ID: 1092428898

View in Genome Browser
Species Human (GRCh38)
Location 12:8394221-8394243
Sequence GCTGTGGGTCAGACACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092428895_1092428898 -10 Left 1092428895 12:8394208-8394230 CCCTCCAGGAGGAGCTGTGGGTC No data
Right 1092428898 12:8394221-8394243 GCTGTGGGTCAGACACACCCTGG No data
1092428890_1092428898 10 Left 1092428890 12:8394188-8394210 CCTAGGAGACACTTTTCTCTCCC No data
Right 1092428898 12:8394221-8394243 GCTGTGGGTCAGACACACCCTGG No data
1092428889_1092428898 17 Left 1092428889 12:8394181-8394203 CCAAGTACCTAGGAGACACTTTT No data
Right 1092428898 12:8394221-8394243 GCTGTGGGTCAGACACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092428898 Original CRISPR GCTGTGGGTCAGACACACCC TGG Intergenic
No off target data available for this crispr