ID: 1092434180

View in Genome Browser
Species Human (GRCh38)
Location 12:8433225-8433247
Sequence TCTTTCTCTGTCACCCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092434176_1092434180 29 Left 1092434176 12:8433173-8433195 CCTAGAAAAGTGGAATCATACCG No data
Right 1092434180 12:8433225-8433247 TCTTTCTCTGTCACCCCGGCTGG No data
1092434177_1092434180 9 Left 1092434177 12:8433193-8433215 CCGTGTTTAATTTTTTTGTTTTG No data
Right 1092434180 12:8433225-8433247 TCTTTCTCTGTCACCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092434180 Original CRISPR TCTTTCTCTGTCACCCCGGC TGG Intergenic
No off target data available for this crispr