ID: 1092427632

View in Genome Browser
Species Human (GRCh38)
Location 12:8387240-8387262
Sequence GCTGTGGGTCAGACACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092427624_1092427632 10 Left 1092427624 12:8387207-8387229 CCTAGGAGACACTTTTCTCTCCC No data
Right 1092427632 12:8387240-8387262 GCTGTGGGTCAGACACACCCTGG No data
1092427623_1092427632 17 Left 1092427623 12:8387200-8387222 CCAAGTACCTAGGAGACACTTTT No data
Right 1092427632 12:8387240-8387262 GCTGTGGGTCAGACACACCCTGG No data
1092427629_1092427632 -10 Left 1092427629 12:8387227-8387249 CCCTCCAGGAGGAGCTGTGGGTC No data
Right 1092427632 12:8387240-8387262 GCTGTGGGTCAGACACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092427632 Original CRISPR GCTGTGGGTCAGACACACCC TGG Intergenic
No off target data available for this crispr