG + Intergenic
1158008962 18:52706689-52706711 GCACCCACCACGACCAAGCATGG + Intronic
1158755577 18:60320614-60320636 ACCCCCACCACCCCGATGATGGG - Intergenic
1159628760 18:70724928-70724950 TCCCCCACCACCCCCATCCATGG - Intergenic
1159785077 18:72704302-72704324 ATCCCCACCACCGCCATCAAAGG + Intergenic
1160122544 18:76143700-76143722 ACCCCAACCACCACCACGAGAGG + Intergenic
1160350197 18:78171860-78171882 CCCCCCACCCCCGCCATGAAAGG - Intergenic
1161997942 19:7725649-7725671 GCGCCCGCCACCACCATGCCTGG - Intergenic
1162003781 19:7764632-7764654 GCGCCCACCACCACCACGCCCGG + Intronic
1162745207 19:12793972-12793994 ACCCCCACCCCCTCCAGGAAGGG + Intronic
1163435819 19:17294499-17294521 GCCTCCACCACCACCAGGGCCGG - Exonic
1163608133 19:18286961-18286983 GCCCCCTCCACTACCATCTATGG - Intergenic
1166307098 19:41941076-41941098 GCCCCCACCCCCACCACGCCTGG + Intergenic
1166542824 19:43616934-43616956 GCAGCCACCACCACCATGCCCGG + Intronic
1166788196 19:45382096-45382118 GCGCCCACCACCACCACGCCCGG - Intronic
1166871297 19:45872681-45872703 GCTGCCACCACCACCAGGAACGG + Exonic
1167139669 19:47641044-47641066 GCACCCACCACCACCATGCCTGG + Intronic
1167735450 19:51291847-51291869 ACCCCCACCAGCACCATGACAGG - Intergenic
1168210894 19:54889225-54889247 GCGCCCACCACCACCACGCCTGG - Intronic
1168338370 19:55609779-55609801 CCCTCCACCACCACCACCAAGGG - Intronic
925846874 2:8042842-8042864 GCCCCCACCACTGGCATGAGTGG + Intergenic
927447542 2:23177527-23177549 GCCCCCGCCAACTCCATGACAGG - Intergenic
927752973 2:25686414-25686436 CCCTCCCCCACCACCATGCAGGG - Intergenic
928524068 2:32121684-32121706 GTGCCCACCACCACCATGCCCGG + Intronic
929864788 2:45708836-45708858 GCCCCCAAGACCACTATGACTGG - Intronic
931193181 2:60025044-60025066 ACCACCACCACCACCAGGACAGG + Intergenic
931792904 2:65681135-65681157 TCTCCCACCTCCACCATGGAGGG - Intergenic
932053123 2:68418760-68418782 CCTCCCACCACCCCCATGGAGGG - Intergenic
932593014 2:73078485-73078507 GTCACCACCACCACCAGGGAGGG + Intronic
932809430 2:74811803-74811825 CACCCCACAACCACCATCAAGGG - Intergenic
933460528 2:82577981-82578003 GCGCCCGCCGCCACCATGCAGGG - Intergenic
934770398 2:96904002-96904024 GCCCCCACCAGCACCTGGCATGG - Intronic
934845955 2:97661422-97661444 GCCCCCACCAGTACCATACAGGG + Intronic
935082705 2:99814244-99814266 ACCACCACCACCACCCTCAAAGG + Intronic
936007834 2:108906253-108906275 GCCCACCCCACCGACATGAAGGG - Intronic
937436701 2:121887390-121887412 GACCTCACTTCCACCATGAAGGG + Intergenic
938387447 2:130877054-130877076 GACCCCATCGCCACCATGGAGGG - Intronic
938568569 2:132541976-132541998 GCCCCCTCCACCACCATGTGAGG - Intronic
939203054 2:139063065-139063087 CCCCCCCCCACCTCCAGGAAGGG - Intergenic
940622863 2:156134755-156134777 CCCCCCACCACCACCACCACTGG + Intergenic
945374878 2:209068013-209068035 ACCCCCACCTCCACCAGCAAAGG - Intergenic
947170441 2:227305521-227305543 GCACCCACCACCATGAAGAATGG - Intronic
1169254003 20:4083423-4083445 ACCCCCACCCGCACCATCAAAGG - Intergenic
1170343076 20:15351108-15351130 GCCCCCACCCCCACCCTACAAGG - Intronic
1171507330 20:25648301-25648323 GCCCCCATCACCCCTATGCAAGG + Intergenic
1171559867 20:26113873-26113895 GCACCCACCACCAGCAGGTAAGG - Intergenic
1171955003 20:31454982-31455004 GCGCCCACCGCCACCATGCCCGG + Intergenic
1172110418 20:32541486-32541508 GCCACCCCCACCACCATCCAAGG - Intronic
1172330784 20:34074854-34074876 GCCATCACCACCTCCAGGAAGGG + Intronic
1172457710 20:35091138-35091160 GCACACACCACCACCATGCCCGG + Intronic
1172536173 20:35675076-35675098 GCCCCCAGCCCCACCACTAAGGG + Exonic
1173454306 20:43190610-43190632 GTCCCCACCACCACGCGGAAGGG + Intergenic
1173911380 20:46673535-46673557 CCCGCCACCATCACCATGACTGG + Intronic
1174352969 20:49981593-49981615 ACCACCACCACCAACCTGAAGGG - Intergenic
1174549635 20:51352641-51352663 GCACCCACCACCACCACGCCTGG + Intergenic
1176651184 21:9548979-9549001 GCACCCACCACCAGCAGGTAAGG + Intergenic
1178033778 21:28557834-28557856 GCGCCCACCACCACCATGCCTGG - Intergenic
1179273348 21:39868564-39868586 TCTCCCACCACCACAATCAATGG + Intronic
1179367047 21:40768322-40768344 CCCCCCACCCCCACCCTGAGGGG + Intronic
1180009613 21:45040698-45040720 GCCTCCCCCACCACCTTGAAGGG - Intergenic
1180220706 21:46356210-46356232 CCCCTCACCCCCACCATGGACGG - Intronic
1181035938 22:20169778-20169800 GCCCCCACCCCCACCAGCCAGGG + Intergenic
1181148736 22:20867376-20867398 GCCCCAGCCACCACCAAGACAGG - Intronic
1181759355 22:25047435-25047457 GCCGCCACCACCACCATGCCTGG + Intronic
1182233254 22:28855048-28855070 GCCCCAACCCCCAACATGACTGG - Intergenic
1182459158 22:30471951-30471973 GCCCCAGCCAGCACCATGAGCGG - Exonic
1182549532 22:31093433-31093455 GTCCCCACCAGCACCATGCCGGG + Intronic
1182613372 22:31568384-31568406 GTGCCCACCACCACCATGCCCGG - Intronic
1182763882 22:32744753-32744775 ACCACCACCACCACCACCAAGGG + Intronic
1183460162 22:37945003-37945025 ACCCCCACCCCCAGCATGACTGG + Intronic
1183833851 22:40435787-40435809 GCGCCCACCACCACCACGCCTGG - Intronic
1184607049 22:45580206-45580228 TTCCTCTCCACCACCATGAAGGG - Intronic
1184632088 22:45789665-45789687 ACCACCACCACCACCACAAAGGG - Intronic
1185380571 22:50505871-50505893 GCACCCACCTCCACCCTGCAGGG + Intronic
1185421586 22:50738045-50738067 TCCCCCACCACCAGGATGATGGG - Intergenic
950211892 3:11129756-11129778 GCGCCCATCACCACCATGCCTGG - Intergenic
950750223 3:15122614-15122636 CCCACCACCACCACCATGAATGG - Intergenic
950787735 3:15450095-15450117 GGCCCCACCCCCACCACCAACGG + Intronic
951720096 3:25689099-25689121 GCCCCCACCCCCAACCTAAAGGG - Intergenic
952903773 3:38126560-38126582 CGCCCCAGCACCACCATGGAGGG - Exonic
952998164 3:38905191-38905213 ATCCTCACCATCACCATGAAGGG - Exonic
953914377 3:46909183-46909205 GCCCCCACCACCTGGATGGATGG + Intergenic
954441709 3:50525720-50525742 GCCCCCACCACCACTCTCAGGGG - Intergenic
954994658 3:54870546-54870568 CACCCCACAACCAGCATGAAAGG + Intronic
955083412 3:55678775-55678797 GCCCCCACCACCACCAATAATGG + Intronic
955529327 3:59856898-59856920 ATCCCCACAACCACCCTGAATGG + Intronic
957072267 3:75576586-75576608 CTCACCACCACCACCACGAATGG + Intergenic
957837843 3:85622157-85622179 GCCTTCACCACCACCATAAATGG + Intronic
958640065 3:96794640-96794662 CCTGCCACCACCACCATGACTGG - Intergenic
960634410 3:119768811-119768833 GCTCCCACCAGCTCCATGGAGGG + Intergenic
961281803 3:125770189-125770211 CCTCCCACCACCACCACGAATGG - Intergenic
961659759 3:128462500-128462522 CCCACCACCACCACCGTGCATGG - Exonic
961678440 3:128582882-128582904 GCCTCCTCCACCAGCATGAATGG + Intergenic
961872545 3:129999395-129999417 CCGCTCACCACCACCACGAATGG + Intergenic
962709029 3:138070156-138070178 GCTCCCACCACCCCCATGCTTGG + Intronic
967059577 3:185860074-185860096 GCATCCACCACCACCATGCCTGG - Intergenic
968113387 3:196068783-196068805 GTGCCCACCACCACCATGCCTGG - Intronic
968532917 4:1104696-1104718 GCCCCCACCACCACTGTCACTGG + Intronic
969111698 4:4848542-4848564 GCCACCTCCACCACCATGTCTGG - Intergenic
969738092 4:9004454-9004476 CCCACCACCAGCACCACGAATGG - Intergenic
969797282 4:9535998-9536020 CCCACCACCAGCACCACGAATGG - Intergenic
973189513 4:47371085-47371107 TCCCCCACCCCCACCCTGACAGG + Intronic
976004029 4:80406819-80406841 GCTCCCACAACAACCTTGAAGGG + Intronic
976563616 4:86529409-86529431 GCCCCCACCTCCACCTAGAAAGG + Intronic
978839533 4:113193712-113193734 GTCCTCACCACCACTCTGAATGG - Intronic
981670930 4:147286342-147286364 ACCGCCATCACCACCATCAAAGG + Intergenic
981942830 4:150303714-150303736 GCACCCACCACCACCACGCCCGG + Intronic
982729666 4:158942625-158942647 CTCCCCACCACCACCATGCCTGG - Intronic
983679033 4:170330766-170330788 CCCCCCACCACCACCATGGCCGG - Intergenic
984672098 4:182502257-182502279 GCCCCCAGCATCCTCATGAAAGG - Intronic
985615393 5:917008-917030 GCCCCCACCGTCACCATAGAGGG + Exonic
986559040 5:9042230-9042252 GCCTCCACCAGCACCAGCAATGG + Exonic
986693989 5:10335936-10335958 GCCAGCACGAGCACCATGAAGGG - Intergenic
988812351 5:34798179-34798201 GCACCCACCACCACCACGCCCGG + Intronic
988949308 5:36241575-36241597 GCCACCACCACCACCCGGGAGGG + Exonic
989474085 5:41854737-41854759 GACACCACCACAAACATGAAGGG + Intronic
990965463 5:61442100-61442122 GACCCCACACCCACCATGATTGG - Intronic
993915759 5:93741507-93741529 GCCCCCACCACTGCCTGGAAGGG + Exonic
996959510 5:129230029-129230051 GCACCCACCACCACCATGCCTGG + Intergenic
998137185 5:139680285-139680307 GCCACCACCGCCACTATCAACGG - Intronic
998483887 5:142485290-142485312 ACCACCACCTCCATCATGAAAGG + Intergenic
999780667 5:154847631-154847653 GCACCCACCCCCACCATGCCTGG + Intronic
1001221503 5:169904463-169904485 TTCCCCACCACCCCCATTAAAGG - Intronic
1001304312 5:170560583-170560605 GCCCCCTTCACCACCAAGAAAGG - Intronic
1001383345 5:171318219-171318241 GCCCCCACCACCCCCAGTCAGGG + Intergenic
1002184410 5:177447373-177447395 GCCCCCACCCCCACCCTCGACGG - Intronic
1003158931 6:3619022-3619044 ACCCCCACCACCACCATGATTGG + Intergenic
1003159312 6:3621703-3621725 CACCCCACCACCACCATGATTGG + Intergenic
1003351404 6:5320882-5320904 GCCCCCACAACCACCACGTGAGG - Intronic
1005517364 6:26567743-26567765 GCGCCCACCACCACCACGCCCGG + Intergenic
1006601731 6:35231016-35231038 CCCCCCACCCCCACCATCTAGGG + Intronic
1007261251 6:40564884-40564906 GCCTCCTCCACCACCATCACAGG + Intronic
1007522442 6:42461644-42461666 GCCCCCACCACTACCATGGCCGG + Intergenic
1007819105 6:44547480-44547502 ACCCCCACCCCCACCATGGCAGG + Intergenic
1010474981 6:76276048-76276070 GCCACCACCACCCCCATCACTGG - Intergenic
1010732858 6:79409518-79409540 GCGCCCGCCACCACCATGCCCGG + Intergenic
1017713522 6:157190900-157190922 CCCACCACCACCCCCATGACAGG - Intronic
1019012242 6:168851201-168851223 TTCCCCACCACCACCTTGAGAGG + Intergenic
1019430825 7:998226-998248 GCCCCCACCACCAGCAGACAAGG - Intronic
1020276540 7:6628144-6628166 CCCCACACCTCCCCCATGAAGGG + Intergenic
1021576735 7:22112102-22112124 TCCCCCACCCCCAGCATGAGTGG + Intergenic
1021713201 7:23436971-23436993 GCGCACACCACCACCATGCCTGG - Intronic
1022164221 7:27741644-27741666 GCGCGCACCACCACACTGAAGGG + Intronic
1027415958 7:77975154-77975176 GCGCCCGCCACCACCATGCCTGG - Intergenic
1027483385 7:78727999-78728021 GCCCCCTCCATCACCATTACTGG - Intronic
1029074534 7:97925542-97925564 CCCACCACCACCACCATGAATGG + Intergenic
1029089447 7:98036773-98036795 GCACCCACCACCACCATGCCCGG + Intergenic
1031599843 7:123692841-123692863 ACCACCTCCACCACCATCAAGGG - Exonic
1032328681 7:130956795-130956817 GCCCTGACCGCCATCATGAAAGG - Intergenic
1034028285 7:147732185-147732207 CCCCCCACCACCCCCATGACAGG + Intronic
1034337855 7:150334874-150334896 GCACCCGCCACCACCATGCCTGG - Intronic
1034496586 7:151427053-151427075 GCCATCACCAGCCCCATGAAGGG + Intergenic
1036195059 8:6707289-6707311 CTCCCCACCACCACCATAATGGG - Intergenic
1036257624 8:7218316-7218338 CCCCCCACCACCACCACGAATGG + Intergenic
1036258876 8:7225315-7225337 CCCACCACCAGCACCACGAATGG + Intergenic
1036307744 8:7614195-7614217 CCCACCACCAGCACCACGAATGG - Intergenic
1036309676 8:7676912-7676934 CCCCCCACCACCACCACGAATGG + Intergenic
1036310931 8:7683911-7683933 CCCACCACCAGCACCACGAATGG + Intergenic
1036358598 8:8062196-8062218 CCCACCACCAGCACCACGAATGG - Intergenic
1036359862 8:8069207-8069229 CCCCCCACCACCACCACGAATGG - Intergenic
1036829555 8:12011443-12011465 CCCCCCCCAACCACCACGAATGG + Intergenic
1036891095 8:12597763-12597785 CCCCCCACCACCACCACGAATGG + Intergenic
1036892361 8:12604756-12604778 CCCACCACCAGCACCACGAATGG + Intergenic
1036898652 8:12655689-12655711 ACCACCACCACCACCATGAATGG + Intergenic
1036899905 8:12662732-12662754 CCCACCACCAGCACCACGAATGG + Intergenic
1037162263 8:15788075-15788097 GCCCTCATCATCCCCATGAAAGG - Intergenic
1037893098 8:22634413-22634435 GCCGTCACCACCACCATGCCCGG - Intronic
1038535711 8:28351646-28351668 GCTCCCACCCCCAGCATGACTGG - Exonic
1038792579 8:30681377-30681399 GCCTGCACCACCACCATGCCTGG - Intronic
1039330585 8:36532740-36532762 GCCCCTACTACAACCAAGAAAGG + Intergenic
1039479160 8:37858867-37858889 CCCCCCACCCCCACCAAGAGAGG + Intronic
1039581373 8:38669579-38669601 GCCTCCACCACCCCCAAGCATGG - Intergenic
1039791856 8:40882604-40882626 GCCACCACCACCACCAGCAGCGG + Intronic
1039952283 8:42181736-42181758 CTCCCCACCACCCCCATGCATGG + Intronic
1040430611 8:47338148-47338170 CCACACACCACCACCAGGAAAGG - Intronic
1041293659 8:56332898-56332920 TCCCCCACCACCACCAGAACAGG - Intergenic
1042007817 8:64201894-64201916 GCCACCTGGACCACCATGAATGG + Intergenic
1042026572 8:64430520-64430542 GTCCCAACCACCACAATGTAGGG - Intergenic
1042655146 8:71087608-71087630 TCCCCCACCACCACCACAAAAGG - Intergenic
1044222596 8:89686766-89686788 CCCCCCACCACAACCCTGAGAGG + Intergenic
1044934256 8:97277837-97277859 GCCTCCGCCGCCACCATGAGCGG - Exonic
1044937761 8:97309499-97309521 TCCCCCACCACCACTATCCATGG + Intergenic
1046466346 8:114608907-114608929 GCACCCACCACCACCAAGCCTGG - Intergenic
1047901149 8:129423427-129423449 ACCACCACCACCACCATCATTGG - Intergenic
1048228753 8:132616426-132616448 GACCCCACCACCACCACTAGTGG - Intronic
1048553019 8:135451188-135451210 GCCCTCATCACCACCATGTCTGG - Intergenic
1049091671 8:140519455-140519477 GCCTGCACCACCACCATGCCCGG - Intergenic
1049264516 8:141660339-141660361 GCCCTCAACTCCACAATGAAGGG + Intergenic
1050564238 9:6865894-6865916 GCGCCCGCCACCACCATGCCTGG + Intronic
1052190051 9:25649828-25649850 GCCACCACATCCAGCATGAAGGG + Intergenic
1052379805 9:27757750-27757772 TCCCCCACCACCCCCAAAAAAGG - Intergenic
1052748763 9:32467454-32467476 CCCACCAGCACCACCATGAAAGG + Intronic
1056144880 9:83719653-83719675 ACCTCCACCACCACCATGCCGGG + Intergenic
1056909131 9:90682257-90682279 GCACCCGCCACCACCATGCCTGG - Intergenic
1060220813 9:121763201-121763223 GCCCCCACCACCACAGAGAATGG - Intronic
1060572550 9:124655989-124656011 GGCCCCACCACCAACATAAGGGG - Intronic
1061362198 9:130150792-130150814 GCTCCCACCAGCACCATGACAGG - Intergenic
1061915950 9:133754234-133754256 GCTGCCACCACCACCACCAAGGG - Intergenic
1203628919 Un_KI270750v1:52529-52551 GCACCCACCACCAGCAGGTAAGG + Intergenic
1187163510 X:16785323-16785345 CCCACCACCACCACCATGCCCGG + Intergenic
1187485410 X:19698627-19698649 ACCCCCACCACCCCCATGAAGGG - Intronic
1188092068 X:25976683-25976705 GCCCCCACTCCCACAATGAAGGG + Intergenic
1188559749 X:31454282-31454304 GCGCACACCACCACCATGCCTGG + Intronic
1188582014 X:31725379-31725401 CCCCCCACCACCACCCCAAAAGG - Intronic
1188780120 X:34272072-34272094 GCTCCCACCGACAACATGAAGGG + Intergenic
1189571106 X:42298388-42298410 CCCTCCACCACCTCCACGAAAGG - Intergenic
1190819034 X:53956102-53956124 GCACCCGCCACCACCATGCCTGG - Intronic
1195112714 X:101663950-101663972 CCCACCACCTCCACCATGCAGGG - Intergenic
1197867634 X:131035944-131035966 GCCCCAACCACAACCAGGGAGGG - Intergenic
1198240857 X:134784317-134784339 GCACCCACCACCACCACGCCTGG - Intronic
1200136774 X:153879115-153879137 CCCCCCACCAGCACCACTAAGGG + Intronic
1201238901 Y:11938898-11938920 AACCCCACCACCACCATCAGTGG + Intergenic