ID: 1092435146

View in Genome Browser
Species Human (GRCh38)
Location 12:8441491-8441513
Sequence GTTTTTAATATCCAGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092435140_1092435146 -10 Left 1092435140 12:8441478-8441500 CCCTTGTGATATGGTTTTTAATA No data
Right 1092435146 12:8441491-8441513 GTTTTTAATATCCAGGGGGCTGG No data
1092435137_1092435146 15 Left 1092435137 12:8441453-8441475 CCAATATGGAAGGGTGTGTACAC No data
Right 1092435146 12:8441491-8441513 GTTTTTAATATCCAGGGGGCTGG No data
1092435139_1092435146 -9 Left 1092435139 12:8441477-8441499 CCCCTTGTGATATGGTTTTTAAT No data
Right 1092435146 12:8441491-8441513 GTTTTTAATATCCAGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092435146 Original CRISPR GTTTTTAATATCCAGGGGGC TGG Intergenic
No off target data available for this crispr