ID: 1092434176

View in Genome Browser
Species Human (GRCh38)
Location 12:8433173-8433195
Sequence CGGTATGATTCCACTTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092434176_1092434180 29 Left 1092434176 12:8433173-8433195 CCTAGAAAAGTGGAATCATACCG No data
Right 1092434180 12:8433225-8433247 TCTTTCTCTGTCACCCCGGCTGG No data
1092434176_1092434178 -2 Left 1092434176 12:8433173-8433195 CCTAGAAAAGTGGAATCATACCG No data
Right 1092434178 12:8433194-8433216 CGTGTTTAATTTTTTTGTTTTGG No data
1092434176_1092434179 25 Left 1092434176 12:8433173-8433195 CCTAGAAAAGTGGAATCATACCG No data
Right 1092434179 12:8433221-8433243 AGAGTCTTTCTCTGTCACCCCGG 0: 187
1: 11707
2: 57985
3: 129820
4: 175829

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092434176 Original CRISPR CGGTATGATTCCACTTTTCT AGG (reversed) Intergenic
No off target data available for this crispr