ID: 1092436632

View in Genome Browser
Species Human (GRCh38)
Location 12:8452429-8452451
Sequence GTGCCTGCTTAGTTCAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092436632 Original CRISPR GTGCCTGCTTAGTTCAATCA TGG Intergenic
900904255 1:5540095-5540117 GTTTCTCCTTAGTTCAATCTTGG + Intergenic
906540521 1:46582265-46582287 GTACCTTCTTGGTTCCATCACGG + Intronic
908471114 1:64444867-64444889 GTGCCTTCCTAGATCACTCAGGG + Intergenic
913201291 1:116496838-116496860 GAGCCTGCTTGGTGCATTCAGGG - Intergenic
919568784 1:199220948-199220970 GTGCCTGTTTAGCTCAGTCCTGG + Intergenic
920931860 1:210396057-210396079 ATGCCTGCTTAAGTCAACCAGGG + Intronic
923280125 1:232435887-232435909 TTGCCTCCTTAGTACAATCTTGG + Intronic
1064058219 10:12115852-12115874 TTGCCTACTGAGTTCAAGCAAGG + Intronic
1066587083 10:36947382-36947404 GTGCCAGCATAGTTCAATTCTGG - Intergenic
1081072932 11:38632440-38632462 GTGCCTACTTATCTCAATAATGG - Intergenic
1092436632 12:8452429-8452451 GTGCCTGCTTAGTTCAATCATGG + Intergenic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1098006183 12:65999179-65999201 GGGCCTGCTTGGATCAATCCTGG + Intergenic
1098149580 12:67532607-67532629 TTGCTTACTTAGTTCAATGAGGG - Intergenic
1099748482 12:86738472-86738494 TTGACTGCTTTGTTCAATAATGG + Intronic
1099828316 12:87807720-87807742 GTGCCTTCCTAGGTCATTCAGGG - Intergenic
1101491027 12:105209774-105209796 ATTCCTGCTTTGTTTAATCAAGG + Intronic
1110513677 13:76383227-76383249 TTGCCTGGTTAGTTACATCAAGG - Intergenic
1112117580 13:96373720-96373742 TTCTCTGCTTATTTCAATCATGG + Intronic
1120993183 14:90396733-90396755 GCGCCTGCTTAGTCCAACCTGGG - Intronic
1129127854 15:73460438-73460460 GTACCTGCTTATTTCAATATAGG + Intronic
1133682948 16:8137703-8137725 GTGCCTGCTTTGGGCAACCAGGG - Intergenic
1135340051 16:21637618-21637640 GTGCCTGCTGGGCTTAATCAGGG - Intronic
1135626315 16:23998045-23998067 GTGCCTGCCTATGTCAATGAAGG - Intronic
1144173271 17:12680616-12680638 CTGTCTGCTTAATTCACTCATGG + Intronic
1144388072 17:14768647-14768669 CTGCCTGTTTGGTTGAATCATGG - Intergenic
1146985673 17:37214773-37214795 GTGCTTGCTTCCTTCATTCAGGG - Intronic
1151934979 17:77255974-77255996 GTGCCTGCTCAGTGCAGACAGGG + Intergenic
1151934984 17:77256005-77256027 GTGCCTGCTCAGTGCAGACAGGG + Intergenic
1151934989 17:77256036-77256058 GTGCCTGCTCAGTGCAGACAGGG + Intergenic
1151934994 17:77256067-77256089 GTGCCTGCTCAGTGCAGACAGGG + Intergenic
1156827327 18:41447104-41447126 GTTTCTACTTAATTCAATCAAGG + Intergenic
1158571375 18:58599334-58599356 GTGCCTGCTGAATTCATTCAGGG + Intronic
1163392368 19:17038429-17038451 GTGCCTGCTTGCCTCACTCAGGG - Intergenic
926728835 2:16019356-16019378 GATCCTACTTAGCTCAATCAAGG + Intergenic
927021453 2:19021265-19021287 GTGACTTCATAGTTCCATCACGG + Intergenic
927948818 2:27153807-27153829 GTTGCTGCTTGGTTCAATTAAGG - Exonic
936228096 2:110676582-110676604 TTGACTGCTTAGATCAATTAGGG + Intronic
938065786 2:128281270-128281292 GTGCCTCCTTGGTTCACCCAGGG + Intronic
942319379 2:174723355-174723377 GTGACTGCTTACTTGACTCAGGG - Intergenic
943176290 2:184478752-184478774 GTGCCTGCTTTGTGCAATGTAGG - Intergenic
945100697 2:206259951-206259973 GTGCCTGCAGACTTCAAGCACGG + Intergenic
947481743 2:230506965-230506987 GTGCCTGCTTTGTAACATCAAGG - Intronic
947922252 2:233887501-233887523 GTGCCTGCTTAGTTGTCTCTTGG + Intergenic
1170560402 20:17552309-17552331 GTGCCTGGTTTGTTCAAGGAAGG + Intronic
1184357012 22:43988885-43988907 TTGCCTCCTCAGTTAAATCAAGG + Intronic
1184624998 22:45719742-45719764 GTGCATCCTTACTTCATTCAAGG + Intronic
951096184 3:18634128-18634150 GTCCCTCATTAGATCAATCATGG + Intergenic
952272220 3:31844243-31844265 GAGCCAGCTTACTTGAATCATGG - Intronic
957548966 3:81679414-81679436 ATGCCTGCCTTGATCAATCAGGG + Intronic
960103392 3:113768486-113768508 CTGCCTGCTTAGCTCCCTCAAGG + Intronic
960915303 3:122688826-122688848 GGGCATGCTTAGTGCATTCATGG - Intronic
971063784 4:23003879-23003901 GTATCTGGTTAGTTTAATCAGGG - Intergenic
974544174 4:63278580-63278602 TTTCCTTCTTGGTTCAATCATGG - Intergenic
976118631 4:81755902-81755924 GTGCATGCTTACTTAAATAAAGG - Intronic
978340143 4:107714007-107714029 GAGCCTGCCTAGTTTGATCAAGG - Intronic
979047022 4:115880123-115880145 GTGCCTGCTTAAAAAAATCATGG + Intergenic
983702804 4:170618784-170618806 GTGTCTGCTCAGTTGAAACATGG + Intergenic
986520227 5:8607830-8607852 ATACCTTCTTAGTTCAATGAAGG - Intergenic
990772733 5:59268020-59268042 GTGGATGCTTAGTTCAAACTGGG + Intronic
991974390 5:72171848-72171870 GTGCCTGTGTTGTTCAGTCATGG - Intronic
992410858 5:76504056-76504078 GTGCCAGCTTTGATCATTCAGGG - Intronic
992945607 5:81806403-81806425 GTTTCTTCTTAGTTCAATCTTGG - Intergenic
993671975 5:90771817-90771839 GAGCCTACTTAGCTCAATCAAGG - Intronic
1001203554 5:169741321-169741343 GTGCCTGCCTAGTGCATTGAAGG + Intronic
1004021246 6:11777571-11777593 GTGACTACTTGTTTCAATCATGG - Intronic
1006580877 6:35077187-35077209 GTTTCTGCTTACTTGAATCAAGG - Intronic
1007612422 6:43159063-43159085 GTGCCTGCTTAGTCCAAAGCTGG + Intronic
1011638637 6:89399333-89399355 CTGCCTGCCAAATTCAATCATGG + Intronic
1014284941 6:119486664-119486686 GTGCCTGCTTAGCTAAGCCATGG - Intergenic
1016773935 6:147883161-147883183 GTGCCTACTACATTCAATCACGG - Intergenic
1017440962 6:154463909-154463931 GTGCCTGATTAGTTTGATGATGG - Intronic
1020878556 7:13729455-13729477 TTGCCTGCTTGTTGCAATCATGG + Intergenic
1034883946 7:154783364-154783386 GTGCCTTCTGAGTACAGTCATGG + Intronic
1041727257 8:61029857-61029879 GTTCCTGCTTGGCTCCATCAGGG + Intergenic
1043552338 8:81388464-81388486 GAGACTGCTTATTTCACTCATGG - Intergenic
1051197312 9:14576943-14576965 GTGCCTGCTCACATCATTCATGG + Intergenic
1053347758 9:37390401-37390423 GTGCCAGCTTAGACCAACCAGGG - Intergenic
1057203358 9:93155815-93155837 GTGCCTGCTCAGTGCTAACACGG + Intergenic
1187653953 X:21448096-21448118 ATGCCTCCTTAGATGAATCATGG - Intronic
1192775291 X:74238208-74238230 TTTCCTGCTTAGTTCAATCTAGG + Intergenic