ID: 1092435137

View in Genome Browser
Species Human (GRCh38)
Location 12:8441453-8441475
Sequence GTGTACACACCCTTCCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092435137_1092435142 8 Left 1092435137 12:8441453-8441475 CCAATATGGAAGGGTGTGTACAC No data
Right 1092435142 12:8441484-8441506 TGATATGGTTTTTAATATCCAGG No data
1092435137_1092435143 9 Left 1092435137 12:8441453-8441475 CCAATATGGAAGGGTGTGTACAC No data
Right 1092435143 12:8441485-8441507 GATATGGTTTTTAATATCCAGGG No data
1092435137_1092435138 -7 Left 1092435137 12:8441453-8441475 CCAATATGGAAGGGTGTGTACAC No data
Right 1092435138 12:8441469-8441491 TGTACACGCCCCTTGTGATATGG No data
1092435137_1092435146 15 Left 1092435137 12:8441453-8441475 CCAATATGGAAGGGTGTGTACAC No data
Right 1092435146 12:8441491-8441513 GTTTTTAATATCCAGGGGGCTGG No data
1092435137_1092435147 18 Left 1092435137 12:8441453-8441475 CCAATATGGAAGGGTGTGTACAC No data
Right 1092435147 12:8441494-8441516 TTTAATATCCAGGGGGCTGGAGG No data
1092435137_1092435145 11 Left 1092435137 12:8441453-8441475 CCAATATGGAAGGGTGTGTACAC No data
Right 1092435145 12:8441487-8441509 TATGGTTTTTAATATCCAGGGGG No data
1092435137_1092435144 10 Left 1092435137 12:8441453-8441475 CCAATATGGAAGGGTGTGTACAC No data
Right 1092435144 12:8441486-8441508 ATATGGTTTTTAATATCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092435137 Original CRISPR GTGTACACACCCTTCCATAT TGG (reversed) Intergenic
No off target data available for this crispr