ID: 1092434179

View in Genome Browser
Species Human (GRCh38)
Location 12:8433221-8433243
Sequence AGAGTCTTTCTCTGTCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375528
Summary {0: 187, 1: 11707, 2: 57985, 3: 129820, 4: 175829}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092434177_1092434179 5 Left 1092434177 12:8433193-8433215 CCGTGTTTAATTTTTTTGTTTTG No data
Right 1092434179 12:8433221-8433243 AGAGTCTTTCTCTGTCACCCCGG 0: 187
1: 11707
2: 57985
3: 129820
4: 175829
1092434176_1092434179 25 Left 1092434176 12:8433173-8433195 CCTAGAAAAGTGGAATCATACCG No data
Right 1092434179 12:8433221-8433243 AGAGTCTTTCTCTGTCACCCCGG 0: 187
1: 11707
2: 57985
3: 129820
4: 175829

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092434179 Original CRISPR AGAGTCTTTCTCTGTCACCC CGG Intergenic
Too many off-targets to display for this crispr