ID: 1092431273

View in Genome Browser
Species Human (GRCh38)
Location 12:8410985-8411007
Sequence CGGTATGATTCCACTTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092431273_1092431277 29 Left 1092431273 12:8410985-8411007 CCTAGAAAAGTGGAATCATACCG No data
Right 1092431277 12:8411037-8411059 TCTTTCTCTGTCACCCCGGCTGG No data
1092431273_1092431276 25 Left 1092431273 12:8410985-8411007 CCTAGAAAAGTGGAATCATACCG No data
Right 1092431276 12:8411033-8411055 AGAGTCTTTCTCTGTCACCCCGG 0: 187
1: 11707
2: 57985
3: 129820
4: 175829
1092431273_1092431275 -2 Left 1092431273 12:8410985-8411007 CCTAGAAAAGTGGAATCATACCG No data
Right 1092431275 12:8411006-8411028 CGTGTTTAATTTTTTTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092431273 Original CRISPR CGGTATGATTCCACTTTTCT AGG (reversed) Intergenic
No off target data available for this crispr