ID: 1092442036

View in Genome Browser
Species Human (GRCh38)
Location 12:8512913-8512935
Sequence GCTTCCACCAATGAATTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1716
Summary {0: 1, 1: 1, 2: 24, 3: 304, 4: 1386}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092442028_1092442036 20 Left 1092442028 12:8512870-8512892 CCCAAACTTTTGACCTCCAAATG 0: 1
1: 0
2: 3
3: 17
4: 198
Right 1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG 0: 1
1: 1
2: 24
3: 304
4: 1386
1092442029_1092442036 19 Left 1092442029 12:8512871-8512893 CCAAACTTTTGACCTCCAAATGC 0: 1
1: 0
2: 1
3: 10
4: 193
Right 1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG 0: 1
1: 1
2: 24
3: 304
4: 1386
1092442027_1092442036 23 Left 1092442027 12:8512867-8512889 CCTCCCAAACTTTTGACCTCCAA 0: 1
1: 0
2: 1
3: 22
4: 235
Right 1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG 0: 1
1: 1
2: 24
3: 304
4: 1386
1092442035_1092442036 -3 Left 1092442035 12:8512893-8512915 CCATTACGTTGGAGGGTAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG 0: 1
1: 1
2: 24
3: 304
4: 1386
1092442033_1092442036 4 Left 1092442033 12:8512886-8512908 CCAAATGCCATTACGTTGGAGGG 0: 1
1: 0
2: 3
3: 34
4: 272
Right 1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG 0: 1
1: 1
2: 24
3: 304
4: 1386
1092442031_1092442036 7 Left 1092442031 12:8512883-8512905 CCTCCAAATGCCATTACGTTGGA 0: 1
1: 1
2: 11
3: 106
4: 536
Right 1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG 0: 1
1: 1
2: 24
3: 304
4: 1386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092442036 Original CRISPR GCTTCCACCAATGAATTTTG AGG Intronic
900698038 1:4024448-4024470 GCTCCCAAATATGAATTTTGGGG - Intergenic
900731582 1:4265275-4265297 GCTTCAACATATAAATTTTGGGG + Intergenic
900839593 1:5037507-5037529 GCTTTAACATATGAATTTTGGGG - Intergenic
900849544 1:5131287-5131309 GTTTCAACATATGAATTTTGTGG - Intergenic
900903821 1:5536483-5536505 GCTTCAACATGTGAATTTTGGGG - Intergenic
901145881 1:7064410-7064432 GCTTCAACCTATTAATTTTGGGG + Intronic
901233773 1:7656519-7656541 GCTTCAACCTATGGATTTGGTGG + Intronic
901856652 1:12048765-12048787 GCTTCAACCTATGAATTTGGGGG - Intergenic
901946837 1:12711115-12711137 CCTTCCACTCATGACTTTTGAGG - Intergenic
902257591 1:15200043-15200065 GCTTCAACAAAGGAATTTGGCGG - Intronic
902758407 1:18564793-18564815 GGTTCAACCAATGGCTTTTGGGG + Intergenic
903001487 1:20269310-20269332 TCTTCAACATATGAATTTTGGGG - Intergenic
903005741 1:20297428-20297450 GCTTCAGCCAATGAAATGTGTGG - Intronic
903544624 1:24116166-24116188 GTTTCAACATATGAATTTTGGGG + Intergenic
903553275 1:24173978-24174000 TCTTCAACATATGAATTTTGGGG - Intronic
903817806 1:26077779-26077801 GCTTCCACATGTGAATTTTGGGG - Intergenic
904434667 1:30486597-30486619 GCTTCAACATATGAATTTGGGGG - Intergenic
904971280 1:34421248-34421270 GCTTCAACATAGGAATTTTGGGG - Intergenic
905235980 1:36548581-36548603 GTTTCAACATATGAATTTTGGGG - Intergenic
905372220 1:37488974-37488996 ATTTCAACCTATGAATTTTGGGG - Intergenic
905514616 1:38553098-38553120 GTTTCAACATATGAATTTTGGGG + Intergenic
905532759 1:38695089-38695111 GTTTCCACATATGAATTTTGGGG + Intergenic
905697468 1:39985862-39985884 GCTTCAACATATGAATTTGGGGG + Intergenic
905858844 1:41332734-41332756 GCTTCAACAAATGATTTTTGGGG + Intergenic
905954170 1:41978297-41978319 GCTTCAACATATGAATTTGGGGG - Intronic
905957638 1:42012303-42012325 GCTTCAACATATGAATTTGGGGG - Intronic
906625690 1:47323518-47323540 ACTTCAACATATGAATTTTGTGG - Intergenic
906697825 1:47836650-47836672 GGTTTCAACAATGAACTTTGAGG - Intronic
906891799 1:49724616-49724638 GTTTCAACATATGAATTTTGAGG - Intronic
907319453 1:53593620-53593642 GCTTCCACCAAGGAACAGTGGGG - Intronic
907599566 1:55753717-55753739 GCTTAAACAAATGAATTTGGGGG - Intergenic
907617059 1:55936284-55936306 GTTTCAACATATGAATTTTGAGG + Intergenic
907640440 1:56183853-56183875 GCTTCAACATATGAATTTTGGGG - Intergenic
907935713 1:59040451-59040473 GTTTCAACCTATGAATTTTTGGG + Intergenic
908222487 1:62021371-62021393 GTTTCAACAAATGAATTTTGAGG + Intronic
908267334 1:62392436-62392458 GTTTCAACGTATGAATTTTGGGG - Intergenic
908271685 1:62428765-62428787 GCTTCAACATATGAATTTTGGGG - Intergenic
908289321 1:62646399-62646421 GCTTTAACATATGAATTTTGGGG - Intronic
908360295 1:63362667-63362689 ACTTCAACATATGAATTTTGAGG + Intergenic
908536932 1:65086959-65086981 ACTTCAACATATGAATTTTGGGG - Intergenic
908719422 1:67108442-67108464 GTTTCAACATATGAATTTTGAGG + Intronic
908735654 1:67273595-67273617 GCTTCAACATATGGATTTTGGGG + Intergenic
908919890 1:69176659-69176681 GCTTCAACTTATGAATTTTCGGG - Intergenic
908973639 1:69869073-69869095 ATTTCAACCTATGAATTTTGAGG + Intronic
909025649 1:70478715-70478737 GCTTCAACATATGGATTTTGGGG + Intergenic
909079807 1:71096507-71096529 GTTTCAACATATGAATTTTGGGG - Intergenic
909131536 1:71742887-71742909 GCTTCAACATCTGAATTTTGGGG - Intronic
909167663 1:72249032-72249054 GTTTCAACATATGAATTTTGGGG - Intronic
909251134 1:73357780-73357802 GTTTCAACATATGAATTTTGAGG + Intergenic
909294050 1:73923218-73923240 CCTTCAACATATGAATTTTGTGG - Intergenic
909351142 1:74654711-74654733 GTTTCAACATATGAATTTTGGGG + Intronic
909399710 1:75213373-75213395 GCTTCGGCAAATGAATTTAGGGG - Intronic
909489685 1:76211998-76212020 GCTGCAACATATGAATTTTGGGG + Intronic
909837329 1:80273519-80273541 GCTTCAACATATGAATTTTAGGG - Intergenic
909870058 1:80728092-80728114 GCTTCAAAATATGAATTTTGGGG + Intergenic
909933652 1:81527298-81527320 GTTTCAACATATGAATTTTGGGG - Intronic
910112884 1:83701169-83701191 GCTTCAACATATGAATTTTGAGG - Intergenic
910138976 1:84005448-84005470 GTTTCAACATATGAATTTTGTGG - Intergenic
910656114 1:89620288-89620310 GTTTCAACATATGAATTTTGAGG + Intergenic
910674921 1:89807162-89807184 GCTTCAACATACGAATTTTGGGG - Intronic
910783575 1:90969109-90969131 GCTTCAACATATGAATTTTGGGG - Intronic
911168069 1:94742882-94742904 GCTTCAACATATGAATTTGGAGG + Intergenic
911174339 1:94804079-94804101 GCTTCAACATATGAATTTGGGGG + Intergenic
911438486 1:97894354-97894376 TCTTCAACATATGAATTTTGAGG + Intronic
911461947 1:98202527-98202549 GCTTCAACATATGAATTTAGAGG - Intergenic
911923704 1:103799356-103799378 GATTCAACATATGAATTTTGAGG - Intergenic
912164802 1:107030411-107030433 GCTTCAACATATGAATTTGGGGG + Intergenic
912255988 1:108058687-108058709 ACTTCAACACATGAATTTTGTGG - Intergenic
912264987 1:108148444-108148466 GCTTCAACATATGAATTTGGTGG - Intronic
912309823 1:108609061-108609083 GTTTCAACATATGAATTTTGGGG + Intronic
912579933 1:110711406-110711428 GCTTCAACTTATGAATTTTGGGG + Intergenic
912600731 1:110930670-110930692 GCTTCAATCTATGAATTTTAGGG + Intergenic
912664555 1:111567521-111567543 GCTTCAATAGATGAATTTTGGGG - Intronic
912941186 1:114046576-114046598 GCTTCAACATATAAATTTTGAGG - Intergenic
913112590 1:115669950-115669972 GCTTCCACATATGAATTTGGGGG - Intronic
913302602 1:117388032-117388054 GGTTCAACATATGAATTTTGGGG + Intronic
913394221 1:118348821-118348843 GCTTCCACAAATGTTTTTTGGGG - Intergenic
913508445 1:119540743-119540765 TCTTCCCCCAATGAGTTTTCAGG - Intergenic
914213469 1:145603220-145603242 GCTTCAACATATGCATTTTGCGG + Intergenic
914376162 1:147075839-147075861 GTTTCAACCAAGGCATTTTGGGG - Intergenic
914465409 1:147923669-147923691 GCTTCAACATATGCATTTTGGGG + Intergenic
914505615 1:148286726-148286748 GTTTCAACCAAGGCATTTTGGGG - Intergenic
914506947 1:148297425-148297447 GTTTCAACCAAGGCATTTTGGGG + Intergenic
915031879 1:152886787-152886809 GCTTCCACCGATGAGTTGGGGGG - Intergenic
915618523 1:157061899-157061921 GCTTCAACATATGAATTTGGTGG + Intergenic
915661381 1:157408468-157408490 GCTTCAACATATGAATTTGGGGG + Intergenic
916727466 1:167535635-167535657 GCTTCAACATATGAATTTGGGGG - Intronic
917131407 1:171745961-171745983 ACTTCAACATATGAATTTTGAGG - Intergenic
917152797 1:171962758-171962780 GCTTCAACACATGAATTTTGGGG + Intronic
917269353 1:173256530-173256552 GCTTCAACACATGAATTTGGGGG + Intergenic
917411701 1:174765939-174765961 ACTTCAACATATGAATTTTGGGG - Intronic
918090409 1:181288567-181288589 GCTTCAATACATGAATTTTGGGG + Intergenic
918728699 1:187960890-187960912 GTTTCAACATATGAATTTTGGGG + Intergenic
918868845 1:189939375-189939397 GCTTCAACATATGAACTTTGGGG + Intergenic
918923636 1:190750172-190750194 ACTTCAACATATGAATTTTGGGG - Intergenic
919155415 1:193758870-193758892 GCTTCAATGTATGAATTTTGAGG + Intergenic
919692637 1:200541436-200541458 ACTTCGACATATGAATTTTGAGG - Intergenic
919917238 1:202146223-202146245 ACTTCAACCTATGAATTTGGGGG - Intergenic
920188208 1:204175516-204175538 ATTTCAACCTATGAATTTTGGGG - Intergenic
920243430 1:204570467-204570489 GTTTCAACATATGAATTTTGGGG + Intergenic
920586666 1:207170429-207170451 GCTTCCACATATAAATTTTGAGG + Intergenic
921103365 1:211951214-211951236 GCTTCCACATACGAATTTGGGGG - Intronic
921441908 1:215197615-215197637 GCTTCAACATATGACTTTTGGGG + Intronic
921511415 1:216035192-216035214 ACTTCAACATATGAATTTTGGGG - Intronic
921624983 1:217370049-217370071 ACTTCCACATACGAATTTTGGGG - Intergenic
921741241 1:218687514-218687536 GCTTCAACACATGAATTTTGAGG + Intergenic
922078610 1:222272380-222272402 GCTTCAACATATGAATTTTGGGG + Intergenic
922197591 1:223373079-223373101 GCTTCAACCTATAAATTTTTGGG + Intergenic
922277599 1:224093523-224093545 GTTTCAACATATGAATTTTGGGG - Intergenic
922556833 1:226539039-226539061 GGTCCCACCAATGTATTTGGCGG + Intergenic
922786922 1:228287447-228287469 GCTTCCAACTGTGAATTTGGCGG + Intronic
922849435 1:228720400-228720422 ACTTCAACATATGAATTTTGGGG - Intergenic
922893720 1:229083158-229083180 GCTTCAATCTATGAATTTTGAGG - Intergenic
923510194 1:234644465-234644487 GGTTCAACATATGAATTTTGGGG + Intergenic
923560512 1:235036811-235036833 GCTTCAACATATGAATTTGGGGG - Intergenic
924226842 1:241928971-241928993 GTTTCAACCTATGAATTTGGGGG - Intergenic
924462348 1:244270655-244270677 GCTTCAACATATGAATTTTGGGG - Intergenic
1062921081 10:1280233-1280255 GCTTCAACATATGAATTTCGGGG + Intronic
1062966414 10:1610933-1610955 GCTTTAACTCATGAATTTTGGGG + Intronic
1063017748 10:2095518-2095540 ACTTCGACTTATGAATTTTGGGG - Intergenic
1063267657 10:4472601-4472623 GCTTCTACATAGGAATTTTGGGG - Intergenic
1063512149 10:6655958-6655980 ACTTCAACGTATGAATTTTGGGG + Intergenic
1063718318 10:8552724-8552746 GGTTCAACATATGAATTTTGGGG + Intergenic
1063754465 10:8991558-8991580 GCTTCAACATAAGAATTTTGGGG - Intergenic
1063817147 10:9788355-9788377 GATTCAACATATGAATTTTGGGG + Intergenic
1063882942 10:10549804-10549826 ACTTCAACGTATGAATTTTGAGG + Intergenic
1064277698 10:13921673-13921695 GTTTCAACAGATGAATTTTGGGG + Intronic
1064347858 10:14548866-14548888 GCTTCAACATAGGAATTTTGGGG - Intronic
1064392230 10:14951857-14951879 GCTTCAACATATGAATTTTGTGG + Intronic
1064623928 10:17242689-17242711 GCTTCAACATATGAATTTTGGGG + Intergenic
1064741607 10:18440287-18440309 GTTTCAACATATGAATTTTGGGG + Intronic
1064771782 10:18730729-18730751 GCTTCCACATATGAATTTTGGGG + Intergenic
1064944366 10:20771587-20771609 GCTTCAACATATGAATTTTAAGG - Intergenic
1064959987 10:20953125-20953147 GCTTCAACATATGAATTTTGGGG - Intronic
1064985334 10:21204276-21204298 GCTCCAACGTATGAATTTTGAGG - Intergenic
1065171545 10:23035332-23035354 GCTTCAACATATGAATTTGGGGG + Intronic
1065594630 10:27298297-27298319 GCTTTCTCAAATGAATTTTAGGG - Intergenic
1065650174 10:27880506-27880528 GTTTCAACACATGAATTTTGAGG - Intronic
1065656267 10:27954268-27954290 GCTTTCTCAAATGAATTTTAGGG + Intronic
1065871343 10:29958993-29959015 GATTCAACATATGAATTTTGAGG - Intergenic
1065920455 10:30388159-30388181 GCTTCAACATATGAATTTGGAGG + Intergenic
1065991658 10:31016013-31016035 GCCTCAACATATGAATTTTGGGG + Intronic
1066064637 10:31753161-31753183 ACTTCAACACATGAATTTTGGGG - Intergenic
1066110354 10:32190098-32190120 GCTTCGACATGTGAATTTTGAGG - Intergenic
1067002016 10:42624263-42624285 GCTCCAACATATGAATTTTGGGG + Intronic
1067127873 10:43535515-43535537 GCTTCAATATATGAATTTTGGGG + Intergenic
1067180917 10:43985357-43985379 GCTTCCACATATGAATATTGTGG - Intergenic
1067363435 10:45602466-45602488 ACTTCAACATATGAATTTTGGGG - Intergenic
1067408856 10:46047357-46047379 GCTTAAACCAATGAATTTTTAGG + Intergenic
1067658818 10:48218263-48218285 GGTTCTACATATGAATTTTGGGG + Intronic
1067934548 10:50598091-50598113 GTTTCAACATATGAATTTTGTGG - Intronic
1068031274 10:51708374-51708396 GCTTCAACATATGAATTTTGAGG + Intronic
1068141893 10:53019541-53019563 ATTTCAACAAATGAATTTTGAGG - Intergenic
1068459065 10:57302448-57302470 GCTACAACATATGAATTTTGAGG + Intergenic
1068478225 10:57555652-57555674 GCTTCAACATATGAATTTTGAGG - Intergenic
1068639604 10:59388461-59388483 GCTTCAACATATGAATTTGGTGG + Intergenic
1068650933 10:59521960-59521982 GCTTCAACATATGAATTTTGGGG - Intergenic
1068859201 10:61829790-61829812 ACTTCAACATATGAATTTTGGGG - Intergenic
1068896254 10:62205840-62205862 GCTTTGACCAAGGAATATTGGGG + Intronic
1068909331 10:62361443-62361465 GTTTCCACAAATAAATTTTAGGG - Intergenic
1068939802 10:62669639-62669661 GCTTCAATATATGAATTTTGGGG + Intronic
1069681898 10:70291465-70291487 GCTTCGACATAGGAATTTTGAGG + Intergenic
1070516822 10:77215702-77215724 GCTTCAACATATGAATTTTGGGG - Intronic
1070576584 10:77683631-77683653 GTTTCAAACAATGAATTTGGAGG - Intergenic
1070635624 10:78124910-78124932 GCTTCAACATATGAATTTTTGGG + Intergenic
1070916636 10:80159240-80159262 ACTTCCACATATGAACTTTGGGG - Intronic
1070995804 10:80779811-80779833 ACTTCAACAGATGAATTTTGGGG + Intergenic
1071228057 10:83554569-83554591 GCTTCAACATATCAATTTTGAGG + Intergenic
1071237474 10:83666104-83666126 GCTTCAACATATGAATTTTTGGG - Intergenic
1071413020 10:85415181-85415203 GCTTCAACATATGAATTTGGGGG + Intergenic
1071548756 10:86549611-86549633 GTTTCAACATATGAATTTTGGGG - Intergenic
1071762216 10:88621089-88621111 GCTTCAACTTATGAATTTTTGGG + Intergenic
1071842119 10:89483298-89483320 GCTTCAACATATGAATTTGGTGG + Intronic
1072200531 10:93153965-93153987 GCTTCAACATATGAATTTTGGGG + Intergenic
1072707590 10:97692443-97692465 GCTTCAACATATGAATCTTGAGG + Intergenic
1072892450 10:99336013-99336035 GCTTCAACATATGAATTTTGTGG + Intronic
1073362301 10:102909616-102909638 GCTTCAATGTATGAATTTTGGGG - Intergenic
1073754279 10:106564260-106564282 GCTTCAAACCATGGATTTTGTGG + Intergenic
1073773368 10:106760018-106760040 GTTTCAACATATGAATTTTGAGG - Intronic
1073807766 10:107118042-107118064 GTTTCAACATATGAATTTTGGGG - Intronic
1074336090 10:112577252-112577274 GCTTCAACGTGTGAATTTTGGGG + Intronic
1074492733 10:113953743-113953765 GCTTCCACATATGAATTCTGGGG - Intergenic
1075062256 10:119265368-119265390 GCTTCAACAAATGAATTGTGTGG - Intronic
1075196073 10:120360158-120360180 GCTTCAACATATGAATTTTGAGG + Intergenic
1075245845 10:120821658-120821680 GCTTCAGCATATGAATTTTGAGG - Intergenic
1075312150 10:121423403-121423425 GCTTCAACTGATGCATTTTGGGG - Intergenic
1075317761 10:121466120-121466142 ACTTCAACATATGAATTTTGGGG - Intergenic
1075512422 10:123083349-123083371 GCTTCAACATATGAATTTTGAGG - Intergenic
1076072693 10:127504165-127504187 ACTTCAACAAATGAATTTGGAGG + Intergenic
1076183143 10:128426245-128426267 GCTTCAACATATGAATTCTGGGG + Intergenic
1076412453 10:130261867-130261889 GCTTCCACCTGTGAATTCTGGGG + Intergenic
1076440301 10:130476824-130476846 GTTTCAACCTATGAATTTTAGGG + Intergenic
1076557342 10:131335882-131335904 GCTTCAACATATGTATTTTGGGG - Intergenic
1076749591 10:132536128-132536150 GCTTCAACCCATGAATTTGCGGG + Intergenic
1077289982 11:1784599-1784621 GCTTCAACACATGAATTTTGGGG + Intergenic
1077492267 11:2867066-2867088 GCTTCGACATATGATTTTTGGGG - Intergenic
1078025148 11:7688030-7688052 GCTTCAACACATGAATTTGGTGG + Intergenic
1078146488 11:8725146-8725168 GTTTCCACATAGGAATTTTGGGG - Intronic
1078258941 11:9685972-9685994 GTTTCAACATATGAATTTTGGGG + Intronic
1078371152 11:10746507-10746529 ACTTCCATAAATGAATTTTGAGG - Intergenic
1078739230 11:14051121-14051143 ACTTCAACAAATGGATTTTGGGG - Intronic
1078827725 11:14946516-14946538 GCTTCAACATGTGAATTTTGGGG + Intronic
1078867695 11:15313143-15313165 GTTTCAACATATGAATTTTGGGG - Intergenic
1079123809 11:17704286-17704308 GCTTCAACCTATGAATTTCCAGG - Intergenic
1079162859 11:18011211-18011233 GCTTCAACACGTGAATTTTGGGG - Intronic
1079233969 11:18674248-18674270 GCTTCCACATATAAATTTTGGGG + Intergenic
1079358739 11:19752861-19752883 GCTTCAACATATGAATTTGGGGG - Intronic
1079468747 11:20758142-20758164 GCTTCAACATACGAATTTTGGGG + Intronic
1079501371 11:21105044-21105066 GCTTCCACATATGAATTTGGGGG + Intronic
1079506977 11:21163882-21163904 GCTTCAATATATGAATTTTGAGG + Intronic
1079542157 11:21589530-21589552 GCTTCAACATATGAATTTTATGG - Intergenic
1079691035 11:23417183-23417205 GCTTCAACCAATGAATTTTGTGG + Intergenic
1079752011 11:24212136-24212158 TCTTCCACGTATTAATTTTGGGG - Intergenic
1079798652 11:24841091-24841113 GCTTTAACATATGAATTTTGGGG - Intronic
1079826151 11:25196721-25196743 ACTTCAACTTATGAATTTTGGGG + Intergenic
1079976152 11:27093902-27093924 GCTTCAACATATGAATTTGGGGG + Intronic
1080021792 11:27569325-27569347 GCTTCAACATATGAATTTTGGGG + Intergenic
1080103439 11:28486049-28486071 GCTTCAACACATGAATTCTGGGG + Intergenic
1080143344 11:28949017-28949039 ACTTCAACTTATGAATTTTGTGG + Intergenic
1080201172 11:29672126-29672148 GTTTCGACCAAAAAATTTTGGGG + Intergenic
1080206241 11:29732615-29732637 GCTTCAACTAAAGATTTTTGTGG - Intergenic
1080294126 11:30705422-30705444 ATTTCAACCAATGAATTTAGGGG + Intergenic
1080368395 11:31606900-31606922 GCTTCAACATATGAATTCTGGGG - Intronic
1080398039 11:31907692-31907714 GCTTCAACATATGAATATTGGGG + Intronic
1080688429 11:34535104-34535126 GCTTCAATATATGAATTTTGGGG + Intergenic
1080743528 11:35087171-35087193 ACTTCAACTTATGAATTTTGGGG + Intergenic
1080991958 11:37546917-37546939 CCTTCAACATATGAATTTTGGGG + Intergenic
1081114160 11:39177454-39177476 GTTTTCACATATGAATTTTGGGG - Intergenic
1081205508 11:40270536-40270558 ACCTCAACCTATGAATTTTGAGG + Intronic
1081505111 11:43708091-43708113 GCTTCAACGTATGAATTTGGGGG + Intronic
1081602540 11:44505276-44505298 GCTCCAACCCATGAATTTGGAGG + Intergenic
1082781034 11:57287548-57287570 ACTTCAACATATGAATTTTGGGG - Intergenic
1082825197 11:57572446-57572468 GCTTCAACATGTGAATTTTGAGG + Intergenic
1083375582 11:62217606-62217628 CCTTCCACTCATGACTTTTGAGG + Intergenic
1083690118 11:64402784-64402806 GCTTCGGCATATGAATTTTGGGG - Intergenic
1083819435 11:65159300-65159322 GCATCCACCAATGAATGATTGGG + Intergenic
1084172669 11:67408148-67408170 GCTGCCAGGAAGGAATTTTGAGG + Intronic
1084472901 11:69373588-69373610 GCTTCAACTTAGGAATTTTGAGG - Intergenic
1084568822 11:69947186-69947208 GTTTCCACATATGAATGTTGGGG + Intergenic
1084736834 11:71110834-71110856 TATTCAACCTATGAATTTTGCGG - Intronic
1084788102 11:71455476-71455498 GTTTCAACATATGAATTTTGTGG - Intronic
1085075601 11:73588736-73588758 GCTTCAATTTATGAATTTTGAGG - Intronic
1085096439 11:73764154-73764176 GTTTCAACATATGAATTTTGGGG + Intergenic
1085445961 11:76601054-76601076 GTTTCAACATATGAATTTTGGGG - Intergenic
1085840396 11:80005003-80005025 GATTCCATCTATTAATTTTGGGG + Intergenic
1086305721 11:85480024-85480046 ACTTCAACACATGAATTTTGTGG + Intronic
1086532854 11:87806509-87806531 GGTTCAACATATGAATTTTGGGG + Intergenic
1086737768 11:90328449-90328471 GTTTCAACATATGAATTTTGGGG - Intergenic
1087076954 11:94134489-94134511 ACTTCGACATATGAATTTTGCGG - Intronic
1087303557 11:96462879-96462901 ACTTCAACATATGAATTTTGAGG + Intronic
1087617562 11:100505949-100505971 GCTTCAACATATGAATTTTGGGG - Intergenic
1087676527 11:101169004-101169026 GTTTCAACACATGAATTTTGGGG - Intergenic
1087779869 11:102290692-102290714 CCTTCAACATATGAATTTTGGGG + Intergenic
1087867981 11:103257041-103257063 ATTTCCACATATGAATTTTGGGG - Intronic
1087923153 11:103890136-103890158 GCTTCAACATATGAATTTGGGGG - Intergenic
1087978115 11:104575764-104575786 GTTTCAACCCATGAATTTTGGGG - Intergenic
1088333301 11:108675498-108675520 GCTTCAACATAGGAATTTTGGGG + Intronic
1088353113 11:108911862-108911884 GTTTCAACACATGAATTTTGTGG + Intronic
1088375059 11:109132033-109132055 GCTTCAACACATGAATTTTGGGG - Intergenic
1088432957 11:109778609-109778631 ACTTCAACACATGAATTTTGAGG + Intergenic
1088634318 11:111805059-111805081 ACTTCAACATATGAATTTTGAGG - Intronic
1089046794 11:115508171-115508193 GCTTCAACATATGAATTTTGGGG - Intergenic
1089075370 11:115734273-115734295 CCTTCAACATATGAATTTTGCGG + Intergenic
1089178710 11:116566287-116566309 GCTTCAACACATAAATTTTGGGG + Intergenic
1089477637 11:118778369-118778391 CCTTACAACAAAGAATTTTGTGG - Intronic
1089486417 11:118849901-118849923 GTTTCAACATATGAATTTTGGGG - Intergenic
1089672195 11:120064240-120064262 GCTTCAACAGATGAATTCTGTGG - Intergenic
1090458411 11:126869053-126869075 GTTTCAACATATGAATTTTGAGG + Intronic
1090705709 11:129334479-129334501 GTTTCCACACATGAACTTTGGGG - Intergenic
1090827062 11:130395117-130395139 GCTTCAACATATGAATTTTGGGG - Intergenic
1090840612 11:130484715-130484737 ACTTCGACATATGAATTTTGGGG + Intergenic
1090876955 11:130798780-130798802 GCTTCAACAGATGAATTTTGGGG - Intergenic
1091536453 12:1414483-1414505 GTTTCAACATATGAATTTTGAGG + Intronic
1091541487 12:1466445-1466467 GCTTCCACCTATGAATTTGGTGG + Intronic
1091619973 12:2079623-2079645 GCTTCAACATATAAATTTTGGGG + Intronic
1091634259 12:2185412-2185434 GCTTCAACACATGAGTTTTGGGG - Intronic
1092031678 12:5291543-5291565 ACTTCAACCTCTGAATTTTGGGG - Intergenic
1092318713 12:7447736-7447758 GCTTCAACCTGTGGATTTTGTGG - Intronic
1092442036 12:8512913-8512935 GCTTCCACCAATGAATTTTGAGG + Intronic
1092586780 12:9908637-9908659 CCTTCCACTCATGACTTTTGAGG - Intronic
1092646764 12:10583065-10583087 GTTTCAACAAATGAATTTTTGGG - Intergenic
1092661109 12:10739461-10739483 GCTTCAACATATGAAATTTGGGG - Intergenic
1092728944 12:11510309-11510331 GCTTCCATACATGAATTTTGGGG + Intergenic
1092767129 12:11862778-11862800 ACTTCAACTTATGAATTTTGGGG + Intronic
1093052484 12:14519185-14519207 ACTTCAACATATGAATTTTGAGG - Intronic
1093117380 12:15227443-15227465 GCTTCAACATATGCATTTTGAGG + Intronic
1093184408 12:16003386-16003408 ACTTCCACCTATGAATTTTGGGG + Intronic
1093237245 12:16626163-16626185 GTTTCAACCCTTGAATTTTGAGG - Intergenic
1093271190 12:17064171-17064193 GTTTCAACAAATGAATTTTGAGG + Intergenic
1093366955 12:18314310-18314332 GCCTCAACTTATGAATTTTGGGG - Intronic
1093393512 12:18652105-18652127 ACTTCAACCTATCAATTTTGGGG - Intergenic
1093763058 12:22932085-22932107 GGTTTCACATATGAATTTTGGGG - Intergenic
1093881007 12:24404784-24404806 GCTTCAACATATGAATTTGGGGG - Intergenic
1093995875 12:25642221-25642243 GCTTCAACAGATGAATTTTGGGG - Intronic
1093997231 12:25655348-25655370 GCTTCAACAAATGAATTTGGTGG + Intergenic
1094277887 12:28699488-28699510 ACTTCCACATGTGAATTTTGGGG - Intergenic
1094327366 12:29255423-29255445 GCTTCAACACATGAATTTTAGGG + Intronic
1094444680 12:30516692-30516714 GCTTCAACATATGAATTTGGGGG + Intergenic
1094608964 12:31974665-31974687 GCTTTCACTTATGAATTTTGGGG + Intronic
1094681184 12:32668762-32668784 TCTTCGACATATGAATTTTGCGG - Intergenic
1094705840 12:32913714-32913736 GTTTCAACCTATGAATTTTGAGG + Intergenic
1094793203 12:33938803-33938825 GCTTCAACATATGAATTTTGTGG - Intergenic
1094795751 12:33970373-33970395 GCTTCAACGTATGAATTTTTAGG - Intergenic
1095108499 12:38264234-38264256 GCTTCAACGTATGAATTTTTAGG - Intergenic
1095344489 12:41133587-41133609 GCTTCCAAGTATGAATTTTGTGG - Intergenic
1095401301 12:41817654-41817676 GCTTCAATATATGAATTTTGGGG - Intergenic
1095447812 12:42299914-42299936 GCTTCAACACATGAATTTTGGGG + Intronic
1095708878 12:45267445-45267467 GCTTCCACATCTGATTTTTGGGG + Intronic
1095847368 12:46760073-46760095 GCTTCCACATATGAATTTGGGGG + Intergenic
1096305998 12:50476157-50476179 GCTGCCAGGAATCAATTTTGAGG + Exonic
1096361448 12:50991341-50991363 GCTTCAGCCACTGAAGTTTGAGG - Intronic
1096893361 12:54794665-54794687 TCATTCAACAATGAATTTTGGGG - Intergenic
1096924812 12:55132284-55132306 GCTTCAACACATGAATTTTGAGG - Intergenic
1097027387 12:56067296-56067318 ACTTCAACATATGAATTTTGGGG - Intergenic
1097464018 12:59900665-59900687 GTTTCCACATACGAATTTTGGGG - Intergenic
1097669439 12:62518254-62518276 GCTTCAACACATGAATTTTGGGG + Intronic
1097708534 12:62893862-62893884 ACTTCAACATATGAATTTTGGGG + Intronic
1098096036 12:66957035-66957057 GTTTCAACATATGAATTTTGTGG - Intergenic
1098156035 12:67599677-67599699 GCTTCAATACATGAATTTTGAGG + Intergenic
1098176679 12:67799397-67799419 GCTTCAACATATGAATTTTGGGG - Intergenic
1098300461 12:69048676-69048698 GTTTCAACATATGAATTTTGGGG + Intergenic
1098432567 12:70435718-70435740 CCTTCAACCTATAAATTTTGGGG + Intergenic
1098496913 12:71146824-71146846 GCTTCAACATATGAATTTTGTGG - Intronic
1098547385 12:71726930-71726952 GCTTCAACATATGGATTTTGGGG - Intergenic
1098916638 12:76263728-76263750 GCTTCAACATATGAATTTTGAGG - Intergenic
1098947103 12:76601197-76601219 ACTTCAACAAATGAATTTTGGGG + Intergenic
1099003932 12:77215323-77215345 ACTTCAACGTATGAATTTTGGGG + Intergenic
1099081400 12:78187063-78187085 GCTTCGATGTATGAATTTTGAGG + Intronic
1099161458 12:79246745-79246767 GTTTCAACATATGAATTTTGGGG + Intronic
1099274983 12:80563498-80563520 GTTTCAACATATGAATTTTGGGG + Intronic
1099303078 12:80921699-80921721 GCTTCAACATATGCATTTTGGGG + Intronic
1099345218 12:81491467-81491489 GCTTCAACAAATGAATTTTGAGG - Intronic
1099632928 12:85173809-85173831 GTTTCAACGTATGAATTTTGGGG + Intronic
1099682073 12:85842913-85842935 GCTTCAACATATGAATTTTGTGG - Intergenic
1099948326 12:89271247-89271269 GCTTCAACATAGGAATTTTGGGG - Intergenic
1100121282 12:91372264-91372286 GCTTCAACATATGAATTTGGTGG - Intergenic
1100434086 12:94555607-94555629 GCTTCAACATATGAATTTTGGGG + Intergenic
1100784741 12:98066878-98066900 ACTTCAACAAATGAATTTTGTGG - Intergenic
1100829675 12:98506325-98506347 GCTTCAACATATGAATGTTGGGG - Intergenic
1100964801 12:100000674-100000696 GCTTCAACATATGGATTTTGAGG + Intergenic
1101012547 12:100466097-100466119 GCTTCAACCTGTGAATTTTGGGG + Intergenic
1101305792 12:103526598-103526620 GCTTGAACATATGAATTTTGGGG - Intergenic
1101363279 12:104047718-104047740 GTTTCAACATATGAATTTTGGGG + Intronic
1101561921 12:105864840-105864862 GCTTCAACATGTGAATTTTGAGG + Intergenic
1101872538 12:108577800-108577822 GCTTCTACATAAGAATTTTGAGG - Intergenic
1102733184 12:115132722-115132744 GTTTCCAGCAATTGATTTTGGGG - Intergenic
1102808005 12:115799201-115799223 GCTTCAACATATGAATTTAGAGG - Intergenic
1103144211 12:118580376-118580398 GCTTCAACATATAAATTTTGAGG - Intergenic
1104037610 12:125108499-125108521 GCTTCAACATACGAATTTTGGGG + Intronic
1104153597 12:126108905-126108927 GCTTCGACATATGAATTGTGGGG + Intergenic
1104216470 12:126738875-126738897 GCTTCAACATACGAATTTTGGGG + Intergenic
1104222542 12:126798938-126798960 GCTTCAATATATGAATTTTGAGG - Intergenic
1104280105 12:127369005-127369027 GCTTCAACATATGAATTTTGTGG + Intergenic
1105245733 13:18648464-18648486 GCTTCAATATATGAATTTTGGGG - Intergenic
1105464006 13:20620471-20620493 GTTTCAACATATGAATTTTGGGG - Intronic
1105991591 13:25627391-25627413 GCTTCAACATATAAATTTTGGGG - Intronic
1106195553 13:27491279-27491301 GCTTCAACATATGAATTTTAGGG - Intergenic
1106431417 13:29683996-29684018 GCTTCAGCCTATGAATTGTGGGG + Intergenic
1106637371 13:31543416-31543438 ACTTCAACATATGAATTTTGAGG + Intergenic
1106678935 13:31990042-31990064 GTTTCAACATATGAATTTTGGGG - Intergenic
1106856531 13:33859861-33859883 GCTTCAACATATGAATTTGGGGG - Intronic
1106865042 13:33954850-33954872 GCTTCAACATATGAATTTTAGGG + Intronic
1106932364 13:34680392-34680414 TTTTCCAGCAATGAATTTTATGG + Intergenic
1107215240 13:37909971-37909993 GATTCTACAGATGAATTTTGGGG - Intergenic
1107301795 13:38973639-38973661 GGTTCAACCTATGAATTTTGGGG + Intronic
1107571991 13:41671554-41671576 GCTTCAACATATGAATTTGGCGG - Intronic
1107818147 13:44262616-44262638 GCTTCAACATATGAATTTTGGGG - Intergenic
1108181482 13:47844417-47844439 GCTTCAACACATGAATTTGGGGG - Intergenic
1108273519 13:48785800-48785822 GCTTTAACATATGAATTTTGGGG - Intergenic
1108647306 13:52443304-52443326 GCTTCAACATATGAATTTGGGGG - Intronic
1108961385 13:56236275-56236297 ACTTCAACATATGAATTTTGGGG + Intergenic
1109143032 13:58740145-58740167 GCTTCACCATATGAATTTTGGGG + Intergenic
1109182000 13:59224721-59224743 GCTTCAACATATGAATGTTGGGG + Intergenic
1109493304 13:63132347-63132369 GCTTCAACATATGAATTTCGGGG - Intergenic
1109948691 13:69472474-69472496 ACCTCAACCTATGAATTTTGAGG + Intergenic
1109977762 13:69862609-69862631 GCTTCAACATATGAATTTTGAGG - Intronic
1110137986 13:72091840-72091862 GCTTCAACACATGAATTTGGTGG - Intergenic
1110262507 13:73501320-73501342 GTTTCAACATATGAATTTTGGGG - Intergenic
1110285733 13:73748359-73748381 GCTTCAACGTGTGAATTTTGGGG - Intronic
1110407329 13:75165429-75165451 GTTTCAACATATGAATTTTGGGG - Intergenic
1110687827 13:78396089-78396111 GCTTCAACATATGAATTGTGAGG - Intergenic
1110702536 13:78565999-78566021 GCTTCAACATAGGAATTTTGGGG - Intergenic
1110880119 13:80561431-80561453 GCTTCAACATATGAATTTTGGGG - Intergenic
1111104436 13:83627136-83627158 GCTTCAGCATATGAATTTTGGGG + Intergenic
1111151972 13:84264669-84264691 GCTTCAACCTATGAATTTGGAGG - Intergenic
1111686507 13:91507742-91507764 GTTTCAACATATGAATTTTGGGG + Intronic
1111874026 13:93870552-93870574 GCTTCAACATATGAATTTAGGGG - Intronic
1111946453 13:94670333-94670355 GCTTCAACCTGTGAATTTGGGGG + Intergenic
1112095405 13:96127105-96127127 GCTTCAACAGATGAATTTTGTGG - Intronic
1112108488 13:96268159-96268181 GCTCCAATCTATGAATTTTGGGG + Intronic
1112364276 13:98743214-98743236 GCTTCAACATATGCATTTTGGGG + Intronic
1112423249 13:99272797-99272819 GCTTCAACATATGAATTTAGGGG + Intronic
1112590499 13:100759819-100759841 GCTTCAACACATGAATTTTGAGG + Intergenic
1112713082 13:102152583-102152605 ACTTCAACCTATGAATTTTAGGG + Intronic
1113096359 13:106667788-106667810 GCTTCAACATATGAATTTTGAGG + Intergenic
1113270814 13:108671931-108671953 GCTTCTACATATGATTTTTGAGG + Intronic
1113462896 13:110493996-110494018 GCTTCCACTTAGGAACTTTGGGG + Intronic
1113538977 13:111092165-111092187 GCTTCAACCTATGAATTAGGGGG - Intergenic
1113822866 13:113227493-113227515 GCTTCAGCCTATGAATTTTGGGG + Intronic
1113839100 13:113348496-113348518 ACTTCAACAGATGAATTTTGGGG - Intronic
1114543818 14:23483575-23483597 CCTTCCTCAAATTAATTTTGTGG + Intronic
1114593335 14:23890369-23890391 GCTTTCACATATGAATTTTGGGG - Intergenic
1114738001 14:25062859-25062881 GTTTCAACACATGAATTTTGGGG + Intergenic
1115129191 14:30033381-30033403 GTTTCCAACAATAAATTTAGTGG + Intronic
1115260395 14:31446693-31446715 GCTTCAACATATAAATTTTGGGG + Exonic
1116145898 14:41068942-41068964 CCTTCAACACATGAATTTTGAGG - Intergenic
1116214648 14:41997460-41997482 ACTTCAACAAATGAATTTTGGGG - Intergenic
1116321700 14:43475615-43475637 GCTTCGACATATGAATTTAGGGG - Intergenic
1116465418 14:45226947-45226969 GTGTCCACTAATGAAATTTGCGG - Intronic
1116525280 14:45896633-45896655 GTTTCAACATATGAATTTTGAGG - Intergenic
1116627088 14:47279200-47279222 GCTTCCATCAGCAAATTTTGAGG + Intronic
1116665395 14:47767626-47767648 GGTTCAACATATGAATTTTGAGG + Intergenic
1116674391 14:47886996-47887018 GCTTCGACATATGTATTTTGGGG + Intergenic
1117211461 14:53505024-53505046 GCTTCAACATATGAATTTTAGGG + Intergenic
1117227184 14:53674268-53674290 TCTTCAACATATGAATTTTGGGG - Intergenic
1117287792 14:54304125-54304147 GTTTCAACATATGAATTTTGGGG - Intergenic
1117410122 14:55442805-55442827 GCTTCAACATATAAATTTTGGGG - Intronic
1117500942 14:56350652-56350674 GTTTCAACCTATGAATTTTGGGG + Intergenic
1117508761 14:56427987-56428009 GCTTCAACATATGAGTTTTGGGG - Intergenic
1117581335 14:57154370-57154392 ACTTCAACCTATGAATTTTGGGG - Intergenic
1117611076 14:57484137-57484159 GCTTCAACATATGAATTTTGTGG - Intronic
1117873460 14:60224659-60224681 GCTTTAACAAATAAATTTTGGGG - Intergenic
1117960944 14:61160853-61160875 GCTTCAAACTATGAATTTGGGGG - Intergenic
1118032015 14:61827088-61827110 GCCTCAACATATGAATTTTGGGG + Intergenic
1118074389 14:62282480-62282502 GCTTCAACATATGAATTTTAGGG - Intergenic
1118115830 14:62775889-62775911 GCTTCAACAGATGGATTTTGAGG - Intronic
1118378779 14:65200858-65200880 CCTTCAACATATGAATTTTGGGG - Intergenic
1118561255 14:67086126-67086148 GCTTCCACCATTGATTATTGTGG + Intronic
1118735679 14:68700209-68700231 GTTTCAACATATGAATTTTGTGG - Intronic
1118928052 14:70212163-70212185 GCTTCAACATATGAATTTGGGGG - Intergenic
1119063398 14:71500398-71500420 GCTTCCACCATATGATTTTGAGG - Intronic
1119595908 14:75933696-75933718 GCTTCAACATATGAATTTTGAGG - Intronic
1119911493 14:78353564-78353586 GTTTCAACACATGAATTTTGGGG + Intronic
1119915448 14:78397080-78397102 GCTTCAACATATGAATTTTAGGG + Intronic
1119933551 14:78570104-78570126 GCTTCCACATGTGAATTTTGGGG - Intronic
1120024836 14:79571031-79571053 GCTTCAACAGATGATTTTTGGGG + Intronic
1120045753 14:79803634-79803656 ACTTCAACATATGAATTTTGAGG + Intronic
1120382398 14:83797371-83797393 GTTTCAACAAATGAATTTTGAGG + Intergenic
1120483755 14:85084676-85084698 GTTTCAACATATGAATTTTGGGG + Intergenic
1120496685 14:85246692-85246714 TTTTCCATCAATTAATTTTGGGG + Intergenic
1120613750 14:86675819-86675841 GCTTCAACCAGTAAATTTTGAGG - Intergenic
1120658657 14:87227097-87227119 GCTTCGACATATGAATTTGGGGG + Intergenic
1120886227 14:89453874-89453896 GCTTCAACATCTGAATTTTGGGG - Intronic
1120943715 14:89974069-89974091 GCTTCAACATATGAATTTGGTGG + Intronic
1121214174 14:92234420-92234442 GCTTCAACAGATGAATTTTGAGG - Intergenic
1121720817 14:96107499-96107521 GCTTCAACATATGAATTTGGGGG - Intergenic
1121783395 14:96637159-96637181 ACTTCAACATATGAATTTTGTGG + Intergenic
1121827602 14:97023131-97023153 GGTTCAACATATGAATTTTGCGG + Intergenic
1122085942 14:99304918-99304940 GCTTCAACATATGAATTTAGGGG + Intergenic
1122135650 14:99631418-99631440 GCTTCCACATATGAACTTGGGGG + Intergenic
1122181822 14:99960706-99960728 GCTTCAACGTATGAATTTGGGGG + Intergenic
1122192055 14:100053152-100053174 GCTTCAACATATGAATTTTGGGG + Intronic
1122249825 14:100429978-100430000 GCTTCAACATATGAATTTTGGGG + Intronic
1122258006 14:100493747-100493769 GCCTCAACATATGAATTTTGGGG - Intronic
1122495870 14:102154508-102154530 GTTTCAACAAATGAATTTTGAGG + Intronic
1122676870 14:103422868-103422890 GCTTACACATATGAATTTTGAGG - Intronic
1122704207 14:103609851-103609873 ACTTCAACATATGAATTTTGGGG - Intronic
1122820405 14:104341873-104341895 GCTTCAACATATGAATATTGGGG + Intergenic
1122827930 14:104380396-104380418 GCTTCAACATATGAATTTGGGGG + Intergenic
1123672261 15:22670942-22670964 GCTTCAACATATGCATTTTGGGG + Intergenic
1123727341 15:23116850-23116872 GCTTCAACATGTGAATTTTGAGG + Intergenic
1124012479 15:25850007-25850029 GTTTCTACCAATTAATTATGAGG + Intronic
1124052335 15:26209132-26209154 GTTTCCACCCATGAATTTTGGGG + Intergenic
1124080688 15:26492108-26492130 GCTTCAACATATGAATTTGGGGG - Intergenic
1124201625 15:27683232-27683254 GCTGCCAGCATTGATTTTTGGGG - Intergenic
1124324308 15:28744233-28744255 GCTTCAACATATGCATTTTGGGG + Intergenic
1124352572 15:28968655-28968677 ACTTCAACAAATGAATTTTGGGG - Intronic
1124440441 15:29681918-29681940 GCTTCAACATATGAATTTGGGGG + Intergenic
1124528192 15:30477274-30477296 GCTTCAACATATGCATTTTGGGG + Intergenic
1124770465 15:32530430-32530452 GCTTCAACATATGCATTTTGGGG - Intergenic
1124912649 15:33937574-33937596 GCTTCAACATATAAATTTTGGGG - Intronic
1124912878 15:33939742-33939764 GTTTCAACAAATGAGTTTTGGGG - Intronic
1124984622 15:34594691-34594713 GCTTCAACAAATGAATATTGGGG + Intergenic
1125049464 15:35279817-35279839 GCTTCAACATATGAATTTGGGGG - Intronic
1125066652 15:35495119-35495141 ACTTCAACATATGAATTTTGAGG - Intronic
1125120697 15:36155391-36155413 GTTTCAACATATGAATTTTGGGG + Intergenic
1125158794 15:36619590-36619612 GCTGCCAGGAATCAATTTTGAGG + Intronic
1125307280 15:38333075-38333097 ATTTCCACATATGAATTTTGTGG + Intronic
1125347608 15:38733861-38733883 GTTTCAACATATGAATTTTGAGG + Intergenic
1125885225 15:43224342-43224364 GCTTCAACATATGAATTTTTGGG + Intergenic
1126136665 15:45399346-45399368 ATTTCAACAAATGAATTTTGTGG - Intronic
1126247328 15:46524329-46524351 ACTTCAACATATGAATTTTGTGG + Intergenic
1126277607 15:46902588-46902610 ACTTCAACCTATGAATTTTGAGG - Intergenic
1126346626 15:47701852-47701874 GCTTTTAACAATGAAGTTTGAGG + Intronic
1126433060 15:48607410-48607432 GTTTCAACATATGAATTTTGTGG - Intronic
1126479317 15:49100193-49100215 GCTTCAACATATGAATTTGGTGG + Intergenic
1126479427 15:49101462-49101484 ACTTCCACCAGTTAATTTTCAGG - Intergenic
1126675547 15:51156923-51156945 GCTTCAACATATGAATTTGGGGG - Intergenic
1126724154 15:51613989-51614011 GTTTCAAGCTATGAATTTTGGGG - Intronic
1126799034 15:52283565-52283587 GCTTCAACATATGAATTTGGGGG - Intronic
1126921099 15:53525719-53525741 GCTTCCACCTCTGATTTTGGAGG + Intronic
1127441335 15:59011810-59011832 ACTTCAACGTATGAATTTTGGGG + Intronic
1127523569 15:59770187-59770209 ACTTCAACATATGAATTTTGGGG - Intergenic
1127564098 15:60169556-60169578 GTTTCAACATATGAATTTTGGGG + Intergenic
1127646762 15:60966298-60966320 ACTTCAACATATGAATTTTGTGG + Intronic
1127706935 15:61556696-61556718 GTTTCAACCCATGAATTTGGAGG - Intergenic
1127719389 15:61684794-61684816 GCTTCAACCTATGAATTTGGGGG + Intergenic
1127733779 15:61823132-61823154 GTTTTCACATATGAATTTTGGGG - Intergenic
1127962567 15:63900624-63900646 GCTTCCACATGTGAATTTGGTGG - Intergenic
1128540565 15:68526853-68526875 GCTTCAACATAGGAATTTTGGGG - Intergenic
1128642195 15:69347904-69347926 GCTTCAACATATGAATTTTTAGG + Intronic
1128672504 15:69585180-69585202 GCTTCAACATATGAATTTTGAGG - Intergenic
1129054731 15:72810967-72810989 GTTTCAACACATGAATTTTGTGG + Intergenic
1129405198 15:75312393-75312415 GCTTCAACATATGAATTTGGAGG - Intergenic
1129478866 15:75807324-75807346 GCTTCAACATATGAATTTGGAGG - Intergenic
1129555745 15:76507068-76507090 ACCTCCACATATGAATTTTGAGG - Intronic
1129803087 15:78431370-78431392 ACTTCAACATATGAATTTTGTGG + Intergenic
1129836979 15:78714835-78714857 GCTTCAACATATGAATTTGGAGG - Intronic
1129946605 15:79543834-79543856 ATTTCAACAAATGAATTTTGTGG + Intergenic
1130309270 15:82738767-82738789 GCTTCGACACATGAATTTGGGGG + Intergenic
1130318337 15:82816196-82816218 GCTTCAACATATGCATTTTGGGG + Intronic
1130905503 15:88237899-88237921 ACTTCAACAAAGGAATTTTGAGG - Intronic
1130930435 15:88422957-88422979 GCTTCAACAGATAAATTTTGGGG - Intergenic
1131040223 15:89257712-89257734 GCTTCAACATATGAAATTTGGGG + Intronic
1131428487 15:92367024-92367046 GTTTCAACATATGAATTTTGGGG + Intergenic
1131543209 15:93291878-93291900 GCTTCTACATATGAATCTTGAGG + Intergenic
1131680953 15:94722769-94722791 GCTTCAACAGATGAATTTTGGGG - Intergenic
1131852623 15:96559160-96559182 ATTTGCACCACTGAATTTTGGGG - Intergenic
1132331728 15:101016601-101016623 GCTTCGACATATGAATTTGGTGG + Intronic
1132736626 16:1389211-1389233 GCTTCCACGTAGGAATTTGGGGG - Intronic
1132996419 16:2825809-2825831 GCTTCCACATATGTACTTTGGGG - Intronic
1133505454 16:6407895-6407917 GCTTCAACATATGAATTCTGGGG - Intronic
1133511425 16:6461398-6461420 ACTTCAACGTATGAATTTTGAGG + Intronic
1133593282 16:7266614-7266636 GCTTCCGCATATGAATTTGGAGG + Intronic
1133849495 16:9488749-9488771 GCTTCAACATATGAACTTTGCGG - Intergenic
1134294996 16:12937801-12937823 GTTTCAACATATGAATTTTGAGG + Intronic
1134476851 16:14581527-14581549 GCTTCAACATATGAATTTTAGGG - Intronic
1134535073 16:15019764-15019786 GTTTCCACATAGGAATTTTGTGG + Intronic
1134572536 16:15303645-15303667 GCTTCAACATATCAATTTTGAGG - Intergenic
1134729848 16:16452389-16452411 GCTTCAACATATCAATTTTGAGG + Intergenic
1134779516 16:16883083-16883105 GCTTCAACATTTGAATTTTGAGG - Intergenic
1134867751 16:17623786-17623808 GATTCAATCAATGAGTTTTGGGG - Intergenic
1134937583 16:18259507-18259529 GCTTCAACATATCAATTTTGAGG - Intergenic
1135137845 16:19898059-19898081 GCTTCAACATATGAATTTAGGGG + Intergenic
1135461111 16:22643771-22643793 GTTTCAACGTATGAATTTTGGGG + Intergenic
1135605943 16:23824865-23824887 GCTTCAACACATGAATTTGGGGG - Intergenic
1135677582 16:24430219-24430241 GCTTCAAAAAAGGAATTTTGAGG - Intergenic
1135829630 16:25761959-25761981 GCTTCAAACTATGAATTTCGGGG - Intronic
1135876069 16:26201171-26201193 GCATCAACGTATGAATTTTGGGG + Intergenic
1136927890 16:34391471-34391493 GTTTCAACATATGAATTTTGGGG - Intergenic
1136976684 16:35020335-35020357 GTTTCAACATATGAATTTTGGGG + Intergenic
1137857215 16:51806980-51807002 GCTTCAACATATGAATTTTGAGG + Intergenic
1138011057 16:53380512-53380534 GCTTCAACATATGAATTTTGGGG - Intergenic
1138051291 16:53781471-53781493 TCTTCCACCACTGAATGTGGTGG - Intronic
1138120250 16:54395538-54395560 GCTTCGACATATGAATTTTGGGG + Intergenic
1138315487 16:56066114-56066136 TCTTCCACCCATGACTTCTGTGG - Intergenic
1138377173 16:56572592-56572614 GCTTCAACATACGAATTTTGAGG - Intergenic
1138545973 16:57719987-57720009 ACTTCAACCTATGAATTTTAGGG + Intronic
1138751207 16:59423465-59423487 GCTTCCAGCAATGAACATTTGGG + Intergenic
1138896034 16:61205891-61205913 GTTTCAACCCATAAATTTTGGGG - Intergenic
1140178613 16:72690900-72690922 GCTTCAACATCTGAATTTTGAGG + Intergenic
1140451780 16:75076702-75076724 GCTTCAACACATGAATTTTGGGG - Intronic
1140568046 16:76067094-76067116 GCTTCAACATATGAATTTTGGGG - Intergenic
1140650413 16:77082048-77082070 GTTTCAACATATGAATTTTGGGG + Intergenic
1140694051 16:77514203-77514225 ACTTCAACCTATGACTTTTGAGG + Intergenic
1140771949 16:78213398-78213420 GCTTTCACCAATGGATTGTGGGG - Intronic
1140826664 16:78713440-78713462 GCTTCATCACATGAATTTTGGGG - Intronic
1140886487 16:79249009-79249031 GCTTCAGCATATGAATTTTGGGG - Intergenic
1141062606 16:80887900-80887922 GCTTCAACATATGAATTTGGGGG + Intergenic
1141231580 16:82172029-82172051 ACTTCAACATATGAATTTTGGGG - Intergenic
1141687877 16:85580643-85580665 GCTTCCACATCTGAATTTGGGGG - Intergenic
1141978905 16:87537286-87537308 GCTTCAACATATGAATTTTAGGG + Intergenic
1142032697 16:87846451-87846473 GCTTCCACGTCTGAGTTTTGGGG - Intronic
1143002741 17:3805361-3805383 GCTTCAACATATGAATTTGGAGG - Intergenic
1143194416 17:5064613-5064635 GCTTCGACATATAAATTTTGGGG - Intergenic
1143277634 17:5723531-5723553 GTTTCAACATATGAATTTTGGGG + Intergenic
1143535940 17:7539590-7539612 GGTTCCAAAAATGATTTTTGTGG + Intergenic
1143713178 17:8747800-8747822 GTTTCAACATATGAATTTTGAGG - Intergenic
1143715109 17:8762035-8762057 GTTTCAACATATGAATTTTGGGG - Intergenic
1143790891 17:9294716-9294738 GCTTCAACATATGAATGTTGGGG - Intronic
1143978527 17:10847774-10847796 GCTTCAACCTATGAATTTGGGGG - Intergenic
1144043621 17:11434952-11434974 ACTTCAACATATGAATTTTGAGG - Intronic
1144156629 17:12510330-12510352 GCCTCAACATATGAATTTTGGGG + Intergenic
1144274214 17:13649410-13649432 GCTTCAACACATGAATTTTGGGG + Intergenic
1144441541 17:15287042-15287064 ACTTCAACATATGAATTTTGTGG + Intergenic
1145712118 17:26987600-26987622 GCTTCAACATATGAATTGTGGGG - Intergenic
1146461290 17:33047953-33047975 GCTTCAATATATGAATTTTGGGG - Intronic
1146501470 17:33368521-33368543 TCTTACACCACTGGATTTTGGGG + Intronic
1147273628 17:39296019-39296041 GTTTTCACCAATGCATCTTGAGG + Intronic
1147353879 17:39875322-39875344 TCTACCAGCAATGCATTTTGTGG + Exonic
1147417073 17:40299851-40299873 GCTTCCCCAAATGACCTTTGAGG - Intronic
1147725598 17:42564534-42564556 GCTTCCGCCAGCGAATGTTGGGG + Exonic
1148171324 17:45523129-45523151 CCTACCTCTAATGAATTTTGAGG + Intergenic
1148278347 17:46326672-46326694 CCTACCTCTAATGAATTTTGAGG - Intronic
1148300558 17:46544527-46544549 CCTACCTCTAATGAATTTTGAGG - Intronic
1148364694 17:47045422-47045444 CCTACCTCTAATGAATTTTGAGG - Intronic
1148380866 17:47196067-47196089 GCTTCAACATATGAATTTTGAGG - Intergenic
1148923337 17:51060144-51060166 GCTTCAACCTATGAATTTGGGGG - Intronic
1148965265 17:51429591-51429613 GCTTCAATGTATGAATTTTGGGG + Intergenic
1149270471 17:54971574-54971596 GCTTCAACATATGGATTTTGGGG + Intronic
1149766630 17:59284306-59284328 GCTTACACATATGAATTTGGTGG + Intergenic
1150401946 17:64864729-64864751 CCTACCTCTAATGAATTTTGAGG + Intronic
1150474493 17:65464365-65464387 ACTTCAACATATGAATTTTGGGG + Intergenic
1151106987 17:71626504-71626526 GCTTCAACATATGAATTTTGAGG - Intergenic
1151138325 17:71968740-71968762 GCTTCTATGTATGAATTTTGGGG - Intergenic
1151355262 17:73554304-73554326 ACTTCAACAGATGAATTTTGGGG - Intronic
1151512844 17:74571872-74571894 GCTTCCACATATGAATTTTTGGG - Intergenic
1151643647 17:75414798-75414820 GCTTCAACATATGGATTTTGGGG - Intergenic
1151949995 17:77346782-77346804 GCTCCAACATATGAATTTTGGGG - Intronic
1152256311 17:79241962-79241984 GCTTCCATATAGGAATTTTGGGG + Intronic
1152771134 17:82170093-82170115 GCTTCAACCCGTAAATTTTGGGG - Intronic
1153001522 18:459683-459705 GCTTCCACCATTGAAGCTTCTGG - Intronic
1153508319 18:5826607-5826629 CCGTCCATCAATGAATTTGGTGG + Intergenic
1153637360 18:7124246-7124268 GCTTCAACACATGAATTTGGGGG + Intergenic
1153663737 18:7349733-7349755 ACTTCAACATATGAATTTTGAGG + Intergenic
1153808001 18:8726650-8726672 GCTTCCACATATGAATTTGGGGG + Intronic
1153840290 18:9001270-9001292 GCTTCAACATATGAAGTTTGAGG - Intergenic
1153906136 18:9662854-9662876 GTTTCAACTTATGAATTTTGGGG + Intergenic
1154053541 18:10988020-10988042 GTTTCAACATATGAATTTTGGGG - Intronic
1155233404 18:23795846-23795868 GCTTCAACATATGAATTTTTAGG - Intronic
1155433469 18:25786684-25786706 ACTTCAACATATGAATTTTGGGG - Intergenic
1155437939 18:25832646-25832668 GTTTCAACATATGAATTTTGGGG - Intergenic
1155508700 18:26555610-26555632 ACTTGGACAAATGAATTTTGTGG + Intronic
1156034990 18:32756054-32756076 GCTTCAACACATGAATTTGGAGG - Intronic
1156071996 18:33222642-33222664 GTTTCAACATATGAATTTTGGGG + Intronic
1156241314 18:35257364-35257386 ACTTCAACATATGAATTTTGGGG - Intronic
1156260881 18:35444211-35444233 GCTTCAACATATGAATTTTGGGG + Intronic
1156399781 18:36729759-36729781 GCTTCAACTTATGAATTTTGAGG + Intronic
1156556151 18:38070309-38070331 GCTTCAACATATGAATGTTGGGG + Intergenic
1156618199 18:38814162-38814184 GCTAACACAAAGGAATTTTGAGG - Intergenic
1156820537 18:41367223-41367245 GTTTCAACGTATGAATTTTGAGG - Intergenic
1157889851 18:51405277-51405299 GTTCCAACAAATGAATTTTGGGG - Intergenic
1157946992 18:51991520-51991542 GCTTCCACAGATGAATTTGAAGG + Intergenic
1158018727 18:52815228-52815250 GCTTCAACACATGTATTTTGAGG - Intronic
1158041306 18:53097961-53097983 GCTTCAACGTATCAATTTTGAGG + Intronic
1158212796 18:55069392-55069414 GTTCCAACCTATGAATTTTGGGG + Intergenic
1158261292 18:55608892-55608914 CCTTCAACACATGAATTTTGAGG - Intronic
1158687247 18:59625757-59625779 GTTTCAACACATGAATTTTGGGG - Intronic
1158703091 18:59766806-59766828 GTTTCAACATATGAATTTTGGGG - Intergenic
1158727538 18:59987241-59987263 GTTTCAACCTATGAATTTGGAGG - Intergenic
1158789214 18:60755815-60755837 GCTTTAACAAATTAATTTTGAGG - Intergenic
1158840923 18:61386211-61386233 GTTTTCACATATGAATTTTGAGG - Intronic
1158871102 18:61689067-61689089 GCTTCAACGTATGAATTTTGGGG - Intergenic
1158902066 18:61973223-61973245 GCTTCAACATATGAATTCTGGGG + Intergenic
1158949311 18:62477490-62477512 GTTTCAACATATGAATTTTGGGG - Intergenic
1159220912 18:65461833-65461855 GCTTCAACATATGAATTTTAGGG + Intergenic
1159326868 18:66931679-66931701 GCTTCAATTTATGAATTTTGCGG + Intergenic
1159438228 18:68445512-68445534 GCTTTAACATATGAATTTTGGGG - Intergenic
1159534901 18:69703777-69703799 GTTTCAACATATGAATTTTGGGG - Intronic
1159694874 18:71543795-71543817 TTTTTCAGCAATGAATTTTGAGG + Intergenic
1159844978 18:73448247-73448269 GCTTCAACGTATGAATTTAGAGG - Intergenic
1160060562 18:75525586-75525608 ACTTCAACACATGAATTTTGGGG + Intergenic
1160082520 18:75742442-75742464 GCTTCAACATATGAATTTTGAGG + Intergenic
1160135428 18:76267227-76267249 GCTTCCACTAATGGTTCTTGAGG - Intergenic
1160242929 18:77136070-77136092 GCTTTGACATATGAATTTTGGGG + Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1161804418 19:6434241-6434263 GCTTCAACATAAGAATTTTGCGG - Intergenic
1162270141 19:9607813-9607835 GCTTCAACATATGAATTTTCAGG - Exonic
1162282304 19:9709016-9709038 GCTTCAACAAATGAATTTTGGGG - Intergenic
1162508124 19:11100031-11100053 GTGTCCTCCACTGAATTTTGGGG + Intronic
1162609983 19:11741829-11741851 GTTCTCACCTATGAATTTTGAGG + Intergenic
1162834006 19:13304210-13304232 GCTTCAACTCATGAATTTGGAGG - Intronic
1162838455 19:13337613-13337635 ACTTCAACATATGAATTTTGGGG + Intronic
1163212158 19:15849021-15849043 GCTTCAACACATGAATTTTTGGG + Intergenic
1163855772 19:19701033-19701055 GGTCCCACCAATGTATTTGGTGG + Intergenic
1163871547 19:19825392-19825414 GGTCCCACCAATGTATTTGGTGG - Intergenic
1163885475 19:19961154-19961176 GGTCCCACCAATGTATTTGGCGG - Intergenic
1163897075 19:20068642-20068664 GGTCCCACCAATGTATTTGGTGG - Intergenic
1163934999 19:20434581-20434603 GGTCCCACCAATGTATTTTGTGG - Intergenic
1163935620 19:20440533-20440555 GGTCCCACCAATGTATTTGGTGG + Intergenic
1163938111 19:20469263-20469285 GGTCCCACCAATGTATTTGGTGG + Intergenic
1163949232 19:20568642-20568664 GGTCCCACCAATGTATTTGGTGG - Intronic
1164427746 19:28157522-28157544 GCTTCAATATATGAATTTTGAGG - Intergenic
1164464429 19:28475540-28475562 GTTTCAACCTATGAATTTTGGGG - Intergenic
1164502538 19:28831815-28831837 ACTTCCACAGATGAATTTGGGGG + Intergenic
1165171710 19:33897003-33897025 GCCTTCACATATGAATTTTGGGG - Intergenic
1165609836 19:37141841-37141863 GCTTCAACCTCTGAATTTTGGGG + Intronic
1166036492 19:40171911-40171933 GCTTCCACATATGAATTTGGGGG + Intergenic
1166574599 19:43826011-43826033 GCTTCCACCAGTGGTTTTGGAGG + Intronic
1166583524 19:43924990-43925012 GCTTCAACATAAGAATTTTGAGG - Intronic
1166922008 19:46235051-46235073 ACTTCAACACATGAATTTTGCGG - Intergenic
1166968779 19:46548029-46548051 GCTTCAACATATGAATTTTGGGG - Intronic
1167201406 19:48067945-48067967 GCTTCCACATATGACTTTGGTGG - Intronic
1167715343 19:51139368-51139390 ATTTCAACAAATGAATTTTGAGG + Intergenic
1167759437 19:51435859-51435881 GCTTCAACATATGAATTTTGGGG + Intergenic
1168474478 19:56665999-56666021 GCTTCCATGTATAAATTTTGAGG - Intronic
925067616 2:940707-940729 GCTTCAACATATGAATTTGGGGG + Intergenic
925492605 2:4411510-4411532 GCTTCAACATAAGAATTTTGAGG + Intergenic
925586507 2:5470030-5470052 GCTTCAACATATGAACTTTGGGG - Intergenic
925781015 2:7381996-7382018 GCTTCCACATAGGAATTTTGGGG + Intergenic
925793312 2:7515507-7515529 GCTTCCTCCACTGTAGTTTGGGG + Intergenic
925797806 2:7565695-7565717 GCTTCAACCTATGAATTTTGAGG + Intergenic
925824473 2:7833949-7833971 ACTTCAACACATGAATTTTGAGG - Intergenic
925916714 2:8612184-8612206 ACTTCAACATATGAATTTTGGGG - Intergenic
925957947 2:8986644-8986666 GCTTCAACATATGAATTTTGGGG - Intronic
926273454 2:11385621-11385643 GCTTCAACATATGAATTTTGGGG + Intergenic
926319185 2:11736547-11736569 GTTTCAACAGATGAATTTTGGGG + Intronic
926352473 2:12008794-12008816 GCTTTGACATATGAATTTTGGGG + Intergenic
926419755 2:12685182-12685204 ACTTCAACATATGAATTTTGGGG - Intergenic
926427037 2:12747409-12747431 GTTTCAACATATGAATTTTGAGG + Intergenic
926513656 2:13813501-13813523 ACTACCACCTTTGAATTTTGTGG + Intergenic
926608586 2:14922690-14922712 GCTTCTACCTGTGAATTTTAGGG + Intergenic
926612085 2:14956879-14956901 ACTTCAACATATGAATTTTGGGG - Intergenic
926798342 2:16637271-16637293 GCTCCAACCTATGAATTTAGGGG - Intronic
926963472 2:18385192-18385214 GCTTCCACAGATGAAGTTGGTGG - Intergenic
927066375 2:19475310-19475332 GCTTCAACATATGAATTTGGGGG - Intergenic
927189123 2:20504553-20504575 GCTTCAACATATGAATTTTAGGG + Intergenic
927307258 2:21587995-21588017 GCTTCAACACATGAATTCTGGGG - Intergenic
927370965 2:22354948-22354970 GCTTCAACATATGAATTTTGGGG - Intergenic
927451172 2:23210747-23210769 CCTTCAACATATGAATTTTGGGG - Intergenic
927461852 2:23306232-23306254 ACTTCAACACATGAATTTTGGGG - Intergenic
928340186 2:30436092-30436114 GCTACCACATATGAATTTGGTGG + Intergenic
928926087 2:36580724-36580746 ACTTCAACACATGAATTTTGGGG - Intronic
929029526 2:37637442-37637464 GCTTCAACATATGAATTTTAAGG + Intergenic
929236698 2:39612611-39612633 GTTTCAACATATGAATTTTGGGG + Intergenic
929632267 2:43475751-43475773 GCTTACAGGAATGAATTTTATGG + Intronic
929985813 2:46731146-46731168 GTTTCAACATATGAATTTTGGGG - Intronic
930000752 2:46860037-46860059 GCTTCCACATATGGGTTTTGGGG - Intergenic
930287004 2:49443310-49443332 GTTTCAACATATGAATTTTGAGG - Intergenic
930313461 2:49770853-49770875 GCTTCAACATATGAATTTTGGGG - Intergenic
930334851 2:50032594-50032616 GTTTCAACCTATGAATTTTCCGG - Intronic
930603507 2:53468956-53468978 GCTTCAACACATGAATTTGGGGG + Intergenic
930851715 2:55968282-55968304 GCTTCCACTCATGAATTGTCAGG - Intergenic
930866313 2:56125595-56125617 GTTTCCACATATGAATTTTCGGG - Intergenic
930903537 2:56537278-56537300 GCTTCAGCATATGAATTTTGAGG + Intergenic
930992941 2:57682626-57682648 GTTTCAACCTAAGAATTTTGGGG - Intergenic
931105756 2:59053461-59053483 GCTTCAACATATGAATTTTAGGG + Intergenic
931229951 2:60365704-60365726 GCTTCCACCCATGAAATGTGGGG + Intergenic
931425070 2:62163234-62163256 GCTTCAACATATGAATTTAGGGG + Intergenic
931788386 2:65641983-65642005 GCCTCAACCTATGAATCTTGGGG - Intergenic
931883397 2:66590168-66590190 ACTTCAACACATGAATTTTGAGG - Intergenic
932170544 2:69551544-69551566 GCTGCCACCAGTGATGTTTGAGG - Intronic
932254042 2:70268400-70268422 GTTTCAACCTATGAATTTTGGGG - Intronic
932869395 2:75381916-75381938 GCTTCAACAAATGAATTTTAGGG - Intergenic
933094343 2:78159413-78159435 TCTTCAACATATGAATTTTGGGG + Intergenic
933196131 2:79392100-79392122 GCTCCAACATATGAATTTTGTGG + Intronic
933211953 2:79580360-79580382 GCTTCCACCACTGCATTCTTTGG - Intronic
933321248 2:80778147-80778169 GCTTCCACCAAGGAAAACTGAGG - Intergenic
933431007 2:82179094-82179116 GCTTCAACATATGAATTTTAGGG - Intergenic
933440641 2:82309237-82309259 GCTTCCATCAATGAATACTCAGG - Intergenic
933522148 2:83387853-83387875 GATTCAACATATGAATTTTGGGG - Intergenic
933894901 2:86801865-86801887 CCCCCCACAAATGAATTTTGTGG - Intronic
933943634 2:87266041-87266063 GCTTCAACATATGCATTTTGGGG + Intergenic
934075380 2:88423812-88423834 GCTTCAACATACGAATTTTGGGG + Intergenic
934154239 2:89180442-89180464 GCTTCAACTGGTGAATTTTGAGG + Intergenic
934212993 2:90001496-90001518 GCTTCAACTGGTGAATTTTGAGG - Intergenic
934973760 2:98786039-98786061 ACTTCCACATATGAATTTTGAGG + Intergenic
935048080 2:99499494-99499516 CCTTCCACTCATGACTTTTGAGG + Intergenic
935090834 2:99893390-99893412 GCTTCAACTTGTGAATTTTGAGG - Intronic
935154221 2:100468253-100468275 GCTTCAACCTATGAATTGTGGGG + Intergenic
935240689 2:101175536-101175558 GTTTCAACATATGAATTTTGGGG - Intronic
935660800 2:105465272-105465294 GCTTCAACATATGAATTTTGAGG + Intergenic
935788464 2:106570131-106570153 GTTTCAACATATGAATTTTGGGG - Intergenic
936140511 2:109936065-109936087 ACTTCAACACATGAATTTTGAGG - Intergenic
936159827 2:110076477-110076499 GCTTCAACATATGAATTTGGGGG + Intergenic
936177202 2:110234010-110234032 ACTTCAACACATGAATTTTGAGG - Intergenic
936184838 2:110294876-110294898 GCTTCAACATATGAATTTGGGGG - Intergenic
936204183 2:110435421-110435443 ACTTCAACACATGAATTTTGAGG + Intronic
936336587 2:111595538-111595560 GCTTCAACATATGCATTTTGGGG - Intergenic
937131549 2:119517861-119517883 GCTTCAACATATGAATTTAGTGG - Intronic
937138577 2:119577313-119577335 GCTTCCACATATGAATTTTGAGG + Intronic
937438474 2:121897907-121897929 TCTTCCACCAAAGAATTTTGGGG + Intergenic
937493637 2:122395374-122395396 GCTTCAACATATGAATTTGGTGG + Intergenic
937589284 2:123594034-123594056 GCTTCAACATATGAATTTTGTGG - Intergenic
938042480 2:128087083-128087105 TTTTCCACCATTGAGTTTTGAGG - Intergenic
938152688 2:128900901-128900923 ACTTCAACGTATGAATTTTGGGG - Intergenic
938171202 2:129078478-129078500 GCTTCAACATATGAATTCTGAGG + Intergenic
938373539 2:130789320-130789342 GCTTCCACCTATGATTTTGGGGG - Intergenic
938721350 2:134069807-134069829 GCTTCAACATATGAATTTTGGGG - Intergenic
938797493 2:134730671-134730693 GCTTCAACATATGAATTTTGTGG - Intergenic
938974747 2:136465440-136465462 GTTTCAACACATGAATTTTGGGG + Intergenic
939174181 2:138730425-138730447 ACTTCAACATATGAATTTTGGGG + Intronic
939259203 2:139784894-139784916 ACTTCCACACAGGAATTTTGAGG + Intergenic
939329681 2:140740950-140740972 ACTTCAACAAATGAATTTTGAGG + Intronic
939877747 2:147597301-147597323 ATTTCAACCTATGAATTTTGGGG - Intergenic
939956778 2:148533976-148533998 GCTTCAACATAGGAATTTTGGGG + Intergenic
940048405 2:149434964-149434986 GCTTCAACATATGAATTTTGGGG - Intronic
940069492 2:149669734-149669756 GTTTCAACATATGAATTTTGGGG - Intergenic
940158358 2:150683430-150683452 GCTTCCACATATGAATTTAGAGG + Intergenic
940159092 2:150692534-150692556 GTTTCAACGTATGAATTTTGAGG - Intergenic
940322197 2:152389461-152389483 GTTTCAACCTATGAATTTTGAGG + Intronic
940448158 2:153803266-153803288 GCTTCAACATATAAATTTTGGGG - Intergenic
940477849 2:154189301-154189323 GCTTCCACATATGAATTTTGGGG - Intronic
940486123 2:154297352-154297374 GCTTCAATACATGAATTTTGTGG - Intronic
940609678 2:155973437-155973459 GCTTCAACAAATGAATTTTGGGG + Intergenic
940781996 2:157942690-157942712 GTTTCAACACATGAATTTTGGGG - Intronic
940794267 2:158060624-158060646 GCTTCAACATACGAATTTTGAGG - Intronic
941075810 2:161005255-161005277 GCTTGCACCACTTAGTTTTGGGG + Intergenic
941254517 2:163211798-163211820 ACTTCAACATATGAATTTTGAGG + Intergenic
941305459 2:163859609-163859631 ACTTCCACCATTGAATTGTGGGG - Intergenic
941313350 2:163961737-163961759 GTTTCAACCTATGAATTTGGAGG + Intergenic
941482515 2:166034669-166034691 GCTTCAGCATATGAATTTTGTGG - Intronic
941595859 2:167476125-167476147 ACTTCAACCTATGAATTTAGGGG + Intergenic
941789274 2:169533828-169533850 GTTTCAACAGATGAATTTTGGGG - Intronic
941857744 2:170247857-170247879 ATTTCAACCTATGAATTTTGAGG + Intronic
941939380 2:171018039-171018061 GCTTCAATATATGAATTTTGAGG - Intronic
942065922 2:172271291-172271313 ATTTCCACCCAAGAATTTTGGGG + Intergenic
942216723 2:173728530-173728552 GGTTCAACATATGAATTTTGGGG - Intergenic
942226792 2:173823570-173823592 GCTTCAACGTATGAATTTTGTGG + Intergenic
942674242 2:178410924-178410946 GCTTCAACATAGGAATTTTGTGG + Intergenic
942772537 2:179539387-179539409 ACTTCAACATATGAATTTTGAGG + Intronic
942842674 2:180381405-180381427 GCTTCAGTCAATGAATTCTGGGG - Intergenic
942992890 2:182222992-182223014 GCTTCAACACATGAATTTTAGGG - Intronic
943195601 2:184744342-184744364 GTTTCAACATATGAATTTTGGGG - Intronic
943467155 2:188241936-188241958 ATTTCCACAAATGAATTTGGGGG - Intergenic
943489281 2:188530277-188530299 GCTTCAACATGTGAATTTTGGGG + Intronic
943661661 2:190565700-190565722 ACTTCAACATATGAATTTTGGGG - Intergenic
943856652 2:192802403-192802425 GCTTCATCATATGAATTTTGGGG + Intergenic
943888580 2:193255928-193255950 GCTTCAACATTTGAATTTTGGGG - Intergenic
944041172 2:195356925-195356947 CCTTCAACATATGAATTTTGGGG - Intergenic
944087428 2:195865712-195865734 GCTTCAACATAAGAATTTTGGGG - Intronic
944294682 2:198048861-198048883 GTTTCAACATATGAATTTTGGGG + Intronic
944631543 2:201631076-201631098 GCTTCAACATATGAATTTTTGGG - Intronic
944786050 2:203071478-203071500 GCTTCCACATATTAATTTTGGGG + Intronic
945374682 2:209066337-209066359 GCTTCAACATATGAGTTTTGAGG - Intergenic
945558958 2:211314432-211314454 GTTTCAACCTATGAATTTTGGGG - Intergenic
945626184 2:212209613-212209635 GCTTCAGCATATGAATTTTGGGG - Intronic
945657785 2:212646306-212646328 GACTCCACCACTGAATTTAGGGG - Intergenic
945764793 2:213962069-213962091 GCTTCAACACATGAACTTTGAGG - Intronic
945772663 2:214063625-214063647 GTTTCAACATATGAATTTTGGGG + Intronic
946095973 2:217274429-217274451 GCTTCAACCTATGGATTTTGGGG + Intergenic
946104295 2:217355685-217355707 GCTTCAACCCAGGAATTTGGGGG - Intronic
946315985 2:218912859-218912881 ACTTCGACACATGAATTTTGGGG - Intergenic
946319992 2:218947407-218947429 GCCTCAACAAATGAATTTTGGGG + Intergenic
946449001 2:219763811-219763833 GCTTCAACATATGAATTTAGGGG - Intergenic
946566184 2:220968121-220968143 ACTTCAACAAATGAATGTTGGGG + Intergenic
946667787 2:222068777-222068799 TCTTCAACATATGAATTTTGGGG + Intergenic
946742256 2:222814272-222814294 GCTTCAACATATGAATATTGAGG + Intergenic
946793155 2:223321679-223321701 ATTTCCATCACTGAATTTTGCGG - Intergenic
947031564 2:225801608-225801630 GGTTCAACGTATGAATTTTGGGG + Intergenic
947133213 2:226951276-226951298 GCTGCCACAGGTGAATTTTGAGG + Intronic
947157071 2:227173003-227173025 GCTTCAACCTAGGAATTTAGAGG + Intronic
947385929 2:229590512-229590534 GATTTCACCCATGAATTTAGAGG - Intronic
947883507 2:233543485-233543507 GTTTCAACGTATGAATTTTGGGG - Intronic
947919917 2:233861004-233861026 GCTTCAACATATAAATTTTGGGG + Intergenic
947943957 2:234083694-234083716 GCTTCAACATATGAATTTTGAGG + Intergenic
947985188 2:234441591-234441613 GTTTCAACATATGAATTTTGTGG + Intergenic
948235029 2:236381022-236381044 GCTTCAACTCATGAGTTTTGGGG - Intronic
948259252 2:236590718-236590740 GCTTCAAAATATGAATTTTGGGG + Intergenic
948261258 2:236606068-236606090 GCTTCAGCATATGAATTTTGGGG + Intergenic
948410556 2:237756570-237756592 GCTTCAACAGATGAATTTAGAGG + Intronic
948436455 2:237956867-237956889 GCTTCAACATATGAATTTCGAGG - Intergenic
948439990 2:237980575-237980597 GCTTCAACATATGAATTTGGGGG + Intronic
949013123 2:241693323-241693345 GCTTCAACACAGGAATTTTGAGG + Intergenic
1168930412 20:1618893-1618915 GCTTCAACACATGCATTTTGTGG - Intronic
1168938078 20:1685274-1685296 GCTTCAACACATGCATTTTGGGG - Intergenic
1169062176 20:2668875-2668897 GCTTCCACCAGTGGTTTTGGAGG + Intergenic
1169296711 20:4406250-4406272 GTTTCAACATATGAATTTTGGGG + Intergenic
1169409941 20:5359776-5359798 GTTTCAACATATGAATTTTGGGG + Intergenic
1169495951 20:6115519-6115541 GCTTGGATCAATAAATTTTGGGG + Intronic
1169685190 20:8263008-8263030 GCTTCAACAAATGAATTTGGGGG + Intronic
1169773820 20:9230311-9230333 GCTTCAACATATGAAATTTGAGG + Intronic
1169839557 20:9920037-9920059 ACTTCAACAAATGAATTTGGAGG + Intergenic
1170020068 20:11827665-11827687 GTTTCAACCTATGAATTTGGAGG - Intergenic
1170051580 20:12151381-12151403 GCTTCAACTTACGAATTTTGAGG + Intergenic
1170184505 20:13573234-13573256 GTTTCAAACTATGAATTTTGGGG - Intronic
1170184865 20:13577465-13577487 GTTTCAACAAATGAATTTTTGGG - Intronic
1170237746 20:14126429-14126451 GATTCAACATATGAATTTTGGGG + Intronic
1170259976 20:14393760-14393782 GCTTCAACACATGAATTCTGGGG - Intronic
1170336062 20:15271400-15271422 GTTTCAACCTATGAATTTTGTGG + Intronic
1170343735 20:15358928-15358950 GCTTCAAGATATGAATTTTGGGG + Intronic
1170663051 20:18361368-18361390 GCTTCAACGTATGAATTTGGGGG - Intergenic
1170723127 20:18901658-18901680 GCTTCAACCTATGAATTTGATGG + Intergenic
1170946794 20:20898640-20898662 GTTTCAACATATGAATTTTGAGG - Intergenic
1171199310 20:23228313-23228335 GCTTCAACATATAAATTTTGGGG - Intergenic
1171394827 20:24825254-24825276 GTTTCAACATATGAATTTTGGGG + Intergenic
1171395606 20:24831007-24831029 GCTTCAACATATGAATTTTGTGG - Intergenic
1172141941 20:32729033-32729055 GCTTCAATATATGAATTTTGGGG - Intronic
1172246813 20:33451171-33451193 GCTTGAACCCAGGAATTTTGAGG - Intergenic
1172839766 20:37895556-37895578 GCTTCCACATATGAATCTGGGGG - Intergenic
1172999554 20:39095785-39095807 ACTTCAACCTATGAATTTTGGGG + Intergenic
1173019540 20:39255551-39255573 ACTTCAACGTATGAATTTTGGGG + Intergenic
1173057064 20:39624963-39624985 ACTTCAACATATGAATTTTGTGG + Intergenic
1173190321 20:40870983-40871005 GCTTCAACATATGAATTTGGGGG + Intergenic
1173204752 20:40984022-40984044 GCTTCAACATATTAATTTTGGGG - Intergenic
1173321664 20:41992705-41992727 GTTTCAACATATGAATTTTGGGG + Intergenic
1173432984 20:43008125-43008147 ATTTCAACCTATGAATTTTGAGG - Intronic
1173456770 20:43208932-43208954 GTTTCAACATATGAATTTTGAGG - Intergenic
1173480356 20:43393737-43393759 GCTTCAAAATATGAATTTTGCGG - Intergenic
1173498791 20:43537560-43537582 GCTTCAGCATATGAATTTTGCGG + Intronic
1173955333 20:47027953-47027975 GCTTCAACATATGAATTTTAGGG - Intronic
1174304119 20:49603117-49603139 ACTTCAACATATGAATTTTGAGG - Intergenic
1174662353 20:52224481-52224503 GCTTCAACGTATGAATTTAGGGG + Intergenic
1174856717 20:54052489-54052511 GTTTCAACATATGAATTTTGGGG - Intronic
1174866325 20:54139539-54139561 GCTCCAACATATGAATTTTGGGG + Intergenic
1174920392 20:54696108-54696130 GCTTCAATCAATGTATTTTGGGG - Intergenic
1175546375 20:59780611-59780633 GCTTCAACATAGGAATTTTGGGG + Intronic
1176452913 21:6880007-6880029 GCTTCAATATATGAATTTTGGGG - Intergenic
1176831086 21:13745055-13745077 GCTTCAATATATGAATTTTGGGG - Intergenic
1176884666 21:14241290-14241312 GCTTCAACATATGAATTTTGTGG - Intergenic
1176890514 21:14312280-14312302 ACTTCAACATATGAATTTTGGGG - Intergenic
1177103350 21:16922722-16922744 GCTTCAACCCATGAATTTGGGGG - Intergenic
1177160323 21:17540264-17540286 GATTCAACATATGAATTTTGGGG + Intronic
1177170007 21:17644574-17644596 GCTTCAACATATGAATTTTGGGG + Intergenic
1177209962 21:18059016-18059038 GCTTTAACCTATGAATTTGGGGG - Intronic
1177274463 21:18890704-18890726 GCTTCAATATATGAATTTTGAGG + Intergenic
1177535280 21:22419397-22419419 GTTTCAACACATGAATTTTGGGG - Intergenic
1177732361 21:25043950-25043972 GCTTCAACATATGAATTTTCAGG + Intergenic
1177749014 21:25256756-25256778 GTTTCAACAAATGAATTTGGGGG + Intergenic
1177781998 21:25631719-25631741 GGTTCAACATATGAATTTTGAGG + Intergenic
1177834721 21:26175259-26175281 GCTTCAACATATGAATTTTGGGG + Intergenic
1177849502 21:26329721-26329743 ACTTCAACATATGAATTTTGGGG + Intergenic
1178041558 21:28645618-28645640 GTTTCCACATATGAATTTTGGGG - Intergenic
1178160747 21:29911568-29911590 GTTTCAACACATGAATTTTGAGG - Intronic
1178475442 21:32933551-32933573 GCTTCAACATATGAATTTTGGGG - Intergenic
1178604251 21:34021442-34021464 GCTTCAACATATAAATTTTGAGG + Intergenic
1178773200 21:35524968-35524990 GCTTCAACATGTGAATTTTGGGG - Intronic
1178995221 21:37393079-37393101 TTTTCAACAAATGAATTTTGGGG + Intronic
1179065489 21:38020798-38020820 GCTTCAACATATGAATTTGGGGG + Intronic
1179070230 21:38064351-38064373 ACTTTAACAAATGAATTTTGGGG + Intronic
1179173519 21:38991227-38991249 GCTTCAACATATTAATTTTGTGG - Intergenic
1179174213 21:38995727-38995749 GCTTCAGCCTATGGATTTTGGGG + Intergenic
1179900783 21:44392691-44392713 GCTTCAACATATGAATTTTAGGG + Intronic
1179972399 21:44843480-44843502 GCTTCAACCCATGGGTTTTGGGG - Intergenic
1180036477 21:45252852-45252874 GCTTCAACATATGAATTTTGGGG - Intergenic
1180044255 21:45295888-45295910 GCTTCAACACAGGAATTTTGGGG + Intergenic
1180748404 22:18108205-18108227 GCTTTAACACATGAATTTTGGGG + Intronic
1180928602 22:19573666-19573688 GTTTCAACACATGAATTTTGGGG + Intergenic
1180989793 22:19928635-19928657 GCTTCCACATAGGGATTTTGAGG - Intronic
1181349330 22:22244169-22244191 GCTTCAACCTATGGATTTGGGGG + Intergenic
1181389165 22:22567026-22567048 GTTTCAACATATGAATTTTGGGG + Intergenic
1182100907 22:27656576-27656598 GTTTCAACATATGAATTTTGTGG - Intergenic
1182108972 22:27709389-27709411 GTTTCAACATATGAATTTTGGGG + Intergenic
1182233257 22:28855069-28855091 GCTTCAACATATGAATCTTGGGG + Intergenic
1182788996 22:32933098-32933120 ACTTCAACATATGAATTTTGGGG + Intronic
1182842307 22:33401224-33401246 GCTTCAACAGATGAATTTGGAGG - Intronic
1182847695 22:33445262-33445284 GCTCCCACATATGAATTTTGGGG + Intronic
1182955160 22:34417569-34417591 GTTTCCACCTCTGAATTTTGAGG + Intergenic
1182969343 22:34557789-34557811 ACTTCAACATATGAATTTTGGGG + Intergenic
1183004674 22:34891170-34891192 ATTTCAACAAATGAATTTTGGGG + Intergenic
1183176989 22:36231620-36231642 GCTTCAGCATATGAATTTTGGGG - Intronic
1183181241 22:36261420-36261442 GCTTCAGCATATGAATTTTGGGG + Intronic
1183252371 22:36739131-36739153 GCTTCAACATATGAATTTTTGGG - Intergenic
1183338221 22:37263132-37263154 GCTTCAACATATGAATTTTAGGG - Intergenic
1184125120 22:42481482-42481504 GGTTCAACAGATGAATTTTGGGG - Intergenic
1184133330 22:42530943-42530965 GTTTCAACAGATGAATTTTGGGG - Intergenic
1184145009 22:42604839-42604861 GCTTCAACAGAGGAATTTTGGGG - Intronic
1184295913 22:43525403-43525425 GCTTTCAACAAAAAATTTTGAGG - Intergenic
1184456605 22:44614399-44614421 GCTTCAACATATGAATTTGGGGG - Intergenic
1184543669 22:45150184-45150206 GCTTCAATATATGAATTTTGGGG - Intergenic
1184925919 22:47637323-47637345 GCTTCAGCATATGAATTTTGGGG - Intergenic
1185201769 22:49511349-49511371 ATTTCAACAAATGAATTTTGGGG - Intronic
949208195 3:1466081-1466103 GTTTCAACATATGAATTTTGGGG - Intergenic
949237858 3:1832211-1832233 GTTTCAACATATGAATTTTGAGG + Intergenic
949406124 3:3716543-3716565 ACTTCCATAAATGAATTTCGGGG + Intronic
949908246 3:8877478-8877500 GTTTCAACACATGAATTTTGGGG + Exonic
950166812 3:10807102-10807124 GCTTCAACATATGAATTTTAGGG + Intergenic
950268071 3:11589930-11589952 GCTTCCACACGAGAATTTTGAGG + Intronic
950472389 3:13194194-13194216 GCTTCAGCCTATGAATTTGGGGG + Intergenic
950837917 3:15938429-15938451 GCTTCAATATATGAATTTTGGGG - Intergenic
950945746 3:16944418-16944440 ACTTCAACAGATGAATTTTGAGG - Intronic
951515241 3:23551837-23551859 GCTTCAACATATTAATTTTGGGG - Intronic
951634679 3:24760155-24760177 GCTTCAACATATGAATTTTAGGG + Intergenic
951690447 3:25390079-25390101 GTTTCAACATATGAATTTTGGGG - Intronic
952111877 3:30133584-30133606 GCTTCAACATATGAATTTTCGGG + Intergenic
952216609 3:31284434-31284456 GCTTCAACGCATGAATTTTAGGG - Intergenic
952579206 3:34811162-34811184 GCTTCAACATACGAATTTTGAGG - Intergenic
952683326 3:36121324-36121346 GTTTCAACATATGAATTTTGTGG - Intergenic
953298474 3:41747555-41747577 GCTTCAACATATGAATTTTGGGG - Intronic
953468756 3:43148803-43148825 GTTTCAACATATGAATTTTGGGG - Intergenic
953616192 3:44492883-44492905 GCTTCAACATATGAATTTTGGGG - Intergenic
953713176 3:45292438-45292460 GCTTCAACATATAAATTTTGAGG + Intergenic
953719691 3:45344581-45344603 GCTTCAACGTATGAATTTGGGGG - Intergenic
954001537 3:47561218-47561240 GCTTCAACATATGGATTTTGGGG - Intergenic
954091969 3:48292126-48292148 GCTTCAACATATGAATTTTAGGG + Intronic
954790754 3:53131504-53131526 GCTTCAACATATGAATTTTGAGG - Intergenic
954919729 3:54179571-54179593 GCTTCAACATATGAATTTTGAGG - Intronic
955050540 3:55406465-55406487 CTTTCAACAAATGAATTTTGGGG - Intergenic
955716768 3:61837686-61837708 GCTTTCACTGATCAATTTTGAGG + Intronic
956006435 3:64783508-64783530 GCTTCAACATATGAATTTGGGGG - Intergenic
956143891 3:66172975-66172997 GCTTCAACATATGAATTTGGAGG + Intronic
956148469 3:66216160-66216182 GTTTCTACACATGAATTTTGGGG + Intronic
956183597 3:66541609-66541631 GCTTCAACCTGTGAATTTTGGGG + Intergenic
956196719 3:66660521-66660543 GTTTCAACAAGTGAATTTTGGGG - Intergenic
956379163 3:68647688-68647710 GCTTAAACATATGAATTTTGGGG - Intergenic
956881813 3:73518879-73518901 GTTTCAACCCATGAATGTTGTGG + Intronic
956903470 3:73741226-73741248 GATTCAACCTATAAATTTTGGGG + Intergenic
957511491 3:81194203-81194225 GCTTCAATATATGAATTTTGGGG + Intergenic
957684770 3:83488034-83488056 ACTTCAACAAATGAATTTCGGGG - Intergenic
958132766 3:89450452-89450474 GCTTCAAATAATGCATTTTGGGG - Intronic
958469111 3:94496090-94496112 ACTTCCACGTATGAATTTTGAGG - Intergenic
958573600 3:95918545-95918567 GCTTCAGCAAATGCATTTTGGGG - Intergenic
958621134 3:96562687-96562709 GCTTCAGCCTATGAATTTGGGGG - Intergenic
958657572 3:97021802-97021824 GTTTCAACCTATGCATTTTGGGG + Intronic
958824733 3:99016693-99016715 GCTTCAACACATGAATTTTGAGG + Intergenic
958950634 3:100411855-100411877 GCTTCAACATATGGATTTTGGGG + Intronic
959047676 3:101492497-101492519 GCTTCAACATATGAATTTTGGGG - Intronic
959193256 3:103142635-103142657 GTTTCAACATATGAATTTTGGGG - Intergenic
959513985 3:107245037-107245059 CCTTCAACATATGAATTTTGGGG + Intergenic
959807872 3:110579474-110579496 GCTGCCACCAAAAAAATTTGAGG - Intergenic
959808278 3:110585546-110585568 GCTTCAACCTAAAAATTTTGGGG - Intergenic
959988517 3:112603936-112603958 GCTTCCTCCAATGAAGTCTTGGG - Intergenic
960678147 3:120217569-120217591 GCTTCAACATATGAATTTGGGGG + Intronic
960809711 3:121616023-121616045 ACTTCCACATATGAATTTGGGGG + Intronic
960843212 3:121981346-121981368 GCTTCAACATATGAATTTGGGGG - Intergenic
960850630 3:122049685-122049707 GTTTCAACCCATGAATTTTTGGG - Intergenic
961007824 3:123416646-123416668 GCTTCAACAGAGGAATTTTGGGG - Intronic
961251893 3:125514143-125514165 GTTTCAACATATGAATTTTGGGG + Intronic
961352128 3:126310831-126310853 ACTTCAACACATGAATTTTGGGG + Intergenic
961476888 3:127152600-127152622 GCTTCCACATATGAATTAGGGGG + Intergenic
962164462 3:133034455-133034477 GTTTCAACATATGAATTTTGGGG + Intergenic
962169062 3:133081481-133081503 GCTTCAACATATGAATTTGGGGG + Intronic
962353066 3:134669865-134669887 GTTTCAACATATGAATTTTGAGG - Intronic
962484967 3:135833423-135833445 GCTTCAACACATGAATTTTGAGG + Intergenic
962770502 3:138606843-138606865 GTTTCAACATATGAATTTTGGGG + Intergenic
963059729 3:141215484-141215506 GTTTCCACATTTGAATTTTGGGG + Intergenic
963370621 3:144395132-144395154 GCTTCAACATATGAAGTTTGAGG + Intergenic
963435882 3:145265636-145265658 GTTTCAACATATGAATTTTGAGG + Intergenic
963526730 3:146424396-146424418 GCTTCAACATATGAATTTTTGGG + Intronic
963575298 3:147053304-147053326 GCTTCAACATATGAATTTTGGGG - Intergenic
963654587 3:148029577-148029599 ACTTCAACACATGAATTTTGGGG + Intergenic
964253438 3:154747323-154747345 GTTTCAACATATGAATTTTGAGG - Intergenic
964399930 3:156288308-156288330 GCTTCAACACATGAATTTGGAGG + Intronic
964828892 3:160860957-160860979 GCTTCAATATATGAATTTTGGGG + Intronic
964881854 3:161431747-161431769 GTTTCAACACATGAATTTTGGGG + Intergenic
964971485 3:162568538-162568560 GCTTCAACGTAAGAATTTTGAGG + Intergenic
965156872 3:165071575-165071597 GCTTCAACATATGAATTTCGGGG - Intronic
965356055 3:167674287-167674309 GTTTCAACATATGAATTTTGAGG - Intergenic
965410161 3:168320340-168320362 ACTTCAACATATGAATTTTGGGG - Intergenic
965561924 3:170070074-170070096 GCTTCAACATATGAATTTGGGGG + Intronic
965655935 3:170984954-170984976 GCTTCAACAAATGAATTTTGGGG - Intergenic
965676854 3:171206676-171206698 TCATCCACTAATGAGTTTTGAGG + Intronic
965835540 3:172847798-172847820 GTTTCAACATATGAATTTTGGGG - Intergenic
965957316 3:174386687-174386709 ATTTCAACCTATGAATTTTGGGG + Intergenic
966077316 3:175953290-175953312 GCTTCAACATATGAATTTTGGGG - Intergenic
966263010 3:178002396-178002418 GTTTCAACATATGAATTTTGAGG + Intergenic
966301992 3:178489524-178489546 ACTTCAACATATGAATTTTGAGG + Intronic
966535881 3:181033111-181033133 GCTTCAACATATGAATTTTGAGG + Intergenic
966774502 3:183532064-183532086 GTTTCAACATATGAATTTTGTGG - Intronic
967127982 3:186443010-186443032 GTTTCAACATATGAATTTTGGGG + Intergenic
967268832 3:187716296-187716318 ACTTCAACGTATGAATTTTGTGG - Intronic
967543802 3:190699841-190699863 GCTTTCATTTATGAATTTTGAGG - Intergenic
967667373 3:192189472-192189494 GCTTCAACAAAAAAATTTTGGGG - Intronic
967772798 3:193353519-193353541 GCTTCAACCTATGAATTTAGAGG - Intronic
967849145 3:194069512-194069534 GCTTCAACCTATGGCTTTTGGGG - Intergenic
967855041 3:194111029-194111051 GCTTCAATATATGAATTTTGGGG - Intergenic
967911212 3:194544133-194544155 GCTTCAACATATGAGTTTTGGGG - Intergenic
968265165 3:197357074-197357096 GTTTCCCCCTGTGAATTTTGGGG - Intergenic
968496705 4:922061-922083 GCTTCCGCAGATGCATTTTGGGG - Intronic
968527251 4:1067190-1067212 GCTTCAACATATGAATTTTGGGG + Intronic
968822957 4:2869541-2869563 GCTTCAACATGTGAATTTTGGGG + Intronic
968975326 4:3819260-3819282 GCTTCAACCTAGGAATTCTGGGG + Intergenic
969076605 4:4583764-4583786 GTTTCAACACATGAATTTTGTGG + Intergenic
969077289 4:4590130-4590152 GCTTCAACACATGAAATTTGTGG + Intergenic
969176873 4:5405434-5405456 GTTTCAACCTTTGAATTTTGTGG - Intronic
970155871 4:13141380-13141402 GTTCCCACATATGAATTTTGGGG - Intergenic
970172706 4:13305437-13305459 GCTTCAACACATGAATTTTGAGG + Intergenic
970173656 4:13314593-13314615 GCCTCCACATATGAATTTTAAGG + Intergenic
970246596 4:14070839-14070861 ACCTCAACAAATGAATTTTGGGG - Intergenic
970291097 4:14573192-14573214 ACTTCAACATATGAATTTTGGGG - Intergenic
970326532 4:14930764-14930786 GCTTCAACATATGAATTTTGAGG - Intergenic
970347243 4:15164456-15164478 GCTTCCACATAAGAATTTTGGGG - Intergenic
970367234 4:15372190-15372212 GCTTCAACACATGAATTTTGGGG - Intronic
970551504 4:17186194-17186216 GCTTCAACGTATGAATTTAGGGG + Intergenic
970719065 4:18965024-18965046 GCTTCAACATATGAATTTGGTGG - Intergenic
970719347 4:18968185-18968207 ATTTCAACCTATGAATTTTGGGG - Intergenic
970836617 4:20416470-20416492 ACTTCAACATATGAATTTTGGGG + Intronic
970858598 4:20676330-20676352 GCTTCGACATATGAATTTAGGGG + Intergenic
970872067 4:20827556-20827578 ACTTCAACATATGAATTTTGAGG + Intronic
970882757 4:20950949-20950971 GCTTCAATATATGAATTTTGGGG - Intronic
971159607 4:24120607-24120629 GTTTCAACATATGAATTTTGGGG - Intergenic
971210688 4:24613125-24613147 GTTTCAACAAAGGAATTTTGGGG - Intergenic
971228670 4:24779340-24779362 GCTTCAACATACGAATTTTGGGG - Intergenic
971597647 4:28552201-28552223 GTTTCAACATATGAATTTTGGGG - Intergenic
971603013 4:28619738-28619760 GTTTCCACATAAGAATTTTGTGG + Intergenic
971658938 4:29386993-29387015 GCTTCAACATATGAATTTTGGGG + Intergenic
971739061 4:30497592-30497614 GCTTTAACATATGAATTTTGAGG + Intergenic
971785657 4:31099083-31099105 GCTTCAACATAGGAATTTTGAGG + Intronic
971800719 4:31286472-31286494 GCTTCAACATATGAATTTTAGGG + Intergenic
971982370 4:33769192-33769214 GCTTCAACATATGAATTTTGAGG - Intergenic
971993301 4:33929756-33929778 GATAGCAACAATGAATTTTGTGG + Intergenic
972262341 4:37422104-37422126 GCTTCAACATAGGAATTTTGAGG + Intronic
972268224 4:37483352-37483374 GCTGCAACATATGAATTTTGTGG + Intronic
972332669 4:38078459-38078481 GCTTCAACATAGGAATTTTGGGG - Intronic
972349676 4:38225119-38225141 GTTTCCACATATGACTTTTGGGG + Intergenic
972465234 4:39349279-39349301 GCTTCAACGTGTGAATTTTGGGG - Intronic
972554842 4:40171519-40171541 ACTTCAACATATGAATTTTGGGG - Intergenic
972745688 4:41930401-41930423 GCTTTGACATATGAATTTTGGGG - Intergenic
972749557 4:41974411-41974433 GCTTCAACATAGGAATTTTGTGG + Intergenic
972863459 4:43201434-43201456 GCTTCAACACGTGAATTTTGTGG - Intergenic
972969219 4:44551585-44551607 GCTTCAACGTATGAATTTGGGGG + Intergenic
973063205 4:45755815-45755837 GATTCAACAAATGAATTTTTTGG + Intergenic
973073335 4:45893368-45893390 GTTTCAACATATGAATTTTGGGG + Intergenic
973139676 4:46750961-46750983 GCTTCAAATTATGAATTTTGGGG + Intronic
973297733 4:48544236-48544258 CCTTCCAGCAAAGAATTTTCTGG - Intronic
973345336 4:49048790-49048812 GCTTCAACAAATGAATTTTGGGG + Intronic
973719396 4:53707817-53707839 ACTTCAACACATGAATTTTGGGG + Intronic
973724930 4:53765655-53765677 GCTTCAACATATGAATTGTGGGG - Intronic
973755289 4:54067925-54067947 GCTTCAACATATGAATTTGGGGG - Intronic
973805100 4:54518152-54518174 GCTTCAACATATGAATTTTGGGG - Intergenic
973836428 4:54814215-54814237 GCTTCAACATATGAATTTTAGGG + Intergenic
974012101 4:56616404-56616426 ACTTCAACACATGAATTTTGTGG + Intergenic
974197369 4:58592861-58592883 GCTTCAACATATGAATTTTAGGG + Intergenic
974274043 4:59692142-59692164 GTTTCCATAAATTAATTTTGGGG + Intergenic
974278833 4:59763064-59763086 ACTTCTACATATGAATTTTGAGG - Intergenic
974825871 4:67129480-67129502 GCTTCAACACAAGAATTTTGGGG + Intergenic
974930808 4:68358981-68359003 GCTTCAACATATGAATTTGGGGG - Intergenic
975182669 4:71364706-71364728 GCTTCAACAGAAGAATTTTGGGG + Intronic
975259980 4:72286999-72287021 GTTTCAACAAAGGAATTTTGGGG - Intronic
975274913 4:72485740-72485762 GTTTCAACGTATGAATTTTGAGG - Intronic
975600401 4:76093890-76093912 GCTTCAACATATGAATTTTGGGG - Intronic
975704370 4:77097503-77097525 GCTTCAACATATGAATTTTGGGG - Intergenic
976008955 4:80463768-80463790 GCTTCAACCTATGAATTTTGGGG + Intronic
976028491 4:80721607-80721629 ACTTCAACATATGAATTTTGGGG + Intronic
976059187 4:81106696-81106718 GTTTCAACAAATGAATTTGGTGG - Intronic
976074500 4:81282130-81282152 GCTTCAATCTATGAATTTTGTGG - Intergenic
976166705 4:82263830-82263852 GTTTCAACATATGAATTTTGTGG + Intergenic
976309850 4:83600416-83600438 GCTTTAACATATGAATTTTGGGG + Intronic
976373170 4:84313821-84313843 GCTTCAACATATGAATTTGGTGG + Intergenic
976597112 4:86904866-86904888 GCTTCAACGAATGAATTTTGAGG - Intronic
976755795 4:88496866-88496888 GCTTCAAAATATGAATTTTGTGG - Intronic
976825007 4:89250531-89250553 GATTACACCAATAACTTTTGAGG - Intronic
977008500 4:91603993-91604015 GCTTCAACATATGAATTTGGGGG + Intergenic
977055631 4:92187081-92187103 ACTTCAACGTATGAATTTTGGGG + Intergenic
977360584 4:95999320-95999342 GCCTCAACATATGAATTTTGGGG + Intergenic
977605397 4:98979356-98979378 GTTTCAACAGATGAATTTTGTGG + Intergenic
977823348 4:101501990-101502012 GCTTTGACATATGAATTTTGGGG + Intronic
977900519 4:102417158-102417180 ACTTCAACCTATGAATTTGGAGG - Intronic
978025986 4:103874868-103874890 GCTTCAACATATGAATTTTGGGG + Intergenic
978084309 4:104631734-104631756 GTTTCAACATATGAATTTTGGGG + Intergenic
979086601 4:116418751-116418773 GCTTCAGCCTATAAATTTTGGGG - Intergenic
979098074 4:116576005-116576027 GCTTCAACATATGAATTTGGAGG - Intergenic
979446507 4:120820090-120820112 GTTTCAACGTATGAATTTTGGGG - Intronic
979522794 4:121687963-121687985 GTTTCAACATATGAATTTTGAGG - Intronic
979545582 4:121936559-121936581 GCTTCAACATATGAATTTTGTGG - Intronic
979804097 4:124949523-124949545 GCTTCAAGAATTGAATTTTGAGG - Intergenic
980287019 4:130792818-130792840 ACTTCAACATATGAATTTTGAGG - Intergenic
980447477 4:132929295-132929317 GCTTCAACATATGAATTTTGGGG + Intergenic
980492463 4:133545681-133545703 GTTTCAACATATGAATTTTGGGG + Intergenic
980560444 4:134465745-134465767 GCTTGAACAAGTGAATTTTGAGG + Intergenic
980719774 4:136680063-136680085 GCTTCCACATATGAATTTTAGGG + Intergenic
980842291 4:138278504-138278526 ACTTCAACATATGAATTTTGGGG - Intergenic
980852257 4:138396915-138396937 GTTTCAACATATGAATTTTGAGG - Intergenic
980879118 4:138691645-138691667 GTTTCAACACATGAATTTTGTGG - Intergenic
980905652 4:138946326-138946348 GCTTCAACATATAAATTTTGGGG - Intergenic
981147737 4:141344927-141344949 GCTTCAACATATGAATTTTGTGG - Intergenic
981271764 4:142853973-142853995 GCTTCAACATATGAATTCTGGGG + Intergenic
981308206 4:143268611-143268633 GGTTCCTCCCATGAAATTTGAGG - Intergenic
981507107 4:145514285-145514307 GCTTCCGCATATGAATTTTAGGG + Intronic
981570639 4:146147276-146147298 GCTTCAACACATTAATTTTGGGG - Intergenic
981719866 4:147790342-147790364 GTTTCAACATATGAATTTTGGGG + Intronic
981838895 4:149088171-149088193 GCTTCAACATATGAATTTTGTGG + Intergenic
981927792 4:150158371-150158393 GCTTCAACATATGAATTTTAGGG + Intronic
981959086 4:150513837-150513859 GCTTCAACATATAAATTTTGGGG + Intronic
982153670 4:152493523-152493545 GCTTCAACACGTGAATTTTGGGG - Intronic
982502334 4:156172596-156172618 GTTTCAACATATGAATTTTGAGG + Intergenic
982540771 4:156667610-156667632 ATTTCCACATATGAATTTTGTGG + Intergenic
982610584 4:157569293-157569315 ACTTCAACATATGAATTTTGGGG + Intergenic
982873899 4:160620191-160620213 GTTTCCACATATGAATTTTAGGG + Intergenic
983124243 4:163930935-163930957 GCTTCCACATATGAATTTGAGGG - Intronic
983259890 4:165444113-165444135 GCGTCAACATATGAATTTTGAGG + Intronic
983635069 4:169889632-169889654 GTTTCAACATATGAATTTTGGGG - Intergenic
983639977 4:169936123-169936145 GCTTCAGCATATGAATTTTGGGG + Intergenic
983711302 4:170720244-170720266 GGTTCAACATATGAATTTTGGGG - Intergenic
983953243 4:173667120-173667142 ACTTCAACCTTTGAATTTTGGGG - Intergenic
984056220 4:174932598-174932620 GTTTCAACATATGAATTTTGGGG + Intronic
984107257 4:175563912-175563934 GCTTCAACCTATGAATTTTGTGG - Intergenic
984282427 4:177687730-177687752 GCTTCCACATAAGAATTTGGGGG - Intergenic
984428156 4:179614379-179614401 GCTTCAACATATGAATTTCGCGG - Intergenic
984589556 4:181601824-181601846 GCTTCAACCTATGAATTTCAGGG + Intergenic
985067699 4:186139343-186139365 ATTTCAACCTATGAATTTTGGGG - Intronic
985175083 4:187192229-187192251 GCTTTCACATATGAATTTAGGGG - Intergenic
985213444 4:187621105-187621127 GCTTCCACGAATGACTCTTGTGG + Intergenic
985562516 5:596717-596739 GCTTCAACATGTGAATTTTGTGG + Intergenic
985715020 5:1452266-1452288 GCTTTAACCTATGAATTTGGGGG - Intergenic
985755833 5:1715927-1715949 ACTTCAACAAGTGAATTTTGCGG - Intergenic
985797636 5:1975030-1975052 GCTTCCAGCAAAGAAGTTTCAGG - Intergenic
986074207 5:4317990-4318012 GCGTCAACATATGAATTTTGTGG - Intergenic
986200607 5:5574968-5574990 GCTTCCACATATGAATTTTCAGG + Intergenic
986241918 5:5967822-5967844 GTTTCAACCTATGAATTATGAGG + Intergenic
986524482 5:8658675-8658697 GCTTCAACACATAAATTTTGAGG - Intergenic
986612527 5:9583940-9583962 GCTTCCAGCATTGATTTGTGTGG + Intergenic
986746767 5:10751591-10751613 ACTTCAACCTATGAATTTTGGGG - Intronic
986902340 5:12451950-12451972 GCTTCAGCCTATGAACTTTGAGG - Intergenic
986961733 5:13220937-13220959 GCTTCAACAAATGAATTTGGGGG + Intergenic
986977692 5:13411711-13411733 ACTTCAACATATGAATTTTGGGG - Intergenic
987107714 5:14656803-14656825 ACTTCAACATATGAATTTTGGGG + Intergenic
987393364 5:17397789-17397811 GCTTCAACATATGAATTTGGGGG - Intergenic
987456075 5:18148452-18148474 GCCTCCACCTATGAAATATGAGG + Intergenic
987507236 5:18789452-18789474 ACTTCAACATATGAATTTTGTGG - Intergenic
987728043 5:21728558-21728580 GCTTCAACGTATGAATTTTGGGG - Intergenic
987749491 5:22020826-22020848 GCTTCAACATATGAATTTTGGGG + Intronic
987968381 5:24907827-24907849 CCTTCCACCATTCAATTTTTAGG - Intergenic
988005105 5:25400461-25400483 GCTTCAACATATGAATTTGGAGG + Intergenic
988108487 5:26781933-26781955 GCTTCAACATATGACTTTTGAGG + Intergenic
988320953 5:29696324-29696346 ACTTCAACATATGAATTTTGGGG - Intergenic
988452438 5:31356739-31356761 GCTGCAACATATGAATTTTGGGG + Intergenic
988503932 5:31805696-31805718 ACTTCAACAGATGAATTTTGGGG - Intronic
988653723 5:33183376-33183398 GCTTCAACATATGAATTTTGGGG + Intergenic
988781707 5:34528547-34528569 ACTTCAACATATGAATTTTGGGG - Intergenic
988786852 5:34573095-34573117 GTTTCCACACATGAACTTTGGGG - Intergenic
988801423 5:34699642-34699664 GCTTCAACATATGGATTTTGGGG + Intronic
989118368 5:37978587-37978609 ACTTCAACAAATGTATTTTGGGG + Intergenic
989360830 5:40599529-40599551 GCTTCAACATATGAATTTGGGGG + Intergenic
989369824 5:40694739-40694761 GCTTCAACAAATGAATTTTGGGG + Intergenic
989550799 5:42733972-42733994 GCTTCAACATATTAATTTTGAGG - Intergenic
989612003 5:43303227-43303249 GCTTCAACATATGAATTTGGTGG - Intronic
990076758 5:51855208-51855230 ACTTCAACAAATGAATTTTGGGG - Intergenic
990140725 5:52700026-52700048 GCTTCAACATATGAAGTTTGAGG + Intergenic
990160180 5:52929366-52929388 GTTTCAACACATGAATTTTGAGG + Intronic
990203645 5:53405979-53406001 ACTTCAACATATGAATTTTGGGG - Intergenic
990288273 5:54322626-54322648 GCTTCCACCATTGACTTTTAAGG + Intergenic
990344679 5:54860059-54860081 GCTTCAACATATGAATTTTGGGG + Intergenic
990697912 5:58443013-58443035 GTTTCCAACCATGAAATTTGGGG - Intergenic
990730882 5:58807755-58807777 GCTTCAACATATGAATTTGGGGG + Intronic
990746498 5:58964267-58964289 GTTACCACCACTGAATTTCGGGG + Intergenic
991021199 5:61981989-61982011 GCTTCAACATATGAATTTGGGGG - Intergenic
991086076 5:62649426-62649448 GCTTCAACATATGAATTATGGGG - Intergenic
991131441 5:63126632-63126654 ACTTCAACAAATGAATTTTTTGG + Intergenic
991218824 5:64188866-64188888 GCTTTAACATATGAATTTTGGGG - Intronic
991333933 5:65525628-65525650 GCTTCCACATATAAATTTTGGGG - Intronic
991357537 5:65784663-65784685 GTTTCAACACATGAATTTTGGGG + Intronic
991525441 5:67551963-67551985 GATTCAACATATGAATTTTGAGG + Intergenic
991621233 5:68547365-68547387 ACTTCAACATATGAATTTTGGGG + Intergenic
991671286 5:69050841-69050863 GTTTCAACATATGAATTTTGAGG - Intergenic
991929075 5:71733782-71733804 GTTTCAACATATGAATTTTGGGG + Intergenic
992070227 5:73141478-73141500 GCTTCAACCTATGAATTTAGGGG + Intergenic
992181896 5:74205662-74205684 GCTTCAACATATGAATTTTGGGG - Intergenic
992199968 5:74373466-74373488 TGTTCCACCAATAAATGTTGAGG + Intergenic
992330303 5:75710361-75710383 GCTTCAGCATATGAATTTTGAGG - Intronic
992491504 5:77248732-77248754 GCTTCAACACATGAATTTGGAGG - Intronic
992790438 5:80208897-80208919 ACTTCAACATATGAATTTTGGGG - Intronic
992882291 5:81122323-81122345 CCTTCCATTACTGAATTTTGGGG + Intronic
993193616 5:84710728-84710750 GTTTCAACACATGAATTTTGAGG - Intergenic
993204346 5:84861266-84861288 GTTTCAACATATGAATTTTGAGG - Intergenic
993453841 5:88104942-88104964 ATTTCAACAAATGAATTTTGGGG - Intergenic
993498876 5:88640769-88640791 ACTTCAACATATGAATTTTGAGG - Intergenic
993575400 5:89593070-89593092 GTTTCAACGTATGAATTTTGGGG + Intergenic
993708369 5:91196894-91196916 GCTTCAACAGATGAATTTGGGGG - Intergenic
993829565 5:92738431-92738453 GCTTCAACATATGACTTTTGAGG + Intergenic
993871174 5:93256244-93256266 ACTTCAACATATGAATTTTGGGG - Intergenic
993972866 5:94441485-94441507 GTTTCAACATATGAATTTTGAGG - Intronic
994209780 5:97074437-97074459 GCTTCAACATATGGATTTTGAGG - Intergenic
994285756 5:97964085-97964107 GTTTCAACATATGAATTTTGGGG - Intergenic
994311652 5:98279002-98279024 ACTTCAACATATGAATTTTGGGG + Intergenic
994465130 5:100117577-100117599 GCTTTCACATATGAATTTTGGGG - Intergenic
994759466 5:103835139-103835161 GCTTTCACATATGAATTTTTGGG - Intergenic
994759531 5:103835627-103835649 GTTTCAACAAATGAATTTGGGGG - Intergenic
994852634 5:105075518-105075540 GAAACCACCAAAGAATTTTGAGG - Intergenic
994913713 5:105945941-105945963 GCTTCAACATATAAATTTTGGGG - Intergenic
995294339 5:110501775-110501797 GCTTCAACCAGTGATTTTTGAGG - Intronic
995355224 5:111229483-111229505 GCTTCAACATGTGAATTTTGAGG + Intronic
995400769 5:111738738-111738760 ACTTCCCCATATGAATTTTGAGG - Intronic
995463109 5:112422785-112422807 GCTTCAACATATGAATTTTGAGG + Intergenic
995710186 5:115027302-115027324 GCTTACACCAGTGATTTGTGAGG - Intergenic
995921559 5:117320118-117320140 ACTTCAACATATGAATTTTGGGG + Intergenic
996050925 5:118932498-118932520 ACTTCAACATATGAATTTTGGGG - Intronic
996083238 5:119278003-119278025 GTTTCAACATATGAATTTTGAGG + Intronic
996212218 5:120825372-120825394 ACTTCCACATATGAATTTTGAGG - Intergenic
996369589 5:122739157-122739179 GCTTCAACATTTGAATTTTGAGG + Intergenic
996428307 5:123339561-123339583 GTTTCAACAAATGAACTTTGAGG + Intergenic
996469634 5:123844820-123844842 ACTTCAACATATGAATTTTGAGG - Intergenic
996475718 5:123918141-123918163 GCTTCAACATATGAATTTTGGGG + Intergenic
996531671 5:124533723-124533745 GCTTCAAGCCATGAAGTTTGTGG - Intergenic
996573554 5:124959206-124959228 GCTTCAACATATGAATTTGGTGG - Intergenic
996691044 5:126340433-126340455 GTTTCAACATATGAATTTTGAGG + Intergenic
996730436 5:126712553-126712575 GTTTCAACATATGAATTTTGTGG - Intergenic
996923738 5:128799182-128799204 GTTTCCATACATGAATTTTGGGG - Intronic
997230689 5:132240140-132240162 GCTTCAACATATGAATTTTGAGG - Intronic
997483014 5:134203671-134203693 ACTTAGACAAATGAATTTTGGGG + Intronic
997771870 5:136562664-136562686 GCTTCAACATATAAATTTTGGGG - Intergenic
997997305 5:138597111-138597133 GCTTCAACATACGAATTTTGGGG - Intergenic
998442020 5:142170553-142170575 GCTTCAACACATGAATTTGGGGG + Intergenic
998495390 5:142583905-142583927 GTTTCAACACATGAATTTTGGGG + Intergenic
998513068 5:142729733-142729755 ACTTCAACGTATGAATTTTGGGG + Intergenic
998851122 5:146351640-146351662 GCTTCAACATATTAATTTTGGGG + Intergenic
998871250 5:146554718-146554740 GTTTCAACACATGAATTTTGGGG + Intergenic
998986401 5:147762708-147762730 GCTTCAACATATGAATTTGGGGG + Intronic
999136613 5:149324451-149324473 GTTTCAACATATGAATTTTGGGG + Intronic
999360307 5:150979908-150979930 GCTTCAACATATGAATTTGGTGG - Intergenic
999848042 5:155506907-155506929 GCTTCAACATATGAATTTTAGGG - Intergenic
999980239 5:156951064-156951086 ACTTCAACATATGAATTTTGAGG - Intronic
1000017358 5:157289748-157289770 GCTTCAACCTATAAATTTGGGGG + Intronic
1000366024 5:160492176-160492198 GCTTCAACATATGAATTCTGGGG - Intergenic
1000524448 5:162339177-162339199 ACTTCAACATATGAATTTTGAGG - Intergenic
1000616184 5:163430188-163430210 GCTTCAACATATGAATTTTAGGG - Intergenic
1000632939 5:163611655-163611677 ACTTCTACATATGAATTTTGGGG + Intergenic
1001252972 5:170162640-170162662 GCTTCAACCCATGAATCTGGGGG - Intergenic
1001258484 5:170204348-170204370 ACTTCCATATATGAATTTTGAGG - Intergenic
1001581669 5:172802697-172802719 GCTTCCACATATGAATTTTGAGG - Intergenic
1001730297 5:173948939-173948961 GTTTCAACATATGAATTTTGAGG + Intronic
1001768675 5:174275903-174275925 GCTTCAACATATGAATTTGGGGG + Intergenic
1001965051 5:175904134-175904156 GTTTCAACGTATGAATTTTGGGG + Intergenic
1002167367 5:177356723-177356745 GTTTCAACGTATGAATTTTGGGG - Intergenic
1002251904 5:177935054-177935076 GTTTCAACGTATGAATTTTGGGG - Intergenic
1002365160 5:178704249-178704271 GTTTCAACACATGAATTTTGGGG - Intergenic
1002436853 5:179236842-179236864 GTTTCAACATATGAATTTTGGGG - Intronic
1002470334 5:179431182-179431204 ACTTCAACCTATGAATTTGGGGG + Intergenic
1002949174 6:1791565-1791587 GCTTCAACATATGAATTTTGGGG + Intronic
1003058646 6:2844574-2844596 GTTTCAACATATGAATTTTGGGG + Intergenic
1003149090 6:3533558-3533580 GCTTCAACATATGAATTTTGGGG + Intergenic
1003448276 6:6205282-6205304 GCTTCCACCATTAAACTATGAGG + Intronic
1003585031 6:7381134-7381156 GCTTCAGCATATGAATTTTGGGG - Intronic
1003651569 6:7966072-7966094 GCTTCAACACAGGAATTTTGGGG - Intronic
1003744181 6:8981067-8981089 GTTTCAACATATGAATTTTGGGG - Intergenic
1003779729 6:9411294-9411316 GTTTCAACACATGAATTTTGGGG - Intergenic
1003843384 6:10146551-10146573 ACTTCAACATATGAATTTTGGGG + Intronic
1003863452 6:10342652-10342674 GCTTCCACACATGAATTCTGGGG + Intergenic
1003898239 6:10628599-10628621 GCTCCAACACATGAATTTTGGGG - Exonic
1003906040 6:10700481-10700503 GTTTCAGCAAATGAATTTTGGGG + Intronic
1004061908 6:12205976-12205998 ACTTCCACACATAAATTTTGGGG - Intergenic
1004148797 6:13094879-13094901 GCTTCCACGTATGAATTTGTGGG - Intronic
1004267784 6:14164433-14164455 ACTTCAACCTATGAATTTTGGGG - Intergenic
1004281079 6:14280408-14280430 GCTTCCACATATGGATTCTGGGG + Intergenic
1004387731 6:15187095-15187117 GTTTCAACGTATGAATTTTGGGG - Intergenic
1004424486 6:15498081-15498103 GCTTCAACATATGAATTTGGAGG + Intronic
1004840193 6:19575359-19575381 GCTTCAACATATGAATTATGGGG + Intergenic
1005027074 6:21473558-21473580 GCTTCCACATATGAATTTTGGGG - Intergenic
1005036289 6:21558103-21558125 GTTTCCATATATGAATTTTGGGG - Intergenic
1005106815 6:22232724-22232746 ACTTCAACACATGAATTTTGAGG - Intergenic
1005198107 6:23312620-23312642 GCTTCAACATATGAATTTTGGGG - Intergenic
1005488156 6:26320803-26320825 GCTTCCACATATGAATTTAAGGG + Intergenic
1005788375 6:29270613-29270635 GCTTCAACATATGAATTTTGGGG + Intergenic
1005916040 6:30352450-30352472 GCTTCAACATATGAATTTTGGGG - Intergenic
1006953147 6:37842170-37842192 GTTCCAACAAATGAATTTTGGGG + Intronic
1007145381 6:39624894-39624916 GCTTCAACATATGAATTTGGAGG - Intronic
1007934790 6:45723356-45723378 GCTTCAACATATGAATATTGTGG - Intergenic
1007952473 6:45884624-45884646 GCTTCCATGACTGAATTCTGAGG - Intergenic
1008102395 6:47406048-47406070 GCTTCAACATATGAATTTTGAGG - Intergenic
1008529087 6:52437857-52437879 GGTTCAACATATGAATTTTGGGG + Intronic
1008841019 6:55904419-55904441 GCTTCCATATATGAATTTTGAGG + Intergenic
1009208323 6:60831911-60831933 GCTTAGAACAATGAAATTTGTGG - Intergenic
1009263526 6:61525738-61525760 GCTTCAACATATGAATTTTGAGG + Intergenic
1009298647 6:61986912-61986934 GATTCAACATATGAATTTTGAGG + Intronic
1009496850 6:64359852-64359874 GCTTGGACATATGAATTTTGAGG + Intronic
1009794065 6:68443274-68443296 GCTTCAACATATAAATTTTGAGG + Intergenic
1009841836 6:69087387-69087409 GTTTCAACATATGAATTTTGGGG - Intronic
1009897013 6:69764160-69764182 GCTTCAACATATGAATTCTGGGG - Intronic
1009966625 6:70585115-70585137 GCTCCAACAGATGAATTTTGGGG - Intronic
1010315014 6:74437782-74437804 GCTTCAACATGTGAATTTTGAGG + Intergenic
1010761910 6:79733381-79733403 GCTTCAACATAAGAATTTTGAGG + Intergenic
1010784997 6:79990929-79990951 GCTTCAACATATGAATTTTGGGG - Intergenic
1010870714 6:81034812-81034834 GCTTCAACCCATGAATTTCATGG - Intergenic
1011113602 6:83865717-83865739 ACTTCAACCTATGAATTTGGAGG + Intronic
1011284442 6:85707921-85707943 GTTTCAACACATGAATTTTGGGG - Intergenic
1011396754 6:86918440-86918462 GCTTCACCATATGAATTTTGGGG - Intergenic
1011451002 6:87491926-87491948 GCTTCAACATATGAATTTTAAGG + Intronic
1011529779 6:88309271-88309293 GTTTCTACATATGAATTTTGGGG - Intergenic
1011823733 6:91282164-91282186 GCTTCAACATATGAATTTTGTGG - Intergenic
1012030973 6:94062831-94062853 GCTTCAACATATGAATTATGGGG - Intergenic
1012054553 6:94389094-94389116 GTTTCAACATATGAATTTTGGGG + Intergenic
1012169145 6:95996895-95996917 ACTCCCACTAATGTATTTTGGGG + Intergenic
1012236865 6:96828399-96828421 GCTTCAGCATATGAATTTTGGGG + Intronic
1012412939 6:98980435-98980457 GATTCAACATATGAATTTTGGGG - Intergenic
1012580698 6:100866506-100866528 GAATCCACATATGAATTTTGAGG - Intronic
1012731847 6:102893146-102893168 TCTTCAACACATGAATTTTGGGG + Intergenic
1012760850 6:103298566-103298588 GTTTCAACCTATGAACTTTGGGG - Intergenic
1012847136 6:104404663-104404685 GCTTCAACATATGAATTTGGAGG + Intergenic
1012848709 6:104422213-104422235 GACTTCAACAATGAATTTTGAGG - Intergenic
1013035914 6:106382530-106382552 GCTTCTAAAAATGAATTTTTTGG + Intergenic
1013079572 6:106800667-106800689 GCTTCAACATATGAATTTTGAGG - Intergenic
1013158428 6:107517562-107517584 GCTTCAACATATGAATTTGGGGG + Intronic
1013224345 6:108109317-108109339 GTTTCAACATATGAATTTTGAGG + Intronic
1013250402 6:108327669-108327691 ACTTCAACATATGAATTTTGGGG + Intronic
1013263095 6:108466423-108466445 GCTTCAACCTGTGAATTTTGGGG - Intronic
1013320411 6:108982445-108982467 GCTTCAACATGTGAATTTTGGGG + Intergenic
1013538027 6:111081268-111081290 GCTTCAACATATGAATTTTGGGG + Intergenic
1013594080 6:111645431-111645453 GATTCCAACTATGAATTTGGGGG - Intergenic
1013710946 6:112897697-112897719 ATTTCAACAAATGAATTTTGGGG + Intergenic
1013756018 6:113462649-113462671 GCTTTCACATATGAATTTTTGGG - Intergenic
1013930412 6:115524206-115524228 GCTTCCACATATGAATTTTGGGG - Intergenic
1013995822 6:116306693-116306715 GCTTCAACATATAAATTTTGGGG - Intronic
1014493120 6:122087398-122087420 GGTTCAACATATGAATTTTGGGG - Intergenic
1014653074 6:124065394-124065416 GTTTCAACATATGAATTTTGGGG - Intronic
1014775779 6:125507961-125507983 GCTTCAACATATGAATTATGAGG - Intergenic
1014940995 6:127438190-127438212 GCTTCCTCTAAAGAATATTGTGG + Intergenic
1014993299 6:128109002-128109024 GCTTCAACATATGGATTTTGGGG + Intronic
1014995329 6:128135948-128135970 GCTTCAACGTACGAATTTTGGGG - Intronic
1015022281 6:128491021-128491043 GCTTCAACATATGAATTTTGGGG + Intronic
1015389386 6:132664154-132664176 GTTTGAACAAATGAATTTTGAGG - Intergenic
1015542280 6:134326967-134326989 GCTTTAACATATGAATTTTGGGG + Intergenic
1015597309 6:134878032-134878054 ACTTCAACAGATGAATTTTGAGG + Intergenic
1015678620 6:135779591-135779613 GCTTCAACATATGAATTTTGGGG + Intergenic
1015680707 6:135804852-135804874 GCTTCAACATATGAATTTTGGGG + Intergenic
1015839164 6:137457761-137457783 GCTCCAACATATGAATTTTGGGG + Intergenic
1016090257 6:139969296-139969318 ACTTCAACATATGAATTTTGGGG + Intergenic
1016115018 6:140270418-140270440 GCTTCAACATATGAATTTTGGGG - Intergenic
1016151009 6:140743635-140743657 GATTCAACATATGAATTTTGGGG - Intergenic
1016153014 6:140767652-140767674 GCTACAACATATGAATTTTGAGG - Intergenic
1016214322 6:141578577-141578599 GTTTCAACATATGAATTTTGAGG - Intergenic
1016353202 6:143190139-143190161 GTTTCAACATATGAATTTTGAGG + Intronic
1016359871 6:143255590-143255612 GCTTCACCATATGAATTTTGGGG + Intronic
1016605871 6:145925288-145925310 GCTTCAGCATATGAATTTTGGGG - Intronic
1016645688 6:146405821-146405843 GCTTCAATAGATGAATTTTGGGG + Intronic
1016667801 6:146663419-146663441 TCTTCCACCATGGAATTTTATGG - Intronic
1016736370 6:147484639-147484661 GCTTCAACATATAAATTTTGGGG + Intergenic
1016737577 6:147495700-147495722 GCTTCAACATATGAATTTTGGGG + Intergenic
1016796542 6:148123945-148123967 GCTTCAACCTAGGAATTTGGGGG + Intergenic
1016869362 6:148801453-148801475 GCTTCCAATTATGAATTTTCTGG + Intronic
1016911030 6:149199489-149199511 GCTTGAACAAATGAATTTTGCGG - Intergenic
1017346743 6:153391716-153391738 GTTTCAAACTATGAATTTTGGGG - Intergenic
1017780166 6:157709662-157709684 GCTTCAACCTATGAATTTGTGGG + Intronic
1017780336 6:157710834-157710856 GCTTCAACCTGTGAATTCTGGGG + Intronic
1017852378 6:158315935-158315957 GGTTTCAACATTGAATTTTGTGG + Intronic
1017941328 6:159055698-159055720 GCTTCCACACAGGAATTTTGGGG + Intergenic
1018031093 6:159842646-159842668 GTTTCCACCGATCAATGTTGTGG + Intergenic
1018126782 6:160690292-160690314 GCTTCAGCATATGAATTTTGGGG + Intergenic
1018149770 6:160926801-160926823 GCTTCAGCGTATGAATTTTGGGG - Intergenic
1018200232 6:161387741-161387763 GCTTCCACCTATCCATTATGTGG - Intronic
1018332208 6:162741644-162741666 GCTTCAACACATTAATTTTGGGG + Intronic
1018604343 6:165581270-165581292 GCTTCAACATATGAATTTTGGGG - Intronic
1018682781 6:166277727-166277749 GCTTCAACATGTGAATTTTGGGG - Intergenic
1018748196 6:166779375-166779397 GCTTCAACACAGGAATTTTGAGG - Intronic
1018759692 6:166881908-166881930 GTTTCAACCTATGAATTTGGTGG + Intronic
1018785308 6:167103521-167103543 GCTTCAACATATGAATTTTGGGG - Intergenic
1019085215 6:169469076-169469098 CCTTCCACATATAAATTTTGAGG + Intronic
1019326471 7:440874-440896 GCTTCCACCTATAAGTTTGGAGG + Intergenic
1020215035 7:6183739-6183761 GCTTCAACATATGAATTGTGGGG - Intronic
1020333736 7:7045129-7045151 GTTTCAACAAATGAATTTGGCGG + Intergenic
1020428442 7:8095285-8095307 GCTTCAACATATGAATTTGGTGG + Intergenic
1020449522 7:8305501-8305523 GCTTCAACATGTGAATTTTGGGG + Intergenic
1020654908 7:10917528-10917550 GCTTCAACATATGAATTTTGGGG - Intergenic
1020743604 7:12053530-12053552 GTTTCAACCTACGAATTTTGGGG - Intergenic
1020768277 7:12353402-12353424 GCTTCAACATATAAATTTTGGGG + Intronic
1021042155 7:15875468-15875490 GCTTCAACATATGAATTGTGAGG + Intergenic
1021050966 7:15984465-15984487 GCTTCAACATATGAATTTTTTGG - Intergenic
1021062437 7:16130794-16130816 GCTTCAACACAGGAATTTTGGGG - Intronic
1021152275 7:17166102-17166124 GCTTCAATATATGAATTTTGGGG + Intergenic
1021173752 7:17426112-17426134 GTTTCAACAAATGAATTTTGGGG - Intergenic
1021289315 7:18823560-18823582 GCTTCAACATATGAATTTTGGGG - Intronic
1021468194 7:20969713-20969735 GCTTCAACATATGAATTTTGGGG - Intergenic
1021567243 7:22027924-22027946 GCTTCAACATATGCATTTTGAGG - Intergenic
1021652396 7:22844823-22844845 GCTTCAACCTATGCATTTTGGGG + Intergenic
1021659161 7:22901549-22901571 GCTTCAACAAATGAATTTTGTGG - Intergenic
1021767501 7:23964530-23964552 GCTTCCACACGTGAATTTTAGGG + Intergenic
1022120261 7:27301562-27301584 GCTTCAACATATGAATCTTGGGG - Intergenic
1022156919 7:27669879-27669901 GTTTCCAGCTATCAATTTTGGGG + Intergenic
1022198852 7:28096049-28096071 GCTTCAACATATGAAATTTGGGG + Intronic
1022525726 7:31035788-31035810 GTTTCAACAAATGAATTCTGGGG + Intergenic
1022803222 7:33795355-33795377 GCTTCAACACATGAATTTTGGGG + Intergenic
1022822825 7:33978025-33978047 GTTTCAACCCATGAATTTTGGGG - Intronic
1022840844 7:34162432-34162454 GCTGACTCCAATGAATTTTCAGG + Intergenic
1023178182 7:37453853-37453875 GCTTCAACATACGAATTTTGGGG + Intergenic
1023194772 7:37623036-37623058 GCTTCAACAGATAAATTTTGGGG + Intergenic
1023368822 7:39491588-39491610 GTTTCAACACATGAATTTTGGGG - Intronic
1023508641 7:40926538-40926560 GCTTCAACATATAAATTTTGGGG - Intergenic
1023572650 7:41588428-41588450 GCTTCAACATATGAATTTGGTGG - Intergenic
1023884398 7:44342491-44342513 GTTTCAACCTATGAGTTTTGGGG - Intergenic
1024027445 7:45424650-45424672 GCTTCAACATATGAATTTTGGGG + Intergenic
1024214963 7:47240749-47240771 GCTTCCGCCTGTGAATTTTGGGG - Intergenic
1024449819 7:49526526-49526548 GCTTCCAAGCATGAATTTTAAGG - Intergenic
1024546889 7:50529844-50529866 GCTTCAACACATGAATTTTTGGG - Intronic
1024663235 7:51519841-51519863 GCTTCAACACAGGAATTTTGCGG - Intergenic
1024670471 7:51589437-51589459 GTTTCAACATATGAATTTTGGGG - Intergenic
1024770921 7:52722501-52722523 GTTTCAACATATGAATTTTGAGG + Intergenic
1024830701 7:53451907-53451929 GCTTCAACACATGAATCTTGAGG + Intergenic
1024904614 7:54362393-54362415 CCTTCAACACATGAATTTTGGGG + Intergenic
1024940899 7:54761902-54761924 GCTTCCACATATGAATTTGGAGG + Intergenic
1025121400 7:56307034-56307056 GTTTCTACCTATGAATTTTGGGG - Intergenic
1026098730 7:67367576-67367598 GCTTCAACATATGAATTCTGCGG - Intergenic
1026169405 7:67940674-67940696 GACTCAACAAATGAATTTTGAGG - Intergenic
1026330010 7:69343855-69343877 GCTTCAGCAAGTGAATTTTGGGG - Intergenic
1026686096 7:72511549-72511571 GCTTCAACATATGGATTTTGGGG - Intergenic
1027390951 7:77702980-77703002 GCTTCAACATATGGATTTTGGGG + Intronic
1027515647 7:79138576-79138598 GCTTCAACCTGTGAATTTTAGGG - Intronic
1027528257 7:79298664-79298686 ACTTCAACATATGAATTTTGGGG - Intronic
1027694103 7:81387240-81387262 GCTTCAACATATAAATTTTGAGG + Intergenic
1027992552 7:85380940-85380962 GTTTCAACATATGAATTTTGGGG + Intergenic
1028018506 7:85743497-85743519 CCTTCCACTCATGACTTTTGGGG - Intergenic
1028092965 7:86726011-86726033 GCTTCAACCTGTGAGTTTTGGGG + Intronic
1028369742 7:90077688-90077710 GCTTCAACATATGAATTTTGAGG - Intergenic
1028889943 7:95975638-95975660 ACTTCAACATATGAATTTTGGGG + Intronic
1029101080 7:98130503-98130525 GTTTCCACGTATGAATTTAGGGG - Intronic
1029570746 7:101367241-101367263 GCTTCAACATATGAATTTGGTGG - Intronic
1030027314 7:105337203-105337225 GCTTCAACATACGAATTTTGGGG - Intronic
1030264996 7:107611211-107611233 GTTTCAACATATGAATTTTGTGG + Intronic
1030318025 7:108136386-108136408 ACTTCCACATATGAATTTAGAGG - Intergenic
1030333245 7:108295630-108295652 GCTTCAACATATGAATTTTGGGG + Intronic
1030356663 7:108550872-108550894 GCTTCAACACATGAATTTTCAGG + Intronic
1030516485 7:110544706-110544728 ACTTCAACATATGAATTTTGAGG - Intergenic
1030542270 7:110845751-110845773 GCTTCATCATATGAATTTTGGGG - Intronic
1030753918 7:113266320-113266342 GCTTCAACATATAAATTTTGGGG - Intergenic
1030901074 7:115124556-115124578 GCTTCAACATATGAATTTGGGGG - Intergenic
1031274063 7:119695881-119695903 GCTTCAACATATGAATTTTGAGG - Intergenic
1031385579 7:121146395-121146417 GTTTCAACACATGAATTTTGGGG + Intronic
1031482455 7:122295543-122295565 GCATCAACAAATGAATTCTGAGG - Intergenic
1031609558 7:123808979-123809001 GTTTCAACATATGAATTTTGAGG + Intergenic
1031814589 7:126417798-126417820 GCTTCAACATATAAATTTTGGGG - Intergenic
1032009511 7:128334736-128334758 GCTTCAATGTATGAATTTTGGGG - Intronic
1032245468 7:130207490-130207512 GCTTCAACATATGAATTTTAGGG + Intronic
1032315132 7:130830456-130830478 GCTTCAACATATGAATATTGCGG + Intergenic
1032420720 7:131776981-131777003 ACTTCAACATATGAATTTTGGGG + Intergenic
1032531100 7:132621098-132621120 GCTTCAACATATGAATTTTAGGG + Intronic
1032546497 7:132748167-132748189 GCTTCAACCCATAAATTCTGGGG + Intergenic
1032797824 7:135291696-135291718 GCTTCAACATAAGAATTTTGGGG - Intergenic
1032889809 7:136182156-136182178 GTTTCAACATATGAATTTTGAGG + Intergenic
1032929860 7:136654032-136654054 GCTTCAACATATAAATTTTGGGG - Intergenic
1032946542 7:136860062-136860084 GCTTCCATCGATGTACTTTGGGG + Intergenic
1033272900 7:139948453-139948475 GCTTCAATGTATGAATTTTGAGG + Intronic
1033410207 7:141110727-141110749 GCTTCAACATATGAATTTTAGGG - Intronic
1033490169 7:141835518-141835540 GTTTCAACTTATGAATTTTGGGG + Intergenic
1033968086 7:147002884-147002906 GTTTCAACAAATAAATTTTGGGG + Intronic
1034104275 7:148477155-148477177 GCTTCAACATATGAATTTTGGGG - Intergenic
1034149619 7:148904152-148904174 TTTTCCAACAAGGAATTTTGGGG + Intergenic
1034986227 7:155517092-155517114 GCTTCAACATATGGATTTTGGGG - Intronic
1035117435 7:156536399-156536421 TCTTCCACCAAACAAATTTGAGG - Intergenic
1036035429 8:5013464-5013486 GCTTCAACATATGAATTTTGTGG - Intergenic
1036075868 8:5498909-5498931 GCTTCAACAGATAAATTTTGGGG + Intergenic
1036092692 8:5685316-5685338 GCTACTACCAATTAATTTTTTGG - Intergenic
1036186749 8:6629031-6629053 GCTTCAACCTATGAATTCTGGGG - Intronic
1036484573 8:9167580-9167602 ACTTCCACATATGAATTTTGGGG + Intronic
1036511126 8:9401332-9401354 GCTTCAACATATGAATTTGGGGG + Intergenic
1036608658 8:10330871-10330893 GCTTCAACATATGAATTTGGGGG - Intronic
1037024006 8:14009662-14009684 GCTTCAACACATGAATTTTGGGG - Intergenic
1037125007 8:15337606-15337628 GCTTCCACATATGAATTGTGGGG + Intergenic
1037660883 8:20925808-20925830 GCTTCAAGATATGAATTTTGGGG + Intergenic
1037749665 8:21672968-21672990 GTGTCCACATATGAATTTTGGGG + Intergenic
1037773370 8:21816503-21816525 GATTTCAGCAATGAAATTTGTGG - Intergenic
1038165736 8:25083631-25083653 ACTTCCACAAATAAATTTTGAGG - Intergenic
1038360521 8:26871253-26871275 GCTACAACATATGAATTTTGGGG - Intergenic
1038373746 8:27017009-27017031 GCTTCAACATATGAATTTGGGGG + Intergenic
1038375972 8:27040802-27040824 GCTTCAACATAGGAATTTTGGGG + Intergenic
1038376162 8:27042340-27042362 GCTTCAACATATAAATTTTGGGG - Intergenic
1038920740 8:32081281-32081303 GCTTCAACATATGCATTTTGAGG + Intronic
1039169576 8:34727650-34727672 ACTTCAACATATGAATTTTGAGG - Intergenic
1039208777 8:35187334-35187356 GCTTCAACATATGATTTTTGGGG + Intergenic
1039329920 8:36525718-36525740 GCTTCCAGGTATGAATTTTTGGG - Intergenic
1039415143 8:37386886-37386908 GGTTCAACAAATGCATTTTGTGG - Intergenic
1039417120 8:37405187-37405209 GCTTCAACATATAAATTTTGGGG - Intergenic
1039594121 8:38775680-38775702 GTTTTAACCTATGAATTTTGGGG + Intronic
1039631690 8:39119789-39119811 GATTCAACATATGAATTTTGAGG - Intronic
1039765510 8:40624109-40624131 GCTTCAACATATGAATTTTGGGG - Intronic
1040542677 8:48373996-48374018 GCTTCAATATATGAATTTTGGGG + Intergenic
1040623614 8:49118059-49118081 GCTTCCACGTATGAATTTTGGGG + Intergenic
1040704670 8:50111240-50111262 GCTTCAACATATGAGTTTTGGGG - Intronic
1040725163 8:50374023-50374045 GCTTCAACATATGAATTTTGGGG - Intronic
1040799128 8:51321888-51321910 GCTTCAACTTATGAATTTTGGGG - Intronic
1040822693 8:51582095-51582117 GCTTCAACATATGAATTTTGAGG - Intronic
1040869978 8:52090454-52090476 ACTTCAACATATGAATTTTGGGG + Intergenic
1040909341 8:52502418-52502440 GCTCCAACATATGAATTTTGAGG - Intergenic
1041049265 8:53917022-53917044 GCTTCAATTAATGAATTTTGTGG + Intronic
1041193515 8:55377134-55377156 GCCTCCTCCAGTGAGTTTTGAGG + Intronic
1041219593 8:55635826-55635848 GTTTTCACATATGAATTTTGTGG - Intergenic
1041316656 8:56570480-56570502 GCTTCAACATATGAATTTGGTGG - Intergenic
1041657126 8:60363994-60364016 GCTTCAGCATATGAATTTTGAGG + Intergenic
1041764517 8:61404350-61404372 GCTTTCACTAATGAATCTTTGGG - Intronic
1041775947 8:61522949-61522971 GCTTCAACATATGAATTTTGCGG + Intronic
1041940597 8:63382885-63382907 GTTTCAACATATGAATTTTGGGG - Intergenic
1042172767 8:66008534-66008556 ACTTCCACATATGAATTTTGGGG - Intergenic
1042191146 8:66188667-66188689 GCTTCAACATATGAATTTTGGGG - Intergenic
1042359856 8:67870093-67870115 GTTTCAACGTATGAATTTTGGGG + Intergenic
1042419598 8:68570061-68570083 GCTTCCAGCAAATTATTTTGAGG - Intronic
1042620950 8:70703590-70703612 GTTTCAACGTATGAATTTTGAGG + Intronic
1042621780 8:70714248-70714270 GCTTCAATGTATGAATTTTGGGG + Intronic
1042703959 8:71647114-71647136 GCTTCAAAATATGAATTTTGGGG + Intergenic
1042737890 8:72009305-72009327 GCTTCAACCTAAGAATTTTGGGG - Intronic
1043208322 8:77476142-77476164 GCTTCAACATATGAATTTTGGGG - Intergenic
1043276854 8:78408328-78408350 ACCTCCACATATGAATTTTGAGG - Intergenic
1043389300 8:79776701-79776723 GCTTCAACATATTAATTTTGGGG - Intergenic
1043406004 8:79933458-79933480 GCTTCAACATATAAATTTTGGGG + Intronic
1043487284 8:80710501-80710523 GCTTCAACATATGAATATTGTGG - Intronic
1043617865 8:82149361-82149383 ACTTCAACATATGAATTTTGGGG + Intergenic
1043664420 8:82790717-82790739 GCTTCAGTGAATGAATTTTGGGG - Intergenic
1043794636 8:84521055-84521077 GCTTCAATATATGAATTTTGAGG - Intronic
1043848056 8:85183798-85183820 CCTTCAACATATGAATTTTGGGG - Intronic
1044059301 8:87614918-87614940 GTTTCAACATATGAATTTTGGGG - Intronic
1044077885 8:87846051-87846073 GCTTCCACATATGAATTTTAGGG + Intergenic
1044100151 8:88125039-88125061 GCTTCAACCTGTGAATTTTGTGG + Intronic
1044116221 8:88337428-88337450 GCTTCAACATATGAATTTTGGGG + Intergenic
1044620485 8:94186610-94186632 GCTTCAACATATGAACTTTGTGG + Intronic
1044662432 8:94604668-94604690 GTTTCAACATATGAATTTTGGGG + Intergenic
1044875401 8:96660447-96660469 GCTTTAACGTATGAATTTTGGGG + Intronic
1044888791 8:96809883-96809905 GCTTCGAGTAATGAATTTTATGG + Intronic
1044937358 8:97305953-97305975 ATTTCAACCAATGAATTTGGAGG + Intergenic
1045434455 8:102147434-102147456 ACTTCCATGTATGAATTTTGGGG + Intergenic
1045640730 8:104247530-104247552 GCTTCAACATAAGAATTTTGGGG + Intronic
1045687696 8:104728511-104728533 GCTTCAATATATGAATTTTGAGG + Intronic
1045921676 8:107537509-107537531 GCTTCAACATTTGAATTTTGGGG - Intergenic
1045943228 8:107763852-107763874 ACTTCAGCCTATGAATTTTGAGG - Intergenic
1046403224 8:113735268-113735290 GCTTCAACATATGAATTTTGAGG + Intergenic
1046616312 8:116481326-116481348 GTTTCAACATATGAATTTTGTGG + Intergenic
1046728485 8:117699906-117699928 ACTTCAACATATGAATTTTGGGG - Intergenic
1046803254 8:118451931-118451953 GCTTCAACATGTGAATTTTGGGG - Intronic
1046852739 8:118993818-118993840 ACTTCAACATATGAATTTTGGGG + Intergenic
1046858565 8:119065075-119065097 ACTTCAACACATGAATTTTGAGG - Intronic
1047023013 8:120796410-120796432 ACTTCAACCTATGAATTTTGGGG + Intronic
1047144274 8:122179596-122179618 GTTTCAACATATGAATTTTGAGG - Intergenic
1047182413 8:122602288-122602310 GCTTCCTCATAGGAATTTTGGGG - Intergenic
1047226724 8:122961361-122961383 GCTTCAACATATGAATTTAGGGG + Intronic
1047323925 8:123818317-123818339 GTTTCAACATATGAATTTTGGGG + Intergenic
1047597428 8:126393131-126393153 CATTCAACCTATGAATTTTGGGG - Intergenic
1047896166 8:129368868-129368890 ACTTCAACATATGAATTTTGAGG - Intergenic
1047906335 8:129476991-129477013 GCTTCAACAAATGAATTTGGGGG - Intergenic
1048130145 8:131687272-131687294 GCTTACACATATGAATTTTCAGG - Intergenic
1048215263 8:132488158-132488180 GCTTCAATGTATGAATTTTGGGG + Intergenic
1048416007 8:134228652-134228674 GCTTCCATTTATGGATTTTGTGG + Intergenic
1048476731 8:134749580-134749602 GCTCCAACATATGAATTTTGGGG + Intergenic
1048547615 8:135402446-135402468 GCTTCAACACATGAATTTGGAGG + Intergenic
1048924544 8:139259817-139259839 GCTTCAGCGCATGAATTTTGGGG - Intergenic
1048932644 8:139327170-139327192 GCTTCAACATATGAATTTTGGGG - Intergenic
1048934391 8:139343051-139343073 GCTTCAACATATGAATTTTGGGG - Intergenic
1048944346 8:139430377-139430399 GCTTCAACATATGAATTTGGAGG + Intergenic
1049158185 8:141080004-141080026 GCTTCAACACATGAATTTTGGGG - Intergenic
1050025790 9:1333392-1333414 GCTTCAACACATGAGTTTTGGGG + Intergenic
1050185019 9:2964231-2964253 ACTTCAACATATGAATTTTGGGG - Intergenic
1050470499 9:5984064-5984086 TCTGCCAACAATGAATTCTGAGG - Intronic
1050639414 9:7651328-7651350 GCTTCAACAAATCAATTTTGAGG - Intergenic
1050645177 9:7711988-7712010 GTTTCAACCTATAAATTTTGGGG + Intergenic
1050916237 9:11137567-11137589 GCTTCAGCATATGAATTTTGGGG - Intergenic
1050934602 9:11379750-11379772 GCTTCAACATATGAATTTTGAGG + Intergenic
1051036914 9:12758460-12758482 GTTTTAACCAATGAAGTTTGGGG - Intergenic
1051166240 9:14265276-14265298 GCTTCAACATGTGAATTTTGGGG - Intronic
1051188417 9:14485162-14485184 GCTTCAACAAATGAATTTGGAGG + Intergenic
1051202404 9:14642463-14642485 GCTTCAACATAGGAATTTTGGGG - Intronic
1051700129 9:19813672-19813694 GTTTCAACATATGAATTTTGAGG - Intergenic
1051960509 9:22756132-22756154 GCCTCCACCAATGTATCTTTAGG + Intergenic
1052516385 9:29485998-29486020 GCTTCCATATATGAATTTTGGGG + Intergenic
1052624317 9:30955784-30955806 GCTTCAGCTTATGAATTTTGGGG - Intergenic
1052644377 9:31214125-31214147 GCTTCAAAATATGAATTTTGAGG + Intergenic
1053089852 9:35265175-35265197 GCTTCAACATATGAATTTGGAGG - Intronic
1053196999 9:36127206-36127228 GCTTCCACCTATGAACCTTTAGG - Intergenic
1053345445 9:37374832-37374854 ACTTCAACATATGAATTTTGGGG - Intergenic
1053348810 9:37397920-37397942 GCTTCAACCTATGAATTTTGGGG + Intergenic
1053532261 9:38894470-38894492 GTTTCAACAAATGAATTTTGGGG - Intergenic
1054204485 9:62118879-62118901 GTTTCAACAAATGAATTTTGGGG - Intergenic
1054633877 9:67469485-67469507 GTTTCAACAAATGAATTTTGGGG + Intergenic
1054777400 9:69135130-69135152 GCTTCAACATATGAATTTTGGGG + Intronic
1055176993 9:73331781-73331803 ACTTCCACATACGAATTTTGGGG + Intergenic
1055645782 9:78360078-78360100 GCTTCAACAGATGAATTTTGGGG + Intergenic
1055690473 9:78824628-78824650 GCTTCAACATATGAATTTAGCGG + Intergenic
1056100265 9:83294059-83294081 GTTTCAACAAATGAATTTTAAGG - Intronic
1056236171 9:84596974-84596996 GTTTCAACATATGAATTTTGGGG - Intergenic
1056298521 9:85218340-85218362 GCTTCAACATATGAATTTTGGGG - Intergenic
1056417165 9:86387998-86388020 ACTTCCACCAATCACTTTGGGGG - Intergenic
1056468882 9:86886131-86886153 GCTTCAACATATGAATTTTGGGG - Intergenic
1056626154 9:88255063-88255085 GCTCCAACAGATGAATTTTGGGG + Intergenic
1056958711 9:91103105-91103127 GCTTCAACATATGAATTTTGGGG - Intergenic
1057018608 9:91678285-91678307 ACTTCAACATATGAATTTTGGGG - Intronic
1057057438 9:91974452-91974474 GCTTCAACATATGAATTTTGGGG + Intergenic
1057151678 9:92801384-92801406 GTTTCAACAAATGAATTTTGGGG + Intergenic
1057811745 9:98262733-98262755 GCTTTAACAAATGAATTTAGAGG - Intergenic
1058414812 9:104776399-104776421 GCTTCAACATAGGAATTTTGGGG - Intronic
1059636103 9:116172205-116172227 GCTTCTACCACTGACTTGTGTGG - Intronic
1060022982 9:120148268-120148290 GCTTCGACATATAAATTTTGGGG - Intergenic
1060379041 9:123148151-123148173 GTTTCAACATATGAATTTTGGGG - Intronic
1060908151 9:127326680-127326702 GCTTTAACATATGAATTTTGGGG - Intronic
1061979839 9:134095798-134095820 GTTTCAACCTATGAATTTTGGGG - Intergenic
1062244224 9:135555670-135555692 GCTTCAAACAATGATTTCTGAGG - Intergenic
1062470604 9:136701948-136701970 GCTTCCAGGAAGGAATTTAGTGG + Intergenic
1203516268 Un_GL000213v1:4508-4530 GCTTCAATATATGAATTTTGGGG + Intergenic
1185606225 X:1368516-1368538 GCTTCAACACACGAATTTTGAGG - Intronic
1185787319 X:2901840-2901862 TCTTCCACATATGAATTGTGGGG - Intergenic
1185842566 X:3406385-3406407 GGTTCAACACATGAATTTTGGGG - Intergenic
1185920489 X:4086782-4086804 GTTTCAACATATGAATTTTGCGG - Intergenic
1185920815 X:4090199-4090221 GCTTCAACATATGAATTTTGGGG - Intergenic
1186112018 X:6267801-6267823 TCTTCAACATATGAATTTTGTGG + Intergenic
1186146800 X:6632559-6632581 TCTTCCACACATGAATTTTTGGG + Intergenic
1186155334 X:6719393-6719415 GCTTCAACATATGAATTTTGGGG + Intergenic
1186208171 X:7221901-7221923 GTTTCAACATATGAATTTTGGGG - Intronic
1186602330 X:11051154-11051176 TATTCCACCAATGAACTGTGCGG + Intergenic
1186644990 X:11497375-11497397 GCTTCAACATATGAATTTTAGGG - Intronic
1186818558 X:13262718-13262740 GCTTAAACATATGAATTTTGGGG - Intergenic
1186850423 X:13574486-13574508 GCTTCAACATATGAATCTTGAGG - Intronic
1187108087 X:16265853-16265875 GTTTCAACAAATGAATTTTGGGG + Intergenic
1187365214 X:18661117-18661139 GTTTCAACATATGAATTTTGGGG - Intronic
1187581922 X:20616344-20616366 GCTTCAACATCTGAATTTTGAGG + Intergenic
1187677547 X:21732764-21732786 GCTTCAACATATGAATTTGGGGG - Intronic
1187729228 X:22235668-22235690 GCTTCAACATAAGAATTTTGGGG + Intronic
1188057713 X:25560871-25560893 GCTTCCACATATGAGTTATGGGG + Intergenic
1188181507 X:27061803-27061825 GCTTCAACATGTGAATTTTGGGG + Intergenic
1188247331 X:27852452-27852474 GCTTCAACATATGAATTTTGAGG - Intergenic
1188377431 X:29449045-29449067 GCTTCAATATATGAATTTTGAGG + Intronic
1188391806 X:29630298-29630320 ATTTCCACATATGAATTTTGGGG + Intronic
1188556542 X:31418400-31418422 GTTTCCACATATGAATTTTGGGG + Intronic
1189345834 X:40240658-40240680 GTTTCAACCTATGAATTTTGAGG + Intergenic
1189478308 X:41374305-41374327 GCTTCAACACATGAGTTTTGGGG - Intergenic
1189605643 X:42674810-42674832 GCTTCAACATATGAATTTTAGGG + Intergenic
1189625752 X:42895178-42895200 GCTTCAACATATGAGTTTTGCGG + Intergenic
1189714713 X:43853525-43853547 ACTTCAACATATGAATTTTGAGG - Intronic
1189961544 X:46329304-46329326 GCTTCAACATATGAATTTTGGGG - Intergenic
1190074462 X:47306325-47306347 TCTTCAACACATGAATTTTGGGG - Intergenic
1190272590 X:48877690-48877712 GCTTCAACACATGAATTTTGGGG + Intergenic
1190481400 X:50880669-50880691 GCTTCAACATATAAATTTTGGGG + Intergenic
1190792190 X:53710833-53710855 GCTTCCACATATGAATTTTGAGG - Intergenic
1191227326 X:58057334-58057356 GGTTCAACATATGAATTTTGAGG - Intergenic
1191641111 X:63430536-63430558 GCTTCCATCAATGAACCATGTGG + Intergenic
1192094669 X:68198125-68198147 CTTTCAACCTATGAATTTTGGGG - Intronic
1192251218 X:69415403-69415425 GCTTCAACATATGAATTTTGGGG + Intergenic
1192848303 X:74927520-74927542 GCTTCAACATATGAATTTTTGGG - Intergenic
1192918426 X:75679693-75679715 GCTTCAACATAAGAATTTTGGGG + Intergenic
1193781077 X:85701949-85701971 GCTTCAACATATGAATTGTGGGG - Intergenic
1194027613 X:88772742-88772764 GCTTCAACATATAAATTTTGGGG + Intergenic
1194449766 X:94030092-94030114 GTTTCAACATATGAATTTTGGGG - Intergenic
1194597539 X:95877330-95877352 GCTTCAACATATTAATTTTGGGG + Intergenic
1194603024 X:95947028-95947050 ACTTCAACATATGAATTTTGAGG - Intergenic
1194649249 X:96496362-96496384 GCCTCAACCTATGAATTTTTGGG - Intergenic
1194721692 X:97347681-97347703 ACTTCAACATATGAATTTTGGGG - Intronic
1194737961 X:97536949-97536971 GCTTCCTCCAATGAACTATATGG - Intronic
1194804956 X:98315744-98315766 GCTTTAACATATGAATTTTGGGG - Intergenic
1194995133 X:100583701-100583723 GCATCAACATATGAATTTTGAGG - Intergenic
1195138690 X:101936364-101936386 GTTTCAACATATGAATTTTGGGG + Intergenic
1195284412 X:103369815-103369837 GCTTCAACATATGAAGTTTGGGG - Intergenic
1195461702 X:105133888-105133910 GTTTCAACATATGAATTTTGAGG + Intronic
1195463013 X:105148733-105148755 GCTTCAACATATGAATTTTAGGG - Intronic
1195784596 X:108505470-108505492 GATTCAACATATGAATTTTGAGG - Intronic
1195934606 X:110112928-110112950 GCTCCAACATATGAATTTTGGGG + Intronic
1195957628 X:110349477-110349499 GCCTCAACGTATGAATTTTGAGG + Intronic
1196134561 X:112194252-112194274 GCTTCAACATATGAATTTTGAGG - Intergenic
1196250883 X:113458811-113458833 GTTTCCACATATGAATTTTGGGG + Intergenic
1196286489 X:113886865-113886887 GCTTCAACATATGAATTTTGGGG + Intergenic
1196314573 X:114208365-114208387 GTTTCAACATATGAATTTTGAGG + Intergenic
1196654056 X:118198642-118198664 GCTTCAACATATGAATTTTAAGG - Intergenic
1196833381 X:119793416-119793438 GCTTCAACACATGAATTTTGGGG + Intergenic
1197034913 X:121861488-121861510 GTTTCAACATATGAATTTTGGGG + Intergenic
1197328884 X:125128898-125128920 GCTTCAACATATGAATTTGGGGG - Intergenic
1197440781 X:126486705-126486727 GTTTCAACATATGAATTTTGAGG + Intergenic
1197548369 X:127856289-127856311 GCTTCAACATATGAATATTGAGG - Intergenic
1197705531 X:129631975-129631997 GTTTCGACACATGAATTTTGGGG - Intergenic
1197929746 X:131682084-131682106 GTTTCAACATATGAATTTTGGGG - Intergenic
1197966111 X:132063890-132063912 ATTTCCACATATGAATTTTGGGG - Intergenic
1198073386 X:133171299-133171321 ACTTCAACATATGAATTTTGAGG + Intergenic
1198195232 X:134353601-134353623 GTTTCAACATATGAATTTTGGGG - Intergenic
1198282206 X:135153449-135153471 GCTTCAACAAAGGAATTTTTGGG + Intergenic
1198284494 X:135176424-135176446 GCTTCAACAAAGGAATTTTAGGG + Intergenic
1198288753 X:135219073-135219095 GCTTCAACAAAGGAATTTTTGGG - Intergenic
1198603180 X:138307546-138307568 GCTTCAACATATGAATTTTGAGG - Intergenic
1198670229 X:139072096-139072118 GCTTCAGCATATGAATTTTGGGG - Intronic
1198922909 X:141750412-141750434 GCTTCAACATATGCATTTTGGGG + Intergenic
1199034986 X:143039655-143039677 GCTTCAACATATGAATTTGGTGG - Intergenic
1199181886 X:144867049-144867071 GCTTTAACATATGAATTTTGGGG - Intergenic
1199217557 X:145277919-145277941 GCTTTCAACAAAAAATTTTGAGG - Intergenic
1199710366 X:150464822-150464844 TTTTCCCCCTATGAATTTTGAGG - Intronic
1200021895 X:153218746-153218768 GCTTCCACAGATGGATTTTGGGG + Intergenic
1200050515 X:153427814-153427836 GCTTCCACATATGAATTTTCAGG - Intergenic
1200393190 X:155964977-155964999 GTTTCAACATATGAATTTTGGGG + Intergenic
1201962624 Y:19698835-19698857 CCTTCAACATATGAATTTTGGGG + Intergenic