ID: 1092436727

View in Genome Browser
Species Human (GRCh38)
Location 12:8453449-8453471
Sequence TCCCCAAGACTGCTTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092436727_1092436731 17 Left 1092436727 12:8453449-8453471 CCATCCTGAAGCAGTCTTGGGGA 0: 1
1: 0
2: 0
3: 26
4: 255
Right 1092436731 12:8453489-8453511 ACGAGCATAGACACCAGGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 107
1092436727_1092436729 12 Left 1092436727 12:8453449-8453471 CCATCCTGAAGCAGTCTTGGGGA 0: 1
1: 0
2: 0
3: 26
4: 255
Right 1092436729 12:8453484-8453506 ACCTCACGAGCATAGACACCAGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092436727 Original CRISPR TCCCCAAGACTGCTTCAGGA TGG (reversed) Intergenic
900162166 1:1228906-1228928 TCCCCAGGACGGCCGCAGGATGG + Exonic
900839341 1:5035118-5035140 GCCCCTAGATAGCTTCAGGATGG - Intergenic
903801688 1:25973557-25973579 TCCCCAGGTCAGATTCAGGAGGG - Intronic
905382414 1:37572371-37572393 ACCCCTAGATAGCTTCAGGATGG + Intronic
906101412 1:43266083-43266105 GCACCATGACTGTTTCAGGATGG - Intronic
907295380 1:53448660-53448682 TCCCCTAGATACCTTCAGGATGG - Intergenic
907593866 1:55701989-55702011 TCCCCAAGTCTTCCTCAGGATGG - Intergenic
909049850 1:70754020-70754042 TCCACAAGACTGGTCCAGGAAGG - Intergenic
911749702 1:101482129-101482151 GCTCCAAGATAGCTTCAGGATGG - Intergenic
913219350 1:116646874-116646896 TCCCCAGGACACCTTCAGGGAGG + Intronic
915088379 1:153404389-153404411 ACCCCTAGATAGCTTCAGGATGG - Intergenic
917604388 1:176611680-176611702 TCCCCAAGAATGCTACAGATAGG - Intronic
917865533 1:179190692-179190714 ACCCCTAGATAGCTTCAGGATGG - Intronic
918751907 1:188282823-188282845 GCCCCAAGGTAGCTTCAGGATGG - Intergenic
918853030 1:189717313-189717335 TCTCCATGATTGCTTCAAGAAGG - Intergenic
921362829 1:214345771-214345793 TACCCTAGATAGCTTCAGGATGG - Intergenic
921954741 1:220970438-220970460 TTCCAAGAACTGCTTCAGGAAGG - Intergenic
922445416 1:225692851-225692873 TCCACACCAGTGCTTCAGGAAGG - Intergenic
922607184 1:226896985-226897007 TCCCCCAGGCTGTTTGAGGAAGG + Intergenic
923411135 1:233710545-233710567 CCCCCTACATTGCTTCAGGATGG + Intergenic
923757056 1:236801397-236801419 TCTCCAAGTGGGCTTCAGGAAGG - Intronic
924454928 1:244211550-244211572 TTCCCAAGACTGGCTAAGGAAGG - Intergenic
924500016 1:244628736-244628758 TCCTCAAGACTACATCTGGATGG + Intronic
1063331270 10:5161809-5161831 TGCCCAAGACTGTTTCATCATGG - Intergenic
1063976778 10:11423741-11423763 ACCCCAAAACTGCTTATGGAGGG - Intergenic
1065801514 10:29356973-29356995 ATCCAAAGACTGCTTCAGGCAGG - Intergenic
1065961799 10:30739778-30739800 GCCCCTAGATTGTTTCAGGATGG + Intergenic
1067139030 10:43640406-43640428 GCCCCAAGGTAGCTTCAGGATGG + Intergenic
1067282624 10:44883817-44883839 GCCCCGAGACAGCCTCAGGATGG - Intergenic
1069466770 10:68646987-68647009 TCACCAAGACAGCTGCAGGTGGG - Exonic
1069738635 10:70673578-70673600 CCCCTAAGACTGCTGCAAGAGGG - Intronic
1071995143 10:91140566-91140588 ATCCCTAGACAGCTTCAGGATGG + Intergenic
1072076199 10:91976492-91976514 GCCCCAAGATAGCTTCAGAAGGG - Intronic
1072281000 10:93865378-93865400 TCACCAGGACTGCTACAGGCAGG - Intergenic
1072729560 10:97836447-97836469 CCCCCAAAACTGCTTCCAGATGG + Intergenic
1072971477 10:100021156-100021178 GCCCCTAGATAGCTTCAGGATGG - Intergenic
1074489270 10:113924425-113924447 GCCCCGAGACAGCTTCAGGATGG + Intergenic
1074906326 10:117867036-117867058 GCCCCAAGACTTATTCAGGTGGG + Intergenic
1075875719 10:125804133-125804155 GCCCCTAGAAAGCTTCAGGATGG + Intronic
1077081201 11:725525-725547 TCCCCCAGACTCCTTGAGGCAGG + Intronic
1077104578 11:836625-836647 TCCGCAAGAAAGCTTCAGGGAGG + Intronic
1078583477 11:12558654-12558676 ACCCCAAGCCTGGTTCCGGAGGG + Intergenic
1079873097 11:25824343-25824365 TCCCAAAGACTACATCAGTATGG - Intergenic
1079993839 11:27274597-27274619 TCCCCAAGACAGCATCATAACGG + Intergenic
1080301351 11:30788584-30788606 TCCCCTAGATAGCTTCAGGATGG - Intergenic
1080350784 11:31383314-31383336 GCCCCTAGGCAGCTTCAGGATGG - Intronic
1080750453 11:35145724-35145746 CCCCCATGTCTGCTTCTGGAAGG + Intronic
1080777766 11:35402189-35402211 GCCCCTAGATAGCTTCAGGATGG + Intronic
1081529510 11:43948246-43948268 ACCCCAAATGTGCTTCAGGAGGG - Intergenic
1082737970 11:56877326-56877348 TCCCCAGGACAGCTTGTGGAAGG + Intergenic
1090843788 11:130514646-130514668 TCCCCAACTCTGCTCCAGGGGGG + Intergenic
1090947643 11:131446119-131446141 TCCCCAAGCCTACTGGAGGAAGG + Intronic
1090949246 11:131458326-131458348 TCTCCATCACTGCATCAGGAAGG - Intronic
1091777260 12:3192594-3192616 TCTCCCAGACAGCTCCAGGAGGG - Intronic
1092143533 12:6200116-6200138 ACCCCAAGACGGCTTGAAGAAGG + Intronic
1092436727 12:8453449-8453471 TCCCCAAGACTGCTTCAGGATGG - Intergenic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1093639681 12:21511569-21511591 GCCCCTAGGCAGCTTCAGGATGG - Intronic
1097195675 12:57241363-57241385 TCCCCAACACTGCTGCTGGTGGG + Intergenic
1097264656 12:57738285-57738307 TCCCCCGGACTGCCTCAGGGGGG + Intronic
1097416645 12:59323769-59323791 TCCTCAGGCCTGCTTCAAGAGGG + Intergenic
1101444303 12:104726610-104726632 TCAACAACCCTGCTTCAGGATGG + Intronic
1101535789 12:105614933-105614955 TCCCCAAAACTGTATCAGTAAGG - Intergenic
1102508335 12:113397902-113397924 TCCCCAAGTCTGCTTCCAGGAGG + Intronic
1103986189 12:124768976-124768998 GCCCCTAGGCAGCTTCAGGATGG + Intergenic
1104682704 12:130762335-130762357 TCCCCAGGAAAGCTCCAGGAGGG - Intergenic
1105689808 13:22825482-22825504 TCACCAAAACTGATTCAAGAAGG + Intergenic
1107398791 13:40048217-40048239 TCCCCTAGGTAGCTTCAGGATGG - Intergenic
1108602723 13:52008500-52008522 GCCCCTAGATAGCTTCAGGATGG - Intronic
1109214986 13:59579444-59579466 GCCCCTAGATAGCTTCAGGATGG - Intergenic
1110937116 13:81305104-81305126 GCCCCTAGATAGCTTCAGGATGG + Intergenic
1113175935 13:107564137-107564159 TACCCCAGACTCCATCAGGATGG - Intronic
1113895879 13:113764313-113764335 TCCCCAAGGCAGCTTCTGCAGGG - Intronic
1114596605 14:23917597-23917619 CCCCCTAGATAGCTTCAGGATGG + Intergenic
1114772535 14:25444740-25444762 ACCCCTAGATAGCTTCAGGATGG + Intergenic
1115445696 14:33486738-33486760 TCCCCAGGCCTGCCTGAGGAGGG - Intronic
1118755984 14:68843908-68843930 TCCCCAAGACTGCTCTTGGGAGG + Intergenic
1119029827 14:71183292-71183314 TCCCACAGAATGCTTCAGGGTGG + Intergenic
1119556881 14:75560136-75560158 TACCCATTACTGCTTCTGGAAGG + Intergenic
1121459556 14:94064418-94064440 GTCCCTAGACAGCTTCAGGATGG + Intronic
1122343685 14:101045111-101045133 ACCCGAAGCCAGCTTCAGGAAGG + Intergenic
1122887959 14:104718934-104718956 ACCCCAAGAAGGCTCCAGGAGGG - Exonic
1124360988 15:29036329-29036351 TCCCCAGGTCTCCTTCAGGGAGG + Intronic
1128073392 15:64811183-64811205 GCCCCTAGGCAGCTTCAGGATGG + Intergenic
1128482184 15:68048548-68048570 GCCCCTAGATGGCTTCAGGATGG - Intergenic
1129637905 15:77341688-77341710 ACCCCTAGATTGCTTCAAGATGG - Intronic
1130043840 15:80429214-80429236 GCCCCTAGACAGCTTCAAGAAGG + Intronic
1130394291 15:83488661-83488683 TACACAAATCTGCTTCAGGAGGG + Intronic
1132423918 15:101698005-101698027 TCCCCCAGCCTTCTACAGGAAGG + Intronic
1133940846 16:10307808-10307830 TCCCCTATATAGCTTCAGGATGG - Intergenic
1134446479 16:14335143-14335165 CCCCCAACACTGCTGCAGAAAGG + Intergenic
1135564573 16:23501911-23501933 TCCCCAAGAGTTGTTCAAGAAGG - Intronic
1136229217 16:28877111-28877133 TCCCCACCCCTGCTCCAGGATGG - Intergenic
1139637616 16:68267733-68267755 GCCCCTAGAAAGCTTCAGGATGG + Intronic
1140768686 16:78183488-78183510 TCCACAACACTGCTACAGAACGG - Intronic
1142488246 17:260555-260577 TCTCCAAGACTGATTCAGTCTGG - Intronic
1143332129 17:6145336-6145358 TCCCCAAGCAGGCATCAGGATGG + Intergenic
1143876854 17:9998142-9998164 TCCCCTAGGCAGCTTCAGGATGG - Intronic
1145250728 17:21295643-21295665 ACACCAAGCCTGCATCAGGAGGG - Intronic
1145323473 17:21780722-21780744 GCCCCTAGACAGCCTCAGGATGG + Intergenic
1145392336 17:22465385-22465407 GACCCTAGACAGCTTCAGGATGG + Intergenic
1146602318 17:34228525-34228547 TTGCAAAGGCTGCTTCAGGAGGG - Intergenic
1148378092 17:47168299-47168321 TCCCCTAGGTAGCTTCAGGATGG - Intronic
1149336689 17:55643137-55643159 TCCCAAAGACAGGTCCAGGAGGG + Intergenic
1151256298 17:72879306-72879328 GCCCCTAGATAGCTTCAGGATGG - Intronic
1152920887 17:83066077-83066099 GCCCCTAGACAGCTTCAGGATGG - Intergenic
1153887769 18:9482398-9482420 GCCCCTAGACAACTTCAGGATGG + Intronic
1155626834 18:27844666-27844688 ACCCCAAGACTTCTTGAAGAAGG - Intergenic
1155760288 18:29556659-29556681 TCTCCTAGATAGCTTCAGGATGG - Intergenic
1155915571 18:31553906-31553928 GCACCAAGTCTGCTACAGGATGG - Intergenic
1155957559 18:31966579-31966601 GCCCCTAGGCAGCTTCAGGATGG - Intergenic
1156669456 18:39451086-39451108 GCCCCTAGATAGCTTCAGGATGG + Intergenic
1157471543 18:47992701-47992723 GCCCCTAGATAGCTTCAGGATGG + Intergenic
1158398319 18:57097231-57097253 TCCCCAAGATAGCTCCATGAGGG - Intergenic
1160795996 19:945687-945709 GCCCAAAGACGGCTGCAGGAAGG - Intronic
1160865598 19:1254530-1254552 TCCCCAAGACCTCCCCAGGACGG - Intronic
1161480661 19:4508767-4508789 GCTCCAGGACTGCTTCAGGCTGG - Exonic
1161774716 19:6254047-6254069 GCCCCTAGATAGCTTCAGGATGG + Intronic
1163105950 19:15123138-15123160 TCCCCAATCCTGCTTCTGGGTGG - Exonic
1163717127 19:18879159-18879181 TCCCCGGGACTGCCTGAGGAGGG + Intronic
1165110074 19:33497267-33497289 TCACCAAGTCTGCTACAGGCAGG - Intronic
1166420714 19:42633915-42633937 TCCCCAAGGCTGATGCAGCAGGG + Intronic
1167148645 19:47696581-47696603 TGCCCAACTCTGCTTCTGGAGGG - Intronic
1167830340 19:52014795-52014817 TCCCCTAGACAGCCTCAGAATGG - Exonic
1168313220 19:55472156-55472178 TCCCCCAGGCTGCGTGAGGAAGG + Intergenic
1168313238 19:55472240-55472262 TCCCCCAGGCTGCGTCAGGAAGG + Intergenic
1168313256 19:55472324-55472346 TCCCCCAGGCTGCGTCAGGAAGG + Intergenic
1168313274 19:55472408-55472430 TCCCCCAGGCTGCGTGAGGAAGG + Intergenic
929401334 2:41585378-41585400 CTCCCAAGACTGAATCAGGAAGG + Intergenic
929945623 2:46369596-46369618 TCCCAAACATGGCTTCAGGAAGG + Intronic
930209204 2:48617284-48617306 TCCTCCAGTCTGATTCAGGAGGG + Intronic
935704215 2:105841690-105841712 GCCCCTAGGCAGCTTCAGGATGG - Intronic
936122082 2:109755659-109755681 GCCCCTAGATAGCTTCAGGATGG - Intergenic
936222612 2:110615815-110615837 GCCCCTAGATAGCTTCAGGATGG + Intergenic
936229496 2:110687701-110687723 GCCCCTAGACAGCTTCAGGATGG - Intergenic
937444285 2:121943609-121943631 GCCCCTAGAAAGCTTCAGGATGG - Intergenic
939126872 2:138188210-138188232 GCCCCAAGATAGCTTCAGGATGG + Intergenic
943863702 2:192899764-192899786 ACCCCTAGATAGCTTCAGGATGG - Intergenic
944107695 2:196097174-196097196 GCCCCTAGATAGCTTCAGGATGG + Intergenic
945023978 2:205602579-205602601 CTCCCAAGACTGAATCAGGAAGG - Intronic
946302296 2:218831350-218831372 CCCCCAAGGCTGCTCCAGGAAGG + Exonic
947299183 2:228669091-228669113 TCCCAAAGAGTTCTTCAGGAAGG + Intergenic
947636628 2:231683634-231683656 CTCCCAAGACTGCAGCAGGAAGG + Intergenic
948516231 2:238505440-238505462 GCCCCAAGGCAGCTGCAGGAAGG + Intergenic
948816292 2:240511932-240511954 TCCCCAAGCCTACTACAGCACGG - Exonic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169881454 20:10351414-10351436 GCCCCTAGAGAGCTTCAGGATGG - Intergenic
1170226828 20:13999851-13999873 TACCACAGACTGCTACAGGAAGG - Intronic
1170294993 20:14813917-14813939 ACCCCTAGACAGCTTCAGAATGG - Intronic
1172727776 20:37059631-37059653 TCCCCAACACTGCTTAGGGATGG + Intronic
1172802465 20:37585909-37585931 GGCCCTAGACAGCTTCAGGATGG + Intergenic
1175479749 20:59302415-59302437 ACCCCAAGACAAATTCAGGATGG - Intronic
1175727851 20:61331782-61331804 TGCTCAAGACTGCTGCAGGCAGG - Intronic
1178750371 21:35297049-35297071 TACCCAAGACTGGTTAATGAAGG - Intronic
1179716205 21:43290092-43290114 GCCCCAAAACAGCGTCAGGAAGG - Intergenic
1180745716 22:18087648-18087670 TTTCCAAGGCTGCTTCAGAAGGG + Intronic
1180820642 22:18824930-18824952 TCCCCAGGACACCTTCAGGGAGG + Intergenic
1181206865 22:21259402-21259424 TCCCCAGGACACCTTCAGGGAGG + Intergenic
1181782769 22:25205090-25205112 CCCCCAAACCTGCTGCAGGAGGG - Intronic
1181960236 22:26617426-26617448 TCCCCCAGCCTCCTCCAGGAAGG + Intronic
1183334179 22:37237255-37237277 TCCCTAAGACTTCTCCAAGAGGG - Intronic
1185235285 22:49708897-49708919 TCCCCTAGGTGGCTTCAGGATGG - Intergenic
1203220058 22_KI270731v1_random:36021-36043 TCCCCAGGACACCTTCAGGGAGG - Intergenic
1203270768 22_KI270734v1_random:50805-50827 TCCCCAGGACACCTTCAGGGAGG + Intergenic
949228028 3:1716545-1716567 TCCCCTAGATAGCTTCAGGATGG - Intergenic
949455209 3:4230760-4230782 GCCCCCAGACAGCTTCAGAATGG - Intronic
950555630 3:13694221-13694243 CTCCCAAGACTGCTCCAGGAGGG - Intergenic
953538226 3:43791995-43792017 TCCCCAAGATTCCTTCTTGAGGG + Intergenic
954465183 3:50650210-50650232 GCCCCAAGTCTGCCTCAGGAAGG + Intergenic
954633925 3:52061334-52061356 TCCCCAAGGCTGCTTGGAGAAGG + Intergenic
955037562 3:55283648-55283670 TCCCCAAGATAGCTCCAGGATGG - Intergenic
956168311 3:66413071-66413093 TAGCCAGGACTGCTTCAGAATGG - Intronic
956890844 3:73612869-73612891 ACCCAAAGACTGCCTCAGTATGG + Intronic
958473315 3:94549235-94549257 TCTTCAAGGCTGCCTCAGGAAGG + Intergenic
960009887 3:112822295-112822317 GCCTGAAGACAGCTTCAGGATGG + Intronic
960179200 3:114554786-114554808 TCCCCCAAACTGCTTCAAGTAGG + Intronic
961100113 3:124191387-124191409 GCCCCTAGGCAGCTTCAGGATGG - Intronic
962266395 3:133947413-133947435 TCCCCAAGGCTGCAGCAGGGAGG + Exonic
963047802 3:141116176-141116198 AGCCCCAGGCTGCTTCAGGAAGG + Intronic
963152404 3:142058951-142058973 TCCCCTAGATAGCTTTAGGATGG - Intronic
963243920 3:143042113-143042135 TCCACTAGACTGCTTCTGGAAGG + Intronic
963466580 3:145689501-145689523 GCCCCTAGATAGCTTCAGGATGG + Intergenic
963639026 3:147836397-147836419 TCCCCAAGGCTGGTCCAAGAAGG - Intergenic
964704503 3:159603483-159603505 GCCCCTAGATAGCTTCAGGATGG - Intronic
964859497 3:161185612-161185634 ACCCCTAGATAGCTTCAGGATGG - Intronic
966184464 3:177215452-177215474 TCCCCAAGATGCCTTCAGGCCGG - Intergenic
966734826 3:183180145-183180167 TCCCTAAGGCTGCTCCAGCAGGG - Exonic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
968601736 4:1512959-1512981 GCCCCAGGACAGCTCCAGGACGG + Intergenic
968744104 4:2350596-2350618 GGCCCTAGACAGCTTCAGGATGG + Intronic
968940769 4:3636408-3636430 TCTCCTAGACAGCTTCAGGATGG - Intergenic
970583468 4:17493853-17493875 GCCCCTAGACAGCCTCAGGATGG - Intronic
971094735 4:23387911-23387933 TCCCCAAGACTGGTCCAGGGTGG - Intergenic
971327547 4:25656504-25656526 TCCCCAAGACGGCTGAAGGACGG - Intronic
972995110 4:44870019-44870041 TCCACAAGACTGGTCCAAGAAGG - Intergenic
976408574 4:84686891-84686913 TCCCCTCGTCTGCTTCAGGTAGG + Intronic
977586975 4:98784878-98784900 ACCTCAGGACTACTTCAGGAGGG - Intergenic
978118933 4:105054857-105054879 TGCCCAAACCTGCTTCCGGAAGG - Intergenic
978807456 4:112815567-112815589 TGCCCTAGATAGCTTCAGGATGG + Intergenic
979937986 4:126721734-126721756 TCCCCAAGAATTCTTAAGGTTGG + Intergenic
982218179 4:153100600-153100622 TTCCCAAGACTGAACCAGGAAGG + Intergenic
985278298 4:188260471-188260493 TCTCCTACACTGCTGCAGGAGGG - Intergenic
985757205 5:1726029-1726051 TCCCCAAGAGTGCCTCCTGACGG - Intergenic
986038273 5:3961518-3961540 TCCCTCAGAATGCTTTAGGAGGG - Intergenic
987137908 5:14916992-14917014 TCCCCTAGACAGTCTCAGGATGG - Intergenic
988597502 5:32608296-32608318 GCCCCTAGACAGCTTCAGGATGG - Intergenic
989192283 5:38682935-38682957 TCCCCAGGAATGCTGGAGGAGGG - Intergenic
992841100 5:80695954-80695976 TCCCTGACACTGCTTCAGCAGGG + Intronic
993982628 5:94561003-94561025 GCCCCTAGAGAGCTTCAGGATGG + Intronic
994820173 5:104639411-104639433 TCTCCAATACTTCTTCATGAAGG - Intergenic
995753226 5:115475117-115475139 GCCCCTAGATAGCTTCAGGATGG - Intergenic
996125558 5:119722086-119722108 TACCAAAGATTGCCTCAGGAAGG - Intergenic
997052616 5:130400219-130400241 TCCCTCAGACTGCTTAGGGAAGG - Intergenic
997837929 5:137211607-137211629 GCCCCAAGATAGCTTCAAGATGG + Intronic
998135733 5:139673513-139673535 TCCCCAAAACAGCTGGAGGAGGG - Intronic
1000489201 5:161888151-161888173 TCCCCTAGACTGTTGAAGGAGGG + Intronic
1000961928 5:167610457-167610479 GCCCCTAGATTGTTTCAGGATGG - Intronic
1001415851 5:171544520-171544542 TCCCCAAGACTGCTCCAACTGGG + Intergenic
1004070380 6:12292043-12292065 TCCCTGAGCCTGCTTCAAGAGGG + Intronic
1004787920 6:18989565-18989587 TCTGCAACAGTGCTTCAGGAGGG + Intergenic
1005384723 6:25274679-25274701 TCCTCTAGACTGCTCCATGAGGG + Intergenic
1006463336 6:34176745-34176767 TCCCCAAAACTGCATCAGCCGGG - Intergenic
1007194405 6:40048100-40048122 TCCCCTAGATAGCTTCAGGATGG - Intergenic
1008141149 6:47833811-47833833 TCTCCAAGACTGCTACAAAAGGG + Intergenic
1010175280 6:73020682-73020704 ACCCCTAGGCAGCTTCAGGATGG - Intronic
1010906625 6:81499345-81499367 TTCCCAAGATTGAATCAGGAAGG - Intronic
1011827294 6:91323463-91323485 GCCCCTAGATAGCTTCAGGATGG - Intergenic
1015976743 6:138798337-138798359 ACCCCTAGATAGCTTCAGGATGG - Intronic
1018000911 6:159577735-159577757 GCCCCTAGACAGTTTCAGGATGG - Intergenic
1019708739 7:2508788-2508810 TCCCCAAGACTGGCTCCTGATGG - Intergenic
1019822694 7:3257218-3257240 GCCCCTAGATAGCTTCAGGATGG - Intergenic
1019870686 7:3757895-3757917 GCCCCTAGATAGCTTCAGGATGG - Intronic
1021918965 7:25464548-25464570 ACCCCTAGATAGCTTCAGGATGG - Intergenic
1022100937 7:27168780-27168802 TCCCCAAGGATGCTTTGGGAAGG + Intronic
1022475195 7:30705454-30705476 TCCCAAATCCTGGTTCAGGAAGG + Intronic
1022485669 7:30775679-30775701 ACCCCTAGATAGCTTCAGGATGG - Intronic
1023739536 7:43266206-43266228 GTCCCTAGACAGCTTCAGGATGG - Intronic
1028797867 7:94925434-94925456 TCCCCGAAACAGCTTCAGAAGGG - Intronic
1029666890 7:102001211-102001233 TCCCCAAGAATGCTCCTGGCAGG - Intronic
1029914105 7:104189089-104189111 GCCCCTAGATAGCTTCAGGATGG + Intronic
1032267583 7:130380018-130380040 TCCCCAAGGCAGCTTCAGGCAGG - Intergenic
1032544414 7:132729769-132729791 GCCCCTAGATAGCTTCAGGATGG + Intergenic
1033420889 7:141203758-141203780 TCCCCATGACAACCTCAGGAAGG - Intronic
1034484065 7:151346436-151346458 GCCCCTAGATAGCTTCAGGATGG + Intronic
1035079812 7:156206519-156206541 TCCCCTACACTGTTTGAGGAAGG + Intergenic
1035926031 8:3728627-3728649 CCCACACGACTGCTCCAGGATGG - Intronic
1036479323 8:9124276-9124298 TCTCTAAGTCTACTTCAGGATGG + Intergenic
1037512101 8:19593923-19593945 CCCTCTAGGCTGCTTCAGGATGG + Intronic
1037616879 8:20527338-20527360 TCCGCAAGACCTGTTCAGGAGGG - Intergenic
1038333801 8:26630408-26630430 ATCCCAAGACTGTTTCAGGGCGG - Intronic
1040301661 8:46191187-46191209 TCCCCAGGACTGTCCCAGGAAGG + Intergenic
1040302312 8:46194454-46194476 TCCCCAGGACTGTTTCTGGTGGG + Intergenic
1040308363 8:46223858-46223880 CCCCCAGGACTGTTCCAGGAGGG + Intergenic
1040744778 8:50628041-50628063 GCCCCTAGGCAGCTTCAGGATGG - Intronic
1040781708 8:51117323-51117345 TCTCCTAGATAGCTTCAGGATGG + Intergenic
1041453626 8:58034043-58034065 TACCCAGGCCTGTTTCAGGAGGG - Intronic
1041791271 8:61698683-61698705 GCCCCTAGATAGCTTCAGGATGG - Intronic
1042193202 8:66208866-66208888 TCTCAAAGACTCCTACAGGAAGG + Intergenic
1042335210 8:67622738-67622760 TCCCTAACACTCCTTCAGGTAGG + Intronic
1043210738 8:77513094-77513116 TCTCCAAGAGTGTTTAAGGAGGG + Intergenic
1046883139 8:119332170-119332192 ACCCCTAGATAGCTTCAGGATGG - Intergenic
1047394335 8:124480788-124480810 GCCCCTAGATAGCTTCAGGATGG - Intronic
1049850710 8:144828721-144828743 TCCGCCAGACTGCTTCGTGAAGG + Intronic
1050259661 9:3828183-3828205 TCTCACAGACTGCTTGAGGAAGG - Exonic
1052417462 9:28195263-28195285 TCCCCATGACTATTTCAGGTAGG - Intronic
1053303898 9:36970450-36970472 TCCTCAAGACTCCTGCAGCAAGG - Intronic
1053490564 9:38498087-38498109 ACCCCAAGACAGCCTCAGCATGG + Intergenic
1056481091 9:87007122-87007144 TTCCCAAGGCTGCTTGAGGATGG + Intergenic
1058833155 9:108837438-108837460 TCCCCTAGGTAGCTTCAGGATGG + Intergenic
1062317637 9:135976342-135976364 GCCCCTAGACAGCTTCAGGGTGG + Intergenic
1062522689 9:136964848-136964870 CCCCCAAGGCGGCTACAGGAAGG + Intergenic
1186808322 X:13162079-13162101 GCCCCTAGGCAGCTTCAGGATGG - Intergenic
1187216870 X:17285735-17285757 TCTTCAAGACTCCTTCCGGATGG + Intergenic
1187843671 X:23514541-23514563 TCACAGAGACTGCATCAGGAGGG - Intergenic
1191228981 X:58079194-58079216 TCCCCTAGAATGCTTTAGGTTGG - Intergenic
1191902326 X:66053822-66053844 CTCCCAAGACTGCATCTGGAAGG + Intergenic
1193753958 X:85383219-85383241 TCCCCTAGGTAGCTTCAGGAGGG - Intergenic
1195218507 X:102723705-102723727 GCCCCTAGATAGCTTCAGGATGG + Intronic
1195309327 X:103615535-103615557 ACCCCTAGATAGCTTCAGGATGG + Intronic
1195321930 X:103727721-103727743 GCCCCAAGACCACATCAGGATGG - Intronic
1197211871 X:123834797-123834819 TCAACAATCCTGCTTCAGGATGG - Intergenic
1200258211 X:154597109-154597131 TCCCCCAGTCTCCTTGAGGAAGG - Intergenic