ID: 1092435142

View in Genome Browser
Species Human (GRCh38)
Location 12:8441484-8441506
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092435137_1092435142 8 Left 1092435137 12:8441453-8441475 CCAATATGGAAGGGTGTGTACAC No data
Right 1092435142 12:8441484-8441506 TGATATGGTTTTTAATATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092435142 Original CRISPR TGATATGGTTTTTAATATCC AGG Intergenic
No off target data available for this crispr