ID: 1092434178

View in Genome Browser
Species Human (GRCh38)
Location 12:8433194-8433216
Sequence CGTGTTTAATTTTTTTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092434176_1092434178 -2 Left 1092434176 12:8433173-8433195 CCTAGAAAAGTGGAATCATACCG No data
Right 1092434178 12:8433194-8433216 CGTGTTTAATTTTTTTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092434178 Original CRISPR CGTGTTTAATTTTTTTGTTT TGG Intergenic
No off target data available for this crispr