ID: 1092435138

View in Genome Browser
Species Human (GRCh38)
Location 12:8441469-8441491
Sequence TGTACACGCCCCTTGTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092435137_1092435138 -7 Left 1092435137 12:8441453-8441475 CCAATATGGAAGGGTGTGTACAC No data
Right 1092435138 12:8441469-8441491 TGTACACGCCCCTTGTGATATGG No data
1092435133_1092435138 20 Left 1092435133 12:8441426-8441448 CCAAAGAGGGAGAGGATGGTATT No data
Right 1092435138 12:8441469-8441491 TGTACACGCCCCTTGTGATATGG No data
1092435130_1092435138 28 Left 1092435130 12:8441418-8441440 CCGAATATCCAAAGAGGGAGAGG No data
Right 1092435138 12:8441469-8441491 TGTACACGCCCCTTGTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092435138 Original CRISPR TGTACACGCCCCTTGTGATA TGG Intergenic
No off target data available for this crispr