ID: 1092429378

View in Genome Browser
Species Human (GRCh38)
Location 12:8396830-8396852
Sequence CACCGCCACCACGCCGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092429368_1092429378 26 Left 1092429368 12:8396781-8396803 CCGCGGGCCGCTCGTGGTCCTCT No data
Right 1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG No data
1092429374_1092429378 -2 Left 1092429374 12:8396809-8396831 CCTCTGCTGGCCGCTCACGCGCA No data
Right 1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG No data
1092429367_1092429378 29 Left 1092429367 12:8396778-8396800 CCTCCGCGGGCCGCTCGTGGTCC No data
Right 1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG No data
1092429370_1092429378 19 Left 1092429370 12:8396788-8396810 CCGCTCGTGGTCCTCTGGCGCCC No data
Right 1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG No data
1092429373_1092429378 -1 Left 1092429373 12:8396808-8396830 CCCTCTGCTGGCCGCTCACGCGC No data
Right 1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG No data
1092429372_1092429378 8 Left 1092429372 12:8396799-8396821 CCTCTGGCGCCCTCTGCTGGCCG No data
Right 1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092429378 Original CRISPR CACCGCCACCACGCCGGGCC CGG Intergenic
No off target data available for this crispr