ID: 1092428131

View in Genome Browser
Species Human (GRCh38)
Location 12:8390054-8390076
Sequence CTCCCGGCCAGGGACGTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092428125_1092428131 7 Left 1092428125 12:8390024-8390046 CCTTTTGGCTAGCTGCAGAGTCC No data
Right 1092428131 12:8390054-8390076 CTCCCGGCCAGGGACGTCGTGGG No data
1092428122_1092428131 12 Left 1092428122 12:8390019-8390041 CCTCCCCTTTTGGCTAGCTGCAG No data
Right 1092428131 12:8390054-8390076 CTCCCGGCCAGGGACGTCGTGGG No data
1092428117_1092428131 30 Left 1092428117 12:8390001-8390023 CCAGGACGCGGGGCTCCCCCTCC No data
Right 1092428131 12:8390054-8390076 CTCCCGGCCAGGGACGTCGTGGG No data
1092428123_1092428131 9 Left 1092428123 12:8390022-8390044 CCCCTTTTGGCTAGCTGCAGAGT No data
Right 1092428131 12:8390054-8390076 CTCCCGGCCAGGGACGTCGTGGG No data
1092428124_1092428131 8 Left 1092428124 12:8390023-8390045 CCCTTTTGGCTAGCTGCAGAGTC No data
Right 1092428131 12:8390054-8390076 CTCCCGGCCAGGGACGTCGTGGG No data
1092428119_1092428131 15 Left 1092428119 12:8390016-8390038 CCCCCTCCCCTTTTGGCTAGCTG No data
Right 1092428131 12:8390054-8390076 CTCCCGGCCAGGGACGTCGTGGG No data
1092428121_1092428131 13 Left 1092428121 12:8390018-8390040 CCCTCCCCTTTTGGCTAGCTGCA No data
Right 1092428131 12:8390054-8390076 CTCCCGGCCAGGGACGTCGTGGG No data
1092428120_1092428131 14 Left 1092428120 12:8390017-8390039 CCCCTCCCCTTTTGGCTAGCTGC No data
Right 1092428131 12:8390054-8390076 CTCCCGGCCAGGGACGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092428131 Original CRISPR CTCCCGGCCAGGGACGTCGT GGG Intergenic