ID: 1092442514

View in Genome Browser
Species Human (GRCh38)
Location 12:8519379-8519401
Sequence AGGGAGGGGTAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1844
Summary {0: 1, 1: 0, 2: 7, 3: 124, 4: 1712}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092442514_1092442523 4 Left 1092442514 12:8519379-8519401 CCTTCCTCATTCTACCCCTCCCT 0: 1
1: 0
2: 7
3: 124
4: 1712
Right 1092442523 12:8519406-8519428 TAAGTGGGAAGTACTTCTGTAGG 0: 1
1: 0
2: 1
3: 8
4: 142
1092442514_1092442524 28 Left 1092442514 12:8519379-8519401 CCTTCCTCATTCTACCCCTCCCT 0: 1
1: 0
2: 7
3: 124
4: 1712
Right 1092442524 12:8519430-8519452 CTTTGTGCACAACGAGATCATGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092442514 Original CRISPR AGGGAGGGGTAGAATGAGGA AGG (reversed) Intronic
900074683 1:803811-803833 AGGGAGGGCAAGAATTGGGATGG + Intergenic
900084966 1:888512-888534 AGGGAGGGAGAGAAAGAGGAAGG + Intergenic
900084985 1:888599-888621 AGGGAGGGAGAGAAAGAGGAAGG + Intergenic
900471997 1:2859602-2859624 AAGGAGGGGTAGGAGGAAGAAGG + Intergenic
900522309 1:3111567-3111589 AGGAAGGGGAAGAGGGAGGAGGG + Intronic
900569540 1:3351567-3351589 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
900569544 1:3351583-3351605 AGGGAGGGGAAGAGAGAGGGAGG - Intronic
900569549 1:3351599-3351621 AGGGAGGGGGAGAGAGAGGGAGG - Intronic
900569579 1:3351704-3351726 AGGGAGGGGGAGACAGAGGAAGG - Intronic
900701237 1:4049777-4049799 AAGGAGGGGGAGAAAGAGGGAGG + Intergenic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
900918548 1:5656138-5656160 AGGGATGGAGAGAAAGAGGAAGG + Intergenic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
900946584 1:5834395-5834417 TGGGAGGGGTGGAGAGAGGAGGG + Intergenic
900988503 1:6086872-6086894 AGGGAGGGGAGGCATAAGGACGG - Intronic
901199011 1:7456223-7456245 AGGGAGGGAGAGAAGGAGGGAGG + Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
901949485 1:12730741-12730763 GGGGAGGGATAGCATTAGGAGGG - Intergenic
902114107 1:14106969-14106991 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
902218088 1:14947274-14947296 AGGGTGGGGAAGAGGGAGGATGG + Intronic
902649368 1:17826593-17826615 GGGTGGGGGTAGAATGAGGTGGG + Exonic
902759025 1:18568761-18568783 AGGGAGGGATGGAGAGAGGAGGG + Intergenic
902838071 1:19059363-19059385 AGGGGGGGGTGGGAGGAGGAAGG + Intergenic
902899881 1:19507581-19507603 TGGGTGGGGTAGACTGAGAATGG - Intergenic
903011056 1:20330725-20330747 AGGGAGAGGGAGAAGGAAGAGGG - Intronic
903197740 1:21705024-21705046 AGGGAGGGAGAGAAAGAGGAGGG + Intronic
903198538 1:21713047-21713069 AGGGAGGGAGGGAATGAGAAAGG - Intronic
903406781 1:23103916-23103938 AGGGAGGGGGGGAAGGAGGGAGG + Intronic
903635552 1:24812539-24812561 AGATAGTGATAGAATGAGGAGGG - Intronic
903964326 1:27077028-27077050 AGGGAGGGGAGAAAAGAGGAGGG - Intergenic
904073024 1:27816602-27816624 AGGGAGGGATAGAGAGAGAAGGG + Intronic
904073121 1:27817102-27817124 AGGGAGGGAGAGAAGGAGGGAGG + Intronic
904166835 1:28561997-28562019 AGGGAGGGCTACAATGATCAAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904334472 1:29787779-29787801 AGGGAGGGGTGGAATGGGGGAGG + Intergenic
904495502 1:30884224-30884246 GGGGAGGAGTGGAATGGGGAGGG + Intronic
904534111 1:31187983-31188005 AGGGAGGGGTGGAGTGGGCAGGG + Intronic
904567161 1:31434851-31434873 GGGGAGGGGGCCAATGAGGAAGG + Intergenic
904831179 1:33307594-33307616 TGGGAGGGGTGGGATGAGGTGGG - Intronic
904869000 1:33604834-33604856 AGGGAGGGGGAAGATGAAGAGGG + Intronic
905309116 1:37037384-37037406 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
905362367 1:37429783-37429805 AGGGAGGGAGAGAAAGAGGGAGG - Intergenic
905362379 1:37429819-37429841 AGGGAGGGAAAGAAGGAGGGAGG - Intergenic
905481898 1:38267687-38267709 AGGGAAGGGAAGAGAGAGGAGGG - Intergenic
905602730 1:39268288-39268310 AGGGAGGGCCAGGAGGAGGAGGG - Intronic
905681242 1:39872849-39872871 AGGGAGGGGAAGGAAAAGGAAGG + Intronic
905873828 1:41419600-41419622 AGGGAGGGGTAGAGAAGGGAAGG - Intergenic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906185216 1:43857522-43857544 AGGGAGGGAGGGAAGGAGGAGGG - Intronic
906276039 1:44516819-44516841 AGGTAGGGTTAGCATGAGAATGG - Intronic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
906783988 1:48597891-48597913 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
907044133 1:51289365-51289387 AAGGAGGGATAGAATGAGAAGGG - Intronic
907437428 1:54458761-54458783 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
907475456 1:54702261-54702283 AGGGAGGGGTAGAGGGTGCAGGG - Intronic
907564940 1:55425796-55425818 AGGGAGGGGTAGGGAGGGGAGGG - Intergenic
908017518 1:59858906-59858928 AGGGAGGGGGGGAAGGAGGGAGG + Intronic
908244122 1:62214222-62214244 AGGCAGGGGAAGAATGAGTGAGG - Intergenic
908296424 1:62717811-62717833 AGGGAAGGGTAGAGTAAGGTAGG - Intergenic
908470365 1:64438239-64438261 AGGGAGGGGAGGAAAGAGAAAGG - Intergenic
910131645 1:83914705-83914727 AGGGATTGGTAGCATGTGGATGG - Intronic
910449991 1:87335020-87335042 AGGGAGGGAAAGAATGAAGGGGG + Intronic
910760713 1:90728792-90728814 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
911156608 1:94643456-94643478 AGGTGGGGGTAGCATGAGGGTGG - Intergenic
911239139 1:95446590-95446612 AGTGAGGGGTAGTAGGAGGGTGG - Intergenic
911315730 1:96354586-96354608 AGGTAGGAGTAGAGGGAGGATGG - Intergenic
911406669 1:97449362-97449384 AGGGAGGGGAAAAGAGAGGAAGG + Intronic
912308480 1:108595435-108595457 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
912703404 1:111895048-111895070 AGGGAGAGGAAGCATGAGGGAGG + Intronic
912703417 1:111895100-111895122 AAGGAGGGGAAGGAAGAGGAAGG + Intronic
913196171 1:116458013-116458035 AGGGAGGGGTGGGCTGGGGAGGG - Intergenic
913384274 1:118242295-118242317 AGGGAGGGCTGGTAGGAGGAAGG - Intergenic
913601078 1:120421527-120421549 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
914085967 1:144455074-144455096 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
914191864 1:145419054-145419076 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
914589789 1:149097055-149097077 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
914675696 1:149905820-149905842 GGGGAGGGGTGGGGTGAGGAAGG - Intronic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
915035263 1:152918401-152918423 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
915107890 1:153545792-153545814 AGAGAGGGGAAGAATGGGGACGG + Exonic
915928395 1:160041771-160041793 GGTAAGGGGTAGAATAAGGAAGG + Exonic
916045718 1:160998685-160998707 AGGGAGGGCATGAAGGAGGATGG + Exonic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916332076 1:163628341-163628363 ATGGAGGGGGAGGAGGAGGAGGG - Intergenic
916409803 1:164535225-164535247 AGGGTGGGGAAGAATGAGAAAGG - Intergenic
916585265 1:166144526-166144548 AGGGATGGGGAGAAAGAGGTTGG + Intronic
916651118 1:166835646-166835668 AGGGAGGGGAGGAAGGAGGGAGG - Intergenic
916976578 1:170086743-170086765 AGGGAGGGGGGGAGGGAGGAAGG - Intergenic
917139169 1:171817644-171817666 TGGGTGGGGAAGAAAGAGGAGGG + Intergenic
917304078 1:173608932-173608954 AGGGAGGGGAAGGGAGAGGAAGG + Intergenic
917484528 1:175443701-175443723 AGAGATGGGAAGAAAGAGGAGGG + Intronic
917574323 1:176304955-176304977 AGAAAGGGGAAGAAAGAGGAAGG - Intergenic
917789343 1:178489448-178489470 AGAGAGGTGGGGAATGAGGAAGG + Intergenic
918412651 1:184275997-184276019 AGGGTGGGGGAAAATGGGGATGG + Intergenic
918440244 1:184559554-184559576 AGGGAGGGGAAGAAAGAGAGAGG - Intronic
918490590 1:185077301-185077323 AGGGAGGGAGAGAAGTAGGAGGG - Intronic
918625515 1:186652416-186652438 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919434832 1:197544977-197544999 AGGAAGGGGAAGAAGGAAGAAGG + Intronic
919449341 1:197751886-197751908 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
920089548 1:203442511-203442533 AGAGAGGAATAGAAGGAGGAAGG - Intergenic
920131201 1:203733153-203733175 AGAGAGGTGAAGAAAGAGGAAGG - Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920700566 1:208215383-208215405 AGGGATGGGTAGATGGATGATGG + Intronic
920773148 1:208909055-208909077 AGGGAAGGTTAGGATCAGGATGG - Intergenic
920910026 1:210207658-210207680 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
920910031 1:210207674-210207696 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
921382539 1:214539655-214539677 AAGGAAGGGAAGAAGGAGGAGGG + Intronic
921422726 1:214967107-214967129 AGAGAGGGGTAGCAAGAGGAAGG + Intergenic
921442385 1:215202983-215203005 AGGGAGGAGAAGAATGGGGGAGG - Intronic
921723642 1:218501024-218501046 AGAGAGGGGAAGAGAGAGGAGGG - Intergenic
921761788 1:218923502-218923524 AGGATGGAGTAGCATGAGGAAGG - Intergenic
921771936 1:219050611-219050633 AGGGAAGGGGAGAAAGGGGAGGG + Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922175980 1:223198007-223198029 AGGGAGGGAGGGAATGAGGGAGG - Intergenic
922270528 1:224028716-224028738 AGGGAGGGCAAGAATTGGGATGG + Intergenic
922503252 1:226111680-226111702 AGTGAAAGGTAGAATGGGGAAGG - Intergenic
922595903 1:226812693-226812715 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
922608015 1:226902875-226902897 AGGGTGGGGTAGGCAGAGGAGGG - Intronic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
922812803 1:228427114-228427136 AGGGAGGGAGGGAGTGAGGAAGG - Intergenic
923566137 1:235077281-235077303 AAGGAGGGCTGGAAAGAGGAAGG + Intergenic
923608171 1:235464417-235464439 AGGGAGGGGTGGAGGGAAGAAGG - Intronic
923712021 1:236395469-236395491 AGGGAGGGGAAGGCGGAGGAGGG + Intronic
924091604 1:240507308-240507330 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924328141 1:242916144-242916166 AGGGGTTTGTAGAATGAGGAAGG - Intergenic
924423962 1:243933876-243933898 AGGGAGGGGAAGGGAGAGGAAGG - Intergenic
924424060 1:243934104-243934126 AGGGAGGGGTAGGGAGAGGAAGG - Intergenic
924424117 1:243934240-243934262 AGGGAGGGGAAGGAAGGGGAAGG - Intergenic
924665143 1:246063622-246063644 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
924728656 1:246692607-246692629 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1062812490 10:477341-477363 AGGGAGGGGAGGAAGGTGGATGG + Intronic
1063154116 10:3362784-3362806 TGGGAGGGGGAGAAAAAGGAAGG - Intergenic
1063225731 10:4013305-4013327 GGGGAGGGGGAGAAGGAGTAGGG - Intergenic
1063311411 10:4956226-4956248 AGGGAGGGGGAGCATGGAGATGG + Intronic
1063316386 10:5010242-5010264 AGGGAGGGGGAGCATGGAGATGG - Intronic
1063473428 10:6307565-6307587 GGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1063511150 10:6646740-6646762 AGGGAGGGAAAGAAGGAGGGAGG - Intergenic
1063525256 10:6778871-6778893 AGGGAGGGAGAGAATGAAGAAGG + Intergenic
1063539576 10:6918686-6918708 AGGGAGGAGTAGAAGGATGGAGG + Intergenic
1063791544 10:9454322-9454344 AGGGAGGGGTTGTATGAACAGGG - Intergenic
1063851598 10:10198542-10198564 AGGGAAGGGTGGAAGGAGGGTGG - Intergenic
1063876465 10:10484152-10484174 AGGGAGGGAGAGAGAGAGGAGGG - Intergenic
1063999849 10:11654298-11654320 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1064002227 10:11673262-11673284 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1064508398 10:16061413-16061435 TGGGAGGGTGAGCATGAGGATGG + Intergenic
1064587309 10:16851953-16851975 AGGGAGGGAAAGATTGAGGGAGG - Intronic
1064587380 10:16852204-16852226 AGGGAAAGATAGAGTGAGGAAGG - Intronic
1064587400 10:16852280-16852302 AGGGAAAGATAGAGTGAGGAAGG - Intronic
1064688190 10:17886331-17886353 AGGGAGGGAAAGAAGAAGGAAGG - Intronic
1064769042 10:18704973-18704995 AGGGAGGGGGAGAGAAAGGAAGG - Intergenic
1065188249 10:23189613-23189635 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1065323095 10:24526846-24526868 AAGGAGGGTTAGAATGGTGAAGG + Intronic
1065427254 10:25618648-25618670 AAGGAGGGGTAGTTTGAGGAAGG + Intergenic
1065428161 10:25627345-25627367 AGGGTGGGGTGGAAAGAGGATGG - Intergenic
1065452643 10:25874553-25874575 AGGGAGGGGAAGGATAGGGAAGG + Intergenic
1065607423 10:27432624-27432646 AGGGAGGGAGAAAAGGAGGAAGG - Intergenic
1065824384 10:29556698-29556720 AGACAGGGGTATAATGAGAATGG + Intronic
1065876911 10:30005171-30005193 AGGGAGGGGGGGAGTGAGGATGG - Intergenic
1066198996 10:33128015-33128037 AGGGAAGGGAAGAAGGGGGAAGG - Intergenic
1066199042 10:33128124-33128146 AGGGAGGGGAAGAGGGTGGAGGG - Intergenic
1066295593 10:34051539-34051561 AGGGAAGGGAAGGAAGAGGAAGG - Intergenic
1066502434 10:36007104-36007126 AGGGAGAGAGAGAATGAGGGTGG - Intergenic
1066621155 10:37352223-37352245 AGGCTGGGGAAGAATGTGGATGG + Intronic
1066625529 10:37401986-37402008 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1067052967 10:43035233-43035255 GGTGAGGAGTAGAATGAGCAAGG + Intergenic
1067083385 10:43225876-43225898 GGGGAGGGGGAGAGAGAGGAGGG + Intronic
1067112400 10:43409383-43409405 GGGGAGGGGGAGGAGGAGGAGGG + Intergenic
1067251861 10:44593358-44593380 AGGGAGGGAAAGAAGCAGGAAGG + Intergenic
1067292598 10:44955089-44955111 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
1067807543 10:49403743-49403765 AGGGAGGGGGAGAAAGAGAAAGG - Intergenic
1067807555 10:49403807-49403829 AGGGAGGGAGAGAAAGAGAAAGG - Intergenic
1067807565 10:49403871-49403893 AGGGAGGGAGAGAAAGAGAAAGG - Intergenic
1068008016 10:51412882-51412904 AGGGAGGGATAGAGGGAGAAAGG + Intronic
1068122116 10:52791764-52791786 GAGGAGGGGGAGAAGGAGGAAGG + Intergenic
1068661123 10:59624303-59624325 AGGGTTGGGTAAAATGAGGCTGG - Intergenic
1068859517 10:61833123-61833145 GGGGACGGGGAGAATGGGGAGGG - Intergenic
1068920299 10:62476097-62476119 GGGGAGGGGTAGGGTGGGGAAGG + Intronic
1069123666 10:64602281-64602303 AGGGAGGGGAAGAACGATGAGGG + Intergenic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1069913648 10:71774354-71774376 AGGGATGAGAAGAATTAGGAGGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070363620 10:75714806-75714828 AGGAAGGGAAAGAAGGAGGAAGG - Intronic
1070363624 10:75714822-75714844 AGGGAGGGAAAGAAGGAGGAAGG - Intronic
1070574835 10:77670223-77670245 AGGGAGGGAGAGAATCAGGGAGG + Intergenic
1070574837 10:77670239-77670261 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574844 10:77670273-77670295 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574851 10:77670303-77670325 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574867 10:77670359-77670381 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574876 10:77670394-77670416 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574884 10:77670428-77670450 AGGGAGGGAAAGAATGAGAGAGG + Intergenic
1070574894 10:77670462-77670484 AGGAAGGGGGAGAATGAGAGAGG + Intergenic
1070574911 10:77670528-77670550 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574918 10:77670563-77670585 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574926 10:77670597-77670619 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574943 10:77670665-77670687 AGGAAGGGGGAGAATGAGAGAGG + Intergenic
1070589878 10:77794207-77794229 AGGCAGGGGTAGGCTGTGGAGGG + Intronic
1071497555 10:86179296-86179318 AGGGAGGGGAAGAGGGAGGAGGG - Intronic
1071538177 10:86454376-86454398 AGGGAGAGGGAGATTGTGGAGGG - Intronic
1071971897 10:90916061-90916083 CGGGTGGGGGAGAAGGAGGAGGG + Intronic
1072034592 10:91552492-91552514 AAGGAGGGGTAGAAGGAGAGAGG - Intergenic
1072191120 10:93076836-93076858 AGGGAGAGGTAGAAAGAGAGAGG - Intronic
1072195753 10:93116066-93116088 GGGGAGGGGGAGGAAGAGGAGGG + Intergenic
1072275279 10:93816701-93816723 AGGTAGGGAGAGAAGGAGGAAGG + Intergenic
1072411784 10:95209354-95209376 AGGGAGGGGAAGACTGCGGCAGG + Intronic
1072621754 10:97084314-97084336 AGGGATGGAGAGAATGAGGCAGG - Intronic
1073138764 10:101234141-101234163 AGGGAAGGGGAGAATCAGGGAGG - Intergenic
1073259224 10:102176076-102176098 GGGGAGGGGAAGAAGGAGGTGGG - Intergenic
1074654807 10:115572892-115572914 AGGGAGGGGGAGCATGCAGACGG + Intronic
1074676688 10:115859358-115859380 AGGGAGGGGTAATATGAGCAGGG - Intronic
1074724117 10:116289866-116289888 AGGGAGGGAGAGAGAGAGGAAGG - Intergenic
1074827940 10:117228298-117228320 AGGGAGGGAGGGAATGAGGAAGG - Intergenic
1074865776 10:117543613-117543635 AGCCAGGGGTAGAAGGTGGACGG - Exonic
1074874032 10:117600641-117600663 AGGGAGGAGGAGAAGGAGAAGGG - Intergenic
1074913480 10:117933922-117933944 AGGGAAGGGTTGAGGGAGGAGGG + Intergenic
1075340966 10:121646617-121646639 AGGGAGGGAGGGAGTGAGGAAGG + Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075618383 10:123907914-123907936 AGAGAGGGGAAGCAGGAGGAAGG + Intronic
1075667089 10:124239406-124239428 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1075802230 10:125160625-125160647 AGGGAGGGGTAGGGTGGGGAGGG - Intronic
1076001500 10:126916702-126916724 AAGGAGGGGTAGAAGGAAGGAGG - Intronic
1076074417 10:127522063-127522085 GGGGAGAGCGAGAATGAGGATGG - Intergenic
1076135133 10:128040466-128040488 TGGGAGGGGTAGAGTTAGCAGGG + Intronic
1076217353 10:128706805-128706827 AGGGAGGGGTAGTGAAAGGAGGG + Intergenic
1076217957 10:128710994-128711016 AGGGAGGGCTTGCAGGAGGAGGG + Intergenic
1076230137 10:128813434-128813456 AGGGAGGGACAGAAGGAGGGAGG + Intergenic
1076252394 10:128994764-128994786 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1076272418 10:129165958-129165980 AGGGAGGGAAAGAAGGAGGGAGG + Intergenic
1076425004 10:130361480-130361502 AGGGAGGGGAAGGAGCAGGAGGG + Intergenic
1076476455 10:130757033-130757055 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
1076547195 10:131253313-131253335 AGTGAGGGGCAGAGTGAGGGCGG - Intronic
1077307153 11:1873543-1873565 AGGGAAGGATAGAGGGAGGAGGG + Intronic
1077392572 11:2306913-2306935 AGGGAGGAGGAGATGGAGGAGGG + Intronic
1077533612 11:3108470-3108492 AGGGTGGGGAAGGCTGAGGAGGG + Intronic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1077719750 11:4616079-4616101 AGGGAGGGGGAGAGAGGGGAAGG - Intergenic
1078039665 11:7848234-7848256 AGGGAGAGATTGAATGTGGATGG - Intergenic
1078074908 11:8149762-8149784 GGGAAGGGGTATAATGAGGTGGG - Intronic
1078076531 11:8166928-8166950 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1078108197 11:8371838-8371860 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1078259150 11:9688425-9688447 AGGTAGGGGTAAATTGAGCAAGG + Intronic
1078645887 11:13141158-13141180 AGCGTGGTGTAGAATGTGGATGG - Intergenic
1078841080 11:15075968-15075990 AGAGAAGGGCTGAATGAGGAAGG - Intronic
1079408033 11:20162488-20162510 AGGGAGTGGGAGAAGGAGGGAGG - Intergenic
1079501516 11:21105916-21105938 AGGGAGGGAGGGAATGAGGGAGG - Intronic
1079501721 11:21108142-21108164 AGGGAGGGATATACTTAGGAGGG - Intronic
1079540934 11:21573778-21573800 AGGGAGGGAAAGAGGGAGGAAGG + Intronic
1079761591 11:24336001-24336023 AGGGAGGGGGTGAGGGAGGAAGG - Intergenic
1079802148 11:24882817-24882839 AGGGAGGGAGGGAATGAGAAGGG + Intronic
1079949737 11:26785907-26785929 AGAGAGGGAAAGAATGAGGGAGG - Intergenic
1080036822 11:27719693-27719715 AGGAAGAGATAGAATGAGGGAGG + Intronic
1080313556 11:30923027-30923049 AGGGAGGGAGAGACGGAGGAAGG + Intronic
1080424853 11:32146155-32146177 AGGGAGGGGTAAAATGGAGGAGG - Intergenic
1081631682 11:44693938-44693960 AGGGAGGTGTTGAGTGAGGTGGG - Intergenic
1081647317 11:44799048-44799070 AGGGAGGGCAAGGGTGAGGAGGG - Intronic
1081833930 11:46137921-46137943 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1082556450 11:54568302-54568324 TGGGAGGGGCAGAATGAGATTGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082913912 11:58410243-58410265 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083301663 11:61742783-61742805 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1083317789 11:61827361-61827383 AGGGAGGGGAAGGCAGAGGAAGG - Intronic
1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG + Intronic
1083431112 11:62613890-62613912 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1083549044 11:63572051-63572073 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1083741765 11:64714955-64714977 AGGGAGGGAGAGAAGGAGGTGGG + Intronic
1083935291 11:65866844-65866866 TGTGAGGGGCAGAATGAGAAAGG - Exonic
1084229219 11:67738702-67738724 AGGGAGGGGCACAGTGAGCAGGG + Intergenic
1084470425 11:69356210-69356232 AGGGAGGGAAAGAAGGAGGGAGG + Intronic
1084576094 11:69988900-69988922 AAGGAGGGAGGGAATGAGGAAGG + Intergenic
1084732009 11:71079834-71079856 AGGGAGGGGAAGGAAGGGGAGGG + Intronic
1084813101 11:71627637-71627659 AGGGAAGGGCAGAGTGAGCAGGG - Intergenic
1085719841 11:78903232-78903254 AGGGAGGGTGAGGCTGAGGAGGG - Intronic
1085847531 11:80083275-80083297 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085870000 11:80338356-80338378 GGGGAGGGATATAATGAGTAGGG - Intergenic
1085983678 11:81757371-81757393 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1086571638 11:88291520-88291542 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1086616145 11:88822800-88822822 GGGGAGGGAGAGAAGGAGGAAGG - Intronic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1086826217 11:91502112-91502134 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1087717499 11:101625421-101625443 AGGGAGAGGTGAAAAGAGGAAGG - Intronic
1087739701 11:101873159-101873181 AGGGAGGGGTCCAAAGAGGCTGG + Intergenic
1087757501 11:102070136-102070158 AGGGAGGGAAAGAGGGAGGAAGG + Intronic
1087963981 11:104389768-104389790 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1088455004 11:110024117-110024139 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1088537224 11:110874436-110874458 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1088542189 11:110924718-110924740 AGGGAAGAGTAGGATGGGGAAGG - Intergenic
1088649945 11:111948698-111948720 AGGGACGGGGAGAATGAAGGAGG - Intronic
1088675371 11:112187537-112187559 AGGGACGGGGAGAATGAAGGAGG - Intronic
1088904977 11:114148384-114148406 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1088998082 11:115021147-115021169 AGGGAGGGGAAGAAAGGGGAAGG - Intergenic
1089074603 11:115728230-115728252 GGGGAGGGGTAAAATAATGATGG - Intergenic
1089076392 11:115742076-115742098 AGGAATGGGGAGAATGAAGAGGG + Intergenic
1089111118 11:116057491-116057513 GGGGAGGAGGAGAATGAGGTTGG + Intergenic
1089161250 11:116439180-116439202 AGGGAGGGTAGGAAGGAGGAAGG + Intergenic
1089333167 11:117704134-117704156 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1089341239 11:117759292-117759314 AGGGAGGGGGAAATAGAGGAGGG + Intronic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089517806 11:119044875-119044897 AGGGAGGGGCACAGTGAAGAAGG - Exonic
1089586393 11:119512440-119512462 AGGAAGGGGAAGAAAGAGCAGGG + Intergenic
1089848375 11:121476703-121476725 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1090309533 11:125722804-125722826 AGGGAGGGAGATAATGAGGCAGG - Intergenic
1090446729 11:126770806-126770828 TGGAAGGGGCAGAAAGAGGAAGG + Intronic
1090475085 11:127013040-127013062 AGGGAGGGATGGAGAGAGGAAGG + Intergenic
1090531007 11:127591736-127591758 AGGGAGGGAGAGAAGGAGAAAGG + Intergenic
1090727862 11:129543898-129543920 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091755883 12:3051209-3051231 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
1091880842 12:3976793-3976815 AGGAATGGGTAAAATGAGTAAGG + Intergenic
1091907490 12:4200694-4200716 TGTGAGAGGTAGAATGGGGATGG - Intergenic
1092084084 12:5741480-5741502 AAGGAGCGGTAGGAAGAGGAGGG - Intronic
1092092234 12:5812499-5812521 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1092240273 12:6831782-6831804 AGTGAGGGGTAGCTGGAGGAAGG - Intronic
1092433868 12:8430772-8430794 AGGGAAGGTTAGAGTGAGCAGGG + Intergenic
1092442514 12:8519379-8519401 AGGGAGGGGTAGAATGAGGAAGG - Intronic
1092780122 12:11978555-11978577 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1092889309 12:12953781-12953803 AGCGAGGTCTAGAATGATGAGGG - Intergenic
1092910939 12:13144480-13144502 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1093000828 12:13993916-13993938 GGGGAGGGGAAGAAAGGGGAAGG + Intergenic
1093165502 12:15801187-15801209 AGGCAGGGGCAGAATATGGAAGG - Intronic
1093472911 12:19524025-19524047 AGGGAGGGAGAGATGGAGGAAGG - Intronic
1093591515 12:20907442-20907464 AGGGAGGGGAAGGAAGGGGAAGG - Intronic
1093756905 12:22862900-22862922 ACGTAGGGGTAGAAGGTGGAGGG + Intergenic
1095290377 12:40472817-40472839 AGGGAGGAGGAGGAAGAGGAGGG - Intronic
1095812213 12:46383357-46383379 AGGGAGGGGGAAAAGGAGGTGGG + Intergenic
1095970047 12:47895394-47895416 TGGGAGGGAGAGAAGGAGGAGGG + Intronic
1096197063 12:49655603-49655625 AAGGAGGGAAAGAAGGAGGAAGG + Intronic
1096267458 12:50135130-50135152 AGGGAGGGAGAGAGAGAGGAGGG + Intronic
1096267485 12:50135232-50135254 AGGGAGGGAGAGAGAGAGGAGGG + Intronic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096710389 12:53451754-53451776 AGGGATGGGTGGAAAGAGAAAGG - Intergenic
1096781499 12:53994800-53994822 AGGGAGGGCGAGAAGGAGGGAGG + Intronic
1097281600 12:57847912-57847934 AGAGAGGGGTAGGATGAGGGAGG - Intergenic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098819293 12:75208481-75208503 GGGGAAGGGGAGAAAGAGGAGGG - Intronic
1098980511 12:76951055-76951077 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1099082320 12:78200985-78201007 AGGGAGGGAGGGAGTGAGGAAGG - Intronic
1100370689 12:93966657-93966679 AGGGAGGGATGGAAGGAGGGAGG - Intergenic
1100370853 12:93967186-93967208 AGGGAGGGATAAAGGGAGGAAGG - Intergenic
1100522216 12:95385963-95385985 AGACAGGGGGAGGATGAGGAAGG + Intergenic
1100550727 12:95644333-95644355 AGGAAGGAGAAGAAGGAGGAAGG - Intergenic
1100601073 12:96111847-96111869 AGGGAGGTATAGAACGAGGGAGG - Intergenic
1100874680 12:98949535-98949557 AGGAAGGGGTTGGAGGAGGAAGG + Intronic
1101348554 12:103907184-103907206 AGGGAGGGAAAGAAGAAGGAAGG + Intergenic
1101843104 12:108341944-108341966 GGGGAGGGGGAGGAGGAGGAGGG + Intergenic
1101861891 12:108489169-108489191 AGGGAGGGAGGGAATGAGGGAGG + Intergenic
1101916958 12:108903272-108903294 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1102016901 12:109654216-109654238 AGAGAGGGGAGGAATGAGGAGGG - Intergenic
1102167953 12:110821010-110821032 GGGGAGGGGGAGAAGGAGAAAGG - Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102394517 12:112575024-112575046 AGGGAGAGGGAGGAAGAGGAGGG + Intronic
1102469178 12:113149933-113149955 AGGGAGGGCTAGAAGGAGGGCGG + Intronic
1102503151 12:113366786-113366808 AGGGAGGGAGAGGAGGAGGAGGG - Intronic
1102530470 12:113542801-113542823 AGGGAGGGGGAGAGGGAGGGAGG - Intergenic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102764796 12:115423224-115423246 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1102797137 12:115698316-115698338 AGGGAGGGGAGGGAAGAGGAAGG + Intergenic
1102893219 12:116578308-116578330 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1103004350 12:117409356-117409378 ATGGAGGGGTGGAAGGTGGATGG + Intronic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1103341094 12:120221562-120221584 AGGGAGGAGAAGGATGAGGGAGG + Intronic
1103351627 12:120287666-120287688 AGGGAGGGGAAGAAGCGGGAGGG - Intergenic
1103528081 12:121580573-121580595 AGGGAGGGAGGGAAGGAGGAGGG + Intronic
1104172512 12:126295865-126295887 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
1104483657 12:129130409-129130431 AGGGAGGGGCAGAGTCAGGATGG - Intronic
1104603676 12:130171353-130171375 GGGCAGGGGTGGAATGGGGAGGG - Intergenic
1104668798 12:130666784-130666806 AGGGAGGGATGGAGGGAGGAAGG + Intronic
1104668820 12:130666861-130666883 AGGGAGGGAGAGAAGGAAGAAGG + Intronic
1104668851 12:130666976-130666998 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1104676012 12:130713040-130713062 AGGGAGAGGAGGAATGAGGGAGG + Intronic
1104738650 12:131156238-131156260 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1106171618 13:27293471-27293493 GAGGCGGGGAAGAATGAGGAGGG - Intergenic
1106269274 13:28138460-28138482 AGGAGGGGGTAGAAGGAGGGAGG - Intergenic
1106288064 13:28335404-28335426 AGGGAGTGGAGTAATGAGGAAGG - Intronic
1106311312 13:28556890-28556912 GGGGAAGGGAAGAATGAGGTGGG + Intergenic
1106356039 13:28984316-28984338 AAGGAGGGGTAGAAGGAGAGAGG - Intronic
1106359999 13:29022284-29022306 AGTGAGGAGGAGCATGAGGATGG + Intronic
1107337370 13:39369594-39369616 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1107349486 13:39499403-39499425 AGGGAGGAGAGGACTGAGGAAGG - Intronic
1107613547 13:42141027-42141049 GGGGAGGGATAGCATTAGGAGGG - Intronic
1107722201 13:43260567-43260589 GTGGAGGGGAAGGATGAGGAGGG - Intronic
1107917642 13:45168903-45168925 AGGGAGGGAAGGAAGGAGGAGGG - Intronic
1107999999 13:45897202-45897224 AGGGAGGGAGGGAAGGAGGAGGG - Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108357729 13:49642457-49642479 AGGGAAGGAGAGAGTGAGGAAGG + Intergenic
1108428460 13:50329338-50329360 AGGTAGGGGTAGGTTGGGGATGG + Intronic
1108712700 13:53049430-53049452 AAGGAAGGGGAGAGTGAGGAAGG + Intronic
1108853842 13:54768925-54768947 AGGGAGGGAAGGAATAAGGAGGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109253004 13:60043453-60043475 AGGGAGGCAAAGAATGAGAAAGG + Intronic
1109273869 13:60283083-60283105 AGGGAGGGGAAGAGTGAGAGAGG - Intergenic
1109378485 13:61526403-61526425 AGGGAGGGGGAGGATGCAGATGG + Intergenic
1109408353 13:61931353-61931375 AGGGAGGGAGAGAATGAGAGAGG - Intergenic
1110270872 13:73588828-73588850 GGGGAGGGGTAGGAGGAGGGTGG + Intergenic
1110515829 13:76411427-76411449 AGGAGGGGGGAGAAGGAGGAGGG + Intergenic
1110515836 13:76411443-76411465 AGGAGGGGGGAGAAGGAGGAGGG + Intergenic
1110515860 13:76411490-76411512 AGGAGGGGGGAGAAGGAGGAGGG + Intergenic
1110812992 13:79830827-79830849 AGGGAGCTCTAGAATTAGGAAGG - Intergenic
1111086369 13:83380539-83380561 AGGGAGGGGGAGGAGAAGGAAGG - Intergenic
1111086412 13:83380683-83380705 AGGGAGGGGGAGGAGGAGGAAGG - Intergenic
1111086426 13:83380719-83380741 AGGGAGTGGGAGGAGGAGGAAGG - Intergenic
1111452600 13:88438685-88438707 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
1111497879 13:89076913-89076935 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1111786277 13:92790677-92790699 AGGGAGGGAAAGACAGAGGAAGG + Intronic
1112441223 13:99426387-99426409 AGGGAGTGGAGGAATGAGGGGGG - Intergenic
1112637044 13:101226912-101226934 AGGGAGGGGAAGCATAAGGAAGG - Intronic
1112649709 13:101381591-101381613 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112973230 13:105286066-105286088 AGGACGGGGTAGAAAGGGGATGG + Intergenic
1113049999 13:106200202-106200224 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1113127662 13:106998104-106998126 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1113159584 13:107364945-107364967 AGGGAGAGAGAAAATGAGGAGGG - Intronic
1113159605 13:107364996-107365018 AGGGAGGTGGAGGAAGAGGAGGG - Intronic
1113333187 13:109352003-109352025 AGGGATGGGGATAATGATGAGGG + Intergenic
1113387822 13:109866758-109866780 AGGGAGGGAAAGAAGGAGGAAGG + Intergenic
1113425151 13:110201393-110201415 AAGGAGGGGGAGTAGGAGGAGGG + Intronic
1113508910 13:110836169-110836191 AGGGAGGGAGAGAAGAAGGAAGG + Intergenic
1113614493 13:111671037-111671059 AGGGAGGGGAAAAGGGAGGAGGG - Intronic
1113619961 13:111755951-111755973 AGGGAGGGGAAAAGGGAGGAGGG - Intergenic
1113665238 13:112136639-112136661 AGGGAGGGAGAGAAGGAAGAAGG - Intergenic
1113813792 13:113158260-113158282 AGGGAGGGAAAGCAGGAGGATGG - Intergenic
1113843230 13:113371764-113371786 AGGGAGGGGTCTCAGGAGGAGGG - Intergenic
1113909695 13:113836284-113836306 GGGGAGGGGGAGAAGGGGGAGGG + Intronic
1113990449 14:16023969-16023991 AGGGAGGGAAAGAAAAAGGAAGG - Intergenic
1114197986 14:20495714-20495736 AGGGAGAGGAAGGAAGAGGAGGG - Intergenic
1114499486 14:23157683-23157705 AGGGTGGAGTAGAATGGGGTGGG - Intronic
1114516991 14:23306822-23306844 AGGGAGGGAGAGAGGGAGGAAGG - Exonic
1114563016 14:23607081-23607103 AGGGAGGGAGAGAGTCAGGAGGG + Intergenic
1114662185 14:24354180-24354202 AGGGAGGGGGAGAGGGAGGGAGG - Intergenic
1115108745 14:29794664-29794686 AGGGAAGGGAAGAATGAGAAGGG - Intronic
1115601492 14:34959878-34959900 AAGGATGGGTAGAATGGGAAAGG + Intergenic
1115672400 14:35628996-35629018 GGGGAGGGGGAGAAGGAAGAAGG + Intronic
1115906881 14:38210618-38210640 AAAGAGGGGGAGAATGAGAAGGG + Exonic
1115964933 14:38877402-38877424 AGGGAGAGGGAGCATGAGAAAGG - Intergenic
1116416992 14:44689868-44689890 AAGGAGGGGGAGGAGGAGGAGGG + Intergenic
1116737414 14:48709677-48709699 CTGGAGGGATAGAATAAGGATGG + Intergenic
1117247446 14:53900180-53900202 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1117402766 14:55372598-55372620 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1117554281 14:56868721-56868743 AGGGCAGGGTTCAATGAGGAAGG - Intergenic
1117898170 14:60508879-60508901 AGGGAGGGGTAGAGCGGGGTGGG + Intronic
1118088002 14:62441119-62441141 TGGGAGGGGAAGAATCAGGTGGG + Intergenic
1118425048 14:65651159-65651181 AGGGAGGATTAAAAAGAGGAGGG + Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118766764 14:68915249-68915271 AAGGAGGGGAAGAAGGAGCAGGG - Intronic
1118774770 14:68966902-68966924 AGGAAGGGGCAGGATGAAGAGGG + Intronic
1119004399 14:70910124-70910146 GGGGAGGGGGAGGAGGAGGAGGG - Intronic
1119130078 14:72163977-72163999 TGGGAGGGGTGGCAAGAGGAAGG + Intronic
1119428614 14:74551584-74551606 TGGGGGAGGTAGAATCAGGAAGG - Intronic
1119764230 14:77178406-77178428 GGGGAGGGGAAGGAAGAGGAGGG - Intronic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1119997696 14:79271515-79271537 GGGAAGGGGAAGAAAGAGGAGGG - Intronic
1120134521 14:80850051-80850073 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1120367723 14:83591959-83591981 AGGGAGGGAAAGAAGGAGGGAGG - Intergenic
1120717240 14:87853002-87853024 AGGCAGGGGTAGATTTTGGAAGG - Intronic
1120903171 14:89593242-89593264 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
1120996070 14:90419613-90419635 AGGAAGAGGTAGAATGAGGCTGG + Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121362128 14:93271348-93271370 AGGTCGGGGTGGAAAGAGGAAGG + Intronic
1121578740 14:95010473-95010495 AGGGAGGGAAAGAAGGAAGAAGG + Intergenic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121738340 14:96234389-96234411 AGGGAGGGTGAGAGGGAGGATGG - Intronic
1121769106 14:96516357-96516379 AGAGAGGGAGAGAATGAGGGAGG - Intronic
1121843496 14:97154147-97154169 AAGGAGGGAGAGAGTGAGGAAGG - Intergenic
1121843831 14:97156131-97156153 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1122293048 14:100689672-100689694 AGGGAGGGGATGAAAGGGGAGGG - Intergenic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122447860 14:101782112-101782134 GGGGAGGGGAAGAAGGGGGAGGG - Intronic
1122448156 14:101782926-101782948 AGGGAGGGGGAGAAAGAGAGAGG - Intronic
1122856585 14:104563076-104563098 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1123068136 14:105628337-105628359 AGGTGGGGGTAGAAGGAGCAGGG - Intergenic
1202933256 14_KI270725v1_random:59337-59359 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1123399431 15:19969770-19969792 AGGGGGGAGTAGAATGATGGAGG - Intergenic
1123678637 15:22739458-22739480 AGGGAGGGAGAGAAAGAAGAGGG - Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1123858509 15:24437778-24437800 AGAGAGGGGTAGCAAGAGGCAGG + Intergenic
1123917650 15:25048830-25048852 AGGGAGGGAGAGAGTGAGGGAGG - Intergenic
1123991286 15:25685442-25685464 AGGGAGGGCAAGAATGATGTAGG - Intronic
1124099720 15:26682278-26682300 AGGGAGTGGGAGAGGGAGGAAGG - Intronic
1124153108 15:27199976-27199998 AGAGAGGAGTAGAGGGAGGAAGG - Intronic
1124330843 15:28813739-28813761 AGGGAGGGAGAGAAAGAAGAGGG - Intergenic
1124363698 15:29056605-29056627 AGGGAGGGAGAGAAGGAGGGAGG - Intronic
1124486406 15:30121148-30121170 AGGGAGGGAGAGAGAGAGGAAGG - Intergenic
1124541480 15:30590127-30590149 AGGGAGGGAGAGAGAGAGGAAGG - Intergenic
1124618440 15:31259862-31259884 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
1124723793 15:32136709-32136731 AAGTAGGGGTCGAATGGGGAAGG + Intronic
1124757178 15:32417458-32417480 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1125024800 15:35019487-35019509 AGGGAGGGGGAGGAGGAGGAAGG - Intergenic
1125024808 15:35019506-35019528 AGGGAGGGGGAGGAGGAGGAGGG - Intergenic
1125368857 15:38948298-38948320 GGGGAGGGGAGGAAGGAGGAGGG + Intergenic
1125542020 15:40475075-40475097 AGGTAGGGGTAGAGAGAAGAAGG + Intergenic
1125611465 15:40974083-40974105 TGGGAGGGGAAGACTGGGGAGGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125892167 15:43274903-43274925 AGGGAGGGGGAAGAGGAGGAAGG + Intergenic
1125968252 15:43891480-43891502 AGGGAGGGCTGGTCTGAGGAGGG + Intronic
1126464243 15:48946442-48946464 AGGAAGAGGAAGGATGAGGAAGG - Intronic
1126802892 15:52316362-52316384 AGGAAGTGGAAGAATGAGAAGGG - Intronic
1127007028 15:54582085-54582107 AGAGAGGGAGGGAATGAGGACGG + Intronic
1127390348 15:58500149-58500171 AAGGAGGGGTGGAAAGAGCATGG + Intronic
1127392954 15:58521662-58521684 TAGGAGGGGAAGAAAGAGGAAGG + Intronic
1127660744 15:61098092-61098114 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1127660758 15:61098132-61098154 AGGGAGGGAAAGAAGGAGGGAGG - Intronic
1128304138 15:66586997-66587019 GGGGAGGGGGAGAAGGGGGAAGG - Intronic
1128304157 15:66587034-66587056 GAGGAGGGGGAGAATGGGGAGGG - Intronic
1128361915 15:66968138-66968160 ATGGAGGTTTAGAGTGAGGATGG + Intergenic
1128430645 15:67590402-67590424 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1128463448 15:67888874-67888896 AGGGTGGGGTAGGGAGAGGAAGG + Intergenic
1128617860 15:69124221-69124243 ACTGAAGGGTAGCATGAGGAAGG + Intergenic
1128677805 15:69624635-69624657 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1128828935 15:70748635-70748657 AGGGAGGGGTAGAATGAACAGGG - Intronic
1129007371 15:72385103-72385125 GGGGAGGGGGAGAATGAGTTGGG - Intergenic
1129467087 15:75730298-75730320 AGAGAAGGGGAGAAGGAGGATGG + Intergenic
1129536163 15:76315185-76315207 AGGGAGGGGGAGATTTAGAATGG - Intergenic
1129623295 15:77169574-77169596 AGGTAGGAGTAAAATGAAGAGGG + Intronic
1129657477 15:77533763-77533785 TGGGAGGGGAAGACTGGGGAAGG - Intergenic
1129720140 15:77873422-77873444 AGGGAAGGGGAGAAGGAGGATGG - Intergenic
1130856038 15:87840885-87840907 AGGGAGGGGGAGAGGGAGGAGGG + Intergenic
1130864939 15:87924898-87924920 AGGGAGGAATGGAATGAGGGGGG - Intronic
1130896136 15:88171795-88171817 AGGGAGGGGGAGAAAGAAGAAGG - Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131059490 15:89395862-89395884 TAGGAGGGGGAGAAAGAGGAGGG - Intergenic
1131067101 15:89441534-89441556 AGGGAGGGGTGGAGCCAGGAGGG + Intergenic
1131312583 15:91304412-91304434 AGAGAGGGAGAGAAAGAGGAAGG + Intergenic
1131460011 15:92611193-92611215 AGGGAGGGAGAGAGTGAGGGAGG + Intergenic
1131793336 15:95988399-95988421 AGGGAGGGGAAGGAAGAGGGAGG + Intergenic
1131880713 15:96859299-96859321 AGGGAGGGGAGAAATGGGGAAGG - Intergenic
1132064478 15:98719326-98719348 AGGCAGGGGTGGGAGGAGGAAGG - Intronic
1132078597 15:98845401-98845423 AGGGAGGGGGAGGAGGAGGGAGG - Intronic
1132345543 15:101106386-101106408 AGGGAGAGAAAGAATGAGGCCGG + Intergenic
1132596273 16:751880-751902 AGGGAGGGGTAAGGTGAGCACGG + Intronic
1132664633 16:1075973-1075995 AGGGAGGGGGAGGAGGGGGAGGG - Intergenic
1132719194 16:1307629-1307651 AGGGAGGGAATGAATGAGGGAGG + Intergenic
1132719274 16:1307977-1307999 AGGGAGGGAGGGAATGAGGGAGG + Intergenic
1132719288 16:1308037-1308059 AGGGAGGGAATGAATGAGGGAGG + Intergenic
1132989936 16:2787274-2787296 AGGGAGGGGGTGAAGGATGAGGG - Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133567563 16:7009121-7009143 AGGGAGGGATGGAGGGAGGAAGG - Intronic
1133656733 16:7872141-7872163 AGGGAGGGAAGGAATGAGGGAGG - Intergenic
1133668993 16:7999134-7999156 GGAGGGGGGTAGAATTAGGAAGG - Intergenic
1133875910 16:9734143-9734165 AGGAAGGGAAAGAAAGAGGAAGG + Intergenic
1133927348 16:10203906-10203928 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1133964116 16:10518987-10519009 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1133964328 16:10519615-10519637 AGGAAGGGGAAGGAAGAGGAAGG - Intergenic
1133978132 16:10614923-10614945 AGGGAGGGATGGAAGGAGGAAGG - Intergenic
1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG + Intronic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134291748 16:12907165-12907187 AGGGAAGGGTGGAAGGGGGATGG - Intronic
1134394959 16:13854232-13854254 AGGGAAGGAGAGAAGGAGGAGGG + Intergenic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134710889 16:16326517-16326539 AGGGAGGGGAGGAAGGAGGAGGG - Intergenic
1134747661 16:16600551-16600573 AGGCTGGGGAAGAATGAGCAAGG - Intergenic
1134799615 16:17071776-17071798 AGGGAGGGGAGGAAAGGGGAGGG - Intergenic
1134865616 16:17604215-17604237 AGGGAGGTGTAAGAGGAGGAGGG - Intergenic
1134997807 16:18753111-18753133 AGGCTGGGGAAGAATGAGCAAGG + Intergenic
1135173776 16:20210078-20210100 AGGGAGGAGTAGAATGGAGAGGG - Intergenic
1135263337 16:21000035-21000057 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1135612466 16:23880369-23880391 AAGGAGGGGGAGAAGGAGGCAGG - Intronic
1135628985 16:24021350-24021372 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1136178563 16:28535282-28535304 AAGGAGGGAAAGAAAGAGGAAGG - Intronic
1136380790 16:29894409-29894431 AGGGAGGGAGAGAAGGAGGGAGG - Intronic
1136382361 16:29901451-29901473 TGGGATGGGTAGAGTGAGGCGGG + Exonic
1137531253 16:49280386-49280408 GGTGAGGGGTAGAGAGAGGAGGG - Intronic
1137578169 16:49617592-49617614 AGGGAGGGGAAGAGGAAGGATGG - Intronic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137847174 16:51702030-51702052 AGAGAGGGGGAGAAGGAAGAAGG + Intergenic
1137877917 16:52014887-52014909 AGGGAGGGAAGGAAGGAGGAAGG - Intronic
1137953267 16:52803662-52803684 GGGGAGGGGGAGGAAGAGGAAGG + Intergenic
1138174379 16:54883409-54883431 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1138499816 16:57433498-57433520 AGGGATAGGAAGGATGAGGATGG + Intronic
1138535015 16:57655228-57655250 AGGGAAGGGAGGGATGAGGAGGG + Intronic
1138545365 16:57716010-57716032 AGCGAGGGGTTGGAGGAGGATGG + Intronic
1138603555 16:58072499-58072521 AGGGAGGGCTGGAATGTGGAGGG + Intergenic
1138991616 16:62397122-62397144 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1138995646 16:62449470-62449492 AAGGAAGGATAGAGTGAGGAAGG - Intergenic
1139004116 16:62550427-62550449 AGGGAGGGTGAGAGGGAGGAAGG - Intergenic
1139028981 16:62855875-62855897 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1139029147 16:62858355-62858377 AGGGGGGGGCAGAGAGAGGATGG - Intergenic
1139209965 16:65067778-65067800 AGGGAGGGAGAGAGAGAGGAAGG + Intronic
1139317483 16:66086174-66086196 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139511197 16:67429646-67429668 AGGCAGGACTTGAATGAGGAGGG - Intergenic
1139640874 16:68290608-68290630 AGGGAGGAGGAGAAGGATGAGGG - Intronic
1139782951 16:69366824-69366846 AGGGAGGGGTTGGTTGAGAACGG + Exonic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1140436246 16:74949431-74949453 AGGGAGGGAAAGAAGGAGGGAGG + Intronic
1140541492 16:75760312-75760334 AGGGAGGGATGGAAGGAGGAAGG - Intronic
1140944379 16:79754308-79754330 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1140944635 16:79756500-79756522 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1141028858 16:80570881-80570903 AGGGTGGGGTTGAGTGTGGAGGG - Intergenic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141198996 16:81882884-81882906 AGGGAGGGGAAGAGTGGGAATGG - Intronic
1141371285 16:83488583-83488605 AGGGAGGGTTGGAAAGAGAATGG - Intronic
1141410784 16:83831573-83831595 AGGGAGGAGTGGAGAGAGGAGGG - Intergenic
1141427131 16:83951853-83951875 AGGGAGGGAAAGAGGGAGGAAGG - Intronic
1141527196 16:84618738-84618760 GGGGGTGGGGAGAATGAGGAAGG - Intergenic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141640540 16:85338451-85338473 ATGGAGGGGGAGACTGAGGCAGG - Intergenic
1141646480 16:85370604-85370626 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1141646485 16:85370620-85370642 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1141646490 16:85370636-85370658 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1141775666 16:86121449-86121471 AGGGAGGAGGAGAAGGAGGGAGG - Intergenic
1141844528 16:86598314-86598336 AGGGATGGGAAGGAAGAGGAGGG - Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142058476 16:88015189-88015211 AGGGATGGGCAGAAGGAGCACGG - Intronic
1142422114 16:89977936-89977958 AGGAAGGGGTAGGATGGGGCGGG - Intergenic
1142526314 17:544000-544022 AGGGAGGGAGGGAGTGAGGAAGG + Intronic
1142541238 17:661062-661084 AGGGAGGGATGGAGGGAGGAGGG - Intronic
1142899577 17:3003828-3003850 AGAGAGGCGCACAATGAGGATGG + Intronic
1142905048 17:3035719-3035741 AGGGAGGAGGAGAACAAGGATGG + Exonic
1142968089 17:3593443-3593465 AGGGAGGGGAAGCATGGGGATGG - Intronic
1143208715 17:5166816-5166838 GGGGTGGTGTAGAATGAAGAAGG - Intronic
1143273189 17:5690605-5690627 AGGGAGAGGGAGAAGGAGAAGGG - Intergenic
1143452459 17:7043795-7043817 GGGGAGGGGAAGGGTGAGGAAGG + Exonic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143693971 17:8596631-8596653 AGGGAGGGGGAGTAGGAGGGAGG + Intronic
1143693978 17:8596647-8596669 AGGGAGGGGGAGTAGGAGGGAGG + Intronic
1143693985 17:8596663-8596685 AGGGAGGGGGAGTAGGAGGGAGG + Intronic
1143702897 17:8674796-8674818 AGGGAGGGATGGAATGATGTAGG - Intergenic
1143728719 17:8867706-8867728 AGGAAGGGGAAGGAAGAGGAGGG - Intergenic
1143971237 17:10797420-10797442 AGGGATTGGGAGAGTGAGGAAGG - Intergenic
1144068107 17:11642115-11642137 AGGCAGGGGTTGAAGCAGGAAGG + Intronic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144229351 17:13184785-13184807 GAGGAGGGGGAGAAAGAGGAGGG + Intergenic
1144465520 17:15493732-15493754 AGGGAGGGAGAGAGAGAGGAAGG - Intronic
1144465533 17:15493786-15493808 AGGGAGGGAGAGAGAGAGGAGGG - Intronic
1144508582 17:15855842-15855864 GGAGAGTGGTAGAATGGGGAGGG - Intergenic
1144894664 17:18520765-18520787 GGGGTGGTGTAGAATGAAGAAGG + Intergenic
1145137561 17:20423479-20423501 GGGGTGGTGTAGAATGAAGAAGG - Intergenic
1145826133 17:27878561-27878583 AGGGAGGGGGAGAAGGTGGGTGG - Exonic
1146472221 17:33133751-33133773 GGGGCAGGGTAGAAGGAGGAGGG - Intronic
1146475202 17:33157136-33157158 AGGGAGAGGGACACTGAGGAGGG - Intronic
1146534314 17:33637010-33637032 GGGGAGGAGAAGAAGGAGGAAGG - Intronic
1146724706 17:35147807-35147829 TGGGAGGGGCAGACTGAGGCTGG + Exonic
1146925037 17:36738579-36738601 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
1146925046 17:36738599-36738621 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
1147134151 17:38425603-38425625 AAAGAGGGGGAGTATGAGGAGGG + Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147305822 17:39563774-39563796 AGGGAGAGTGAGAGTGAGGAAGG + Intronic
1147310857 17:39595498-39595520 AGGGAGGGAGGGAAGGAGGAGGG + Intergenic
1147607803 17:41784306-41784328 AGGGAGGGGTGGAGTGGGGGTGG + Intronic
1147788066 17:42994554-42994576 AGTGAGGGGAGGAATGAGGGTGG - Intergenic
1147842240 17:43379971-43379993 AGGGTGGGGGAGAATGGAGAGGG - Intergenic
1147930431 17:43977183-43977205 AGGGAGGGGGAGAGGGAGGCAGG + Intronic
1147952231 17:44113679-44113701 AGGGAGGGGCAGAGTGAGTCTGG - Intronic
1148206710 17:45784190-45784212 AGGGAGGGGGAGGAAGGGGAGGG + Intergenic
1148694034 17:49548495-49548517 AGGAAGGGGGAGCATGAGGCTGG - Intergenic
1148769712 17:50059902-50059924 AGGGAGAGAGAGAATGAGAAAGG - Intronic
1148901899 17:50884788-50884810 GGGGAGAGGTGGAAAGAGGAAGG - Intergenic
1149107083 17:52982591-52982613 GAGGAGGGGGAGAAGGAGGAAGG - Intergenic
1149452526 17:56760873-56760895 AGGGAGGGGAGGAAGGAAGAAGG + Intergenic
1149479963 17:56995416-56995438 AGGGAGGGGTAGGAGAAAGAGGG - Intronic
1149517508 17:57291889-57291911 ATGGCGGGGGAGAATGAGGCTGG - Intronic
1149684384 17:58527028-58527050 CCGGAAGGGAAGAATGAGGAAGG + Intronic
1149686696 17:58539738-58539760 AGGGAGGGAGAGAGAGAGGAGGG + Intronic
1149729548 17:58931413-58931435 AGGGAGGGAGAGAAGGAGGGAGG + Intronic
1149775731 17:59355579-59355601 AGGGAGGTGTAGGAGGAGGGAGG - Intronic
1149867891 17:60160896-60160918 AGGGAGGAGTAGAGGGAGGGAGG + Intronic
1149991688 17:61387151-61387173 CGGGAGGGGTGAAATGCGGAGGG - Intronic
1150001394 17:61443078-61443100 GGGGAGGGGGAGACAGAGGAGGG + Intergenic
1150015356 17:61551682-61551704 AGAGAGGGAAAGAAAGAGGAAGG - Intergenic
1150424768 17:65068572-65068594 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1150519650 17:65852482-65852504 AGGGAGGGAGGGAATGAGGGAGG - Intronic
1150645739 17:66976495-66976517 AGGGAGGGAAAGAGGGAGGATGG - Intronic
1150677780 17:67259579-67259601 AAGGAGGGGTAGAGGGAGGGAGG + Intergenic
1150914018 17:69417786-69417808 AGGGAGGGAGAGAAAGAGGGAGG + Intronic
1151044932 17:70908886-70908908 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1151319448 17:73343687-73343709 AGGGAGGGCCAGAAGGAGGCAGG + Intronic
1151339453 17:73461043-73461065 AGGGAGGGATGGCATGGGGAGGG - Intronic
1151354265 17:73549208-73549230 AGGGAGGAGTAGAAGGAGAGAGG + Intronic
1151815876 17:76471167-76471189 AGGTAGGAGGAGAAAGAGGAAGG + Exonic
1151956575 17:77383141-77383163 AGGGAGGGAAAGAAAGAGGGAGG - Intronic
1151956579 17:77383157-77383179 AGGGAGGGAGAGAAAGAGGGAGG - Intronic
1151956583 17:77383173-77383195 AGGGAGGGAGAGAAGGAGGGAGG - Intronic
1151974399 17:77476170-77476192 AGGGAGGGGTAGGCAGAGAAGGG + Intronic
1152003234 17:77660432-77660454 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
1152091457 17:78249864-78249886 AGGGAGGCATAGAGGGAGGAGGG + Intergenic
1152131393 17:78478921-78478943 AGGGAGGTGTGGACTGATGATGG - Intronic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152287717 17:79422336-79422358 AGGGAGGGGTTGAATGTGTGGGG - Intronic
1152473658 17:80503879-80503901 AGGGAGGGGTGGAGGGATGATGG + Intergenic
1152531730 17:80922908-80922930 AGGGCGGGGAAGGAGGAGGATGG - Intronic
1152620182 17:81359481-81359503 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1152650752 17:81491599-81491621 AGGGAGGGGGAGAGGGAGGGAGG - Intergenic
1152844830 17:82593366-82593388 AGGGAGGGAGGGAAAGAGGAAGG + Intronic
1153151448 18:2099423-2099445 AGGGAGGGACAGAAGGAGGGAGG + Intergenic
1153274344 18:3353153-3353175 AGGGAGGGAGAGAAGGAGAAAGG - Intergenic
1153998904 18:10466622-10466644 AGGGGAGGGCAGAATGAGGGAGG + Intronic
1154031235 18:10756019-10756041 AGGGATGGGGATAAGGAGGAGGG + Intronic
1154352644 18:13599032-13599054 AGGAAGGGGTAGAACAAGGAAGG + Intronic
1154509221 18:15077466-15077488 AGGGAGGAGTAGTAAGAGGTAGG + Intergenic
1155067342 18:22279337-22279359 AGGGAGGTGGAAGATGAGGAGGG - Intergenic
1155130327 18:22928336-22928358 AGGGCATGGGAGAATGAGGAAGG + Intronic
1155294356 18:24371674-24371696 AGTGAAGAGTAGAATGGGGAGGG - Intronic
1155354980 18:24943287-24943309 AGGGAGGAAAAGAAAGAGGAAGG + Intergenic
1155521446 18:26672948-26672970 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1155902795 18:31411678-31411700 AGGGAAGTGGAGAATGATGAGGG - Intronic
1155941043 18:31802388-31802410 GGTGAGGGGGAGAATGTGGAGGG - Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156343322 18:36232639-36232661 AGGGACGGGTAGGATAAAGAAGG - Intronic
1156491386 18:37498433-37498455 GGGGAGGGGAAGAAAGGGGAAGG - Intronic
1156503233 18:37572946-37572968 AGGGAGGGAGAGGCTGAGGATGG + Intergenic
1156523591 18:37744145-37744167 AGGGAGGGAGAGAAAGAGGAAGG - Intergenic
1156541761 18:37918991-37919013 AGGCAGGGGTAGAGGGAGTAGGG + Intergenic
1156791699 18:40983823-40983845 AAGGAGGTGGAGAAGGAGGAGGG - Intergenic
1156827366 18:41447879-41447901 AGGAGGGGGTATAATGAAGAAGG + Intergenic
1157085196 18:44573400-44573422 AGGAAGGGGAAGAAGGAAGACGG + Intergenic
1157139220 18:45088866-45088888 AGGAAGGGGAAAAATAAGGAAGG - Intergenic
1157373255 18:47138058-47138080 AGGGAGGCTGAGAATGAGGCAGG + Intronic
1157447281 18:47755040-47755062 AGGCTGGGGTGGGATGAGGATGG + Intergenic
1157470287 18:47983173-47983195 GGGGAGGAGAAGAAGGAGGAAGG - Intergenic
1157475544 18:48021230-48021252 AGGGAGGGGAGGAAAGAGAAGGG - Intergenic
1157583596 18:48787376-48787398 AGGAAGGGAGAGAAGGAGGAAGG + Intronic
1157612719 18:48968449-48968471 AGGGAGGGAGGAAATGAGGAAGG + Intergenic
1158301918 18:56061981-56062003 AGGGAAGGATAGAATGAGGCTGG + Intergenic
1158332109 18:56374496-56374518 AGGCAGGGGAAGGAGGAGGAGGG - Intergenic
1158528199 18:58234315-58234337 AGGGAGGGAGAGAAGGAGGGAGG - Intronic
1158745153 18:60191224-60191246 AGGGAGGGAAAGAAGGAGGGAGG - Intergenic
1159010728 18:63057071-63057093 TGGGAAGGGAAGGATGAGGATGG - Intergenic
1159284172 18:66327795-66327817 AGAAAGTGGTAGAATGAAGAGGG - Intergenic
1159322965 18:66877501-66877523 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1159322970 18:66877521-66877543 AGGGAGGCGTAGAAGTAGGGAGG + Intergenic
1159356026 18:67338122-67338144 AGGGAGGGAGGGAATGAGGGAGG - Intergenic
1159360009 18:67388004-67388026 AGGGAGGGGGAAAAGGAGAAAGG - Intergenic
1159527894 18:69617435-69617457 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
1159737344 18:72115804-72115826 AAGGAAGGAAAGAATGAGGAAGG - Intergenic
1160085849 18:75777100-75777122 AGGGAGGCAGAGAATGAGGGAGG - Intergenic
1160356172 18:78229756-78229778 AGGGAGGGAAAGAAGGAGGGAGG - Intergenic
1160445179 18:78922060-78922082 AGGGAGAGGTAAAATGAGAGCGG - Intergenic
1160701824 19:511237-511259 AGGGAGGAGGAGGAAGAGGAAGG - Intronic
1160872059 19:1282164-1282186 AGGGAAGGGGAGGAGGAGGAAGG + Intergenic
1161023369 19:2022527-2022549 AGGGAGGGATGGAGGGAGGAAGG - Intronic
1161085439 19:2332960-2332982 TGGGAGGGGGAGCAGGAGGAGGG + Intronic
1161085460 19:2333021-2333043 TGGGAGGGGGAGCAGGAGGAGGG + Intronic
1161085498 19:2333142-2333164 TGGGAGGGGGAGCAGGAGGAGGG + Intronic
1161122890 19:2539892-2539914 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1161130304 19:2584685-2584707 AGGGAGGGATAGAGGGAGGGAGG + Intronic
1161130367 19:2584873-2584895 AGGGAGGGATAGAGGGAGGGAGG + Intronic
1161142953 19:2659631-2659653 AGGGAGGGAAGGAAAGAGGAAGG + Intronic
1161241236 19:3225013-3225035 AGGGAGGGGGAGAGGGGGGAGGG - Intronic
1161256044 19:3310241-3310263 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1161256103 19:3310681-3310703 AGGGAGGGGAAGAGAGAGGGAGG - Intergenic
1161398700 19:4058421-4058443 AGGGAGGGGGAGAAAGGGGTGGG - Intronic
1161434989 19:4257972-4257994 AGGGTGGGGTGGAAAGAGGCTGG - Intronic
1161470625 19:4455330-4455352 AGGCAGGGGTGGGACGAGGAGGG - Intronic
1161638082 19:5401839-5401861 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1161663037 19:5558970-5558992 AGGGAAGGGAAGACGGAGGAAGG + Intergenic
1161681567 19:5682273-5682295 AGGCAGGGAGAGAATGAGTATGG + Intronic
1161756591 19:6138498-6138520 AGGGAGGGAGGGAAAGAGGAAGG + Intronic
1161789275 19:6349358-6349380 AGGGAGGGACAGAAGGAGGGAGG + Intergenic
1161905180 19:7151229-7151251 AGGGAGGGAGGGAAAGAGGAAGG - Intronic
1162028218 19:7906040-7906062 AGGGAGGGGGAGGAGGAGGGAGG - Intronic
1162053096 19:8046815-8046837 GAGGAGGGGGAGAAGGAGGAGGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162072958 19:8165882-8165904 AGGGAGGGGGAGGGGGAGGAGGG + Intronic
1162170816 19:8787357-8787379 AGGGAGGGAGGGAGTGAGGAGGG - Intergenic
1162232562 19:9279861-9279883 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1162311330 19:9909217-9909239 AGGGAAGGGGAGATGGAGGAGGG - Intronic
1162448806 19:10741913-10741935 AGGGAGGGAGGGAAAGAGGAAGG - Intronic
1162467154 19:10849124-10849146 AGGGAGGGGGTGAGTGAGGTGGG - Intronic
1162814851 19:13187553-13187575 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1162826509 19:13255712-13255734 AGGGAGGGAGAGAAGGAGGGAGG - Intronic
1162872719 19:13598583-13598605 AGGGAGGGAAAGAAAGAGGAAGG + Intronic
1162942242 19:14017972-14017994 TGCCAGGGGTAGAAGGAGGAAGG + Intergenic
1163112956 19:15172485-15172507 GGGGAGGGGTAGAGGGATGAAGG - Intronic
1163207213 19:15812495-15812517 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1163222171 19:15929488-15929510 AGGGTGGCATAAAATGAGGAGGG + Exonic
1163383540 19:16985238-16985260 AGGGAGGGATAGAGGGAGAATGG + Intronic
1163632566 19:18424862-18424884 AGGGAGGGGGAGAATGGGGAAGG + Intronic
1163711739 19:18851144-18851166 TGGGAGGGGAAGAATGGGGCTGG + Intronic
1163712028 19:18852646-18852668 AGGGAGGGACAGAAAGAGGAGGG - Intronic
1163712036 19:18852670-18852692 AGGGAGGGACAGAAAGAGGAGGG - Intronic
1163838506 19:19591358-19591380 AGGAAGGGAAAGAATGAGAATGG + Intronic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164609520 19:29622583-29622605 AGGGAGGGGAGGAAAGAGAAAGG + Intergenic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164696584 19:30249358-30249380 GGGGAGGGGGACAAGGAGGAGGG + Intronic
1164730954 19:30504267-30504289 AGGGAGGGATAGAGGGAGGGAGG - Intronic
1164753180 19:30670948-30670970 AGGGATGGGCAGAATGGGGTGGG - Intronic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1165233122 19:34399859-34399881 AGGGAAGAGTGGTATGAGGAAGG - Intronic
1165463543 19:35958836-35958858 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1165717627 19:38056516-38056538 AGGAAGGGGTAAACTGACGAAGG - Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165894967 19:39136101-39136123 AGGAAGGGGGATGATGAGGAAGG - Intronic
1166062435 19:40335003-40335025 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1166087175 19:40484582-40484604 AGTCAGGGGAAGAAAGAGGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166203650 19:41254583-41254605 AGGGGAGGGTAGAAGGTGGAGGG + Intronic
1166283295 19:41809202-41809224 AGGGAGGGAGAGAAGGAGGGAGG + Intronic
1166350292 19:42194894-42194916 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1166350478 19:42195658-42195680 AGGGAGGGAGGGAAAGAGGAAGG - Intronic
1166360927 19:42252727-42252749 TGGGGGGGGGAGAATGAAGAGGG + Intronic
1166473509 19:43100392-43100414 AGGGAGGGAGAGAGAGAGGAAGG + Intronic
1166750077 19:45160358-45160380 AGTGAGGGGCAGGATAAGGAGGG + Intronic
1166808445 19:45500579-45500601 AGGGTGGGGTGGAATGAGGGTGG + Intronic
1167019260 19:46861550-46861572 ATGGAGGGGTGGAAGGGGGAAGG - Intergenic
1167195111 19:48023152-48023174 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
1167195181 19:48023413-48023435 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1167229115 19:48270619-48270641 AGGGAGGGAGAAAAGGAGGAAGG + Intronic
1167554191 19:50183043-50183065 AAGGAGGGGAAGGAGGAGGAAGG - Intergenic
1167568435 19:50271704-50271726 AGGGAGGTGTAGGGGGAGGAAGG + Intronic
1167578635 19:50329467-50329489 CGGGCGGGGTAGAGGGAGGAGGG + Intronic
1167622036 19:50566072-50566094 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1168075478 19:53978869-53978891 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1168357719 19:55712862-55712884 AAGGAGGGGGAGGAGGAGGAGGG + Intronic
1168646447 19:58062004-58062026 AGGGAGGTGTTGAAGAAGGAGGG - Intronic
925034238 2:673732-673754 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
925439917 2:3876599-3876621 AGGGGGTGGTAGAGTCAGGATGG + Intergenic
925452296 2:3980020-3980042 AGGGAAGGGAAGGATGAGGGAGG - Intergenic
925507706 2:4586778-4586800 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
925606937 2:5669266-5669288 AGGGAGGGAGAGAAAGAGGGAGG + Intergenic
925659188 2:6184325-6184347 AGGGAAGGAAAGAAAGAGGAAGG + Intergenic
925791044 2:7488631-7488653 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
925791088 2:7488782-7488804 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
925791194 2:7489146-7489168 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
925820449 2:7794595-7794617 GGGGAGAGGGAGAAAGAGGAAGG + Intergenic
926190242 2:10722415-10722437 AGGAAGGCGTGGGATGAGGAAGG - Intronic
926394847 2:12430403-12430425 AGGAAGGAGAAGAAGGAGGAAGG + Intergenic
926458401 2:13097724-13097746 AGGGAGGGGTGGAAAGGGAAAGG - Intergenic
926821014 2:16851824-16851846 AGGGAGGGGAGGAGGGAGGAAGG - Intergenic
926947698 2:18206159-18206181 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
927287486 2:21371626-21371648 AGGGAAGGGAAGAAGGAGGGAGG + Intergenic
927686389 2:25174339-25174361 AGAGAGGGATAGAGGGAGGAAGG + Intergenic
927686588 2:25175319-25175341 TAGGAGGGGATGAATGAGGAAGG + Intergenic
927859477 2:26551448-26551470 AGTTAGGGGAAGACTGAGGAAGG - Intronic
928084361 2:28336559-28336581 AGGGAGAGGTAGAGAGAGGCAGG + Intronic
928316008 2:30246792-30246814 AGGGAGGGAGTGAGTGAGGAAGG - Intronic
928373767 2:30759130-30759152 AGGAAGGGGAAGAGGGAGGAAGG - Intronic
928742656 2:34373242-34373264 AGGGAGGGAGAGAGAGAGGAAGG - Intergenic
929144456 2:38694493-38694515 AGGGAGAGAGAGAAAGAGGAAGG + Intronic
929171114 2:38934434-38934456 AGGGAGGGATAGAAGGGGGAGGG - Intronic
929171136 2:38934499-38934521 AGGGAGGGAGAGAAGGGGGAGGG - Intronic
929171144 2:38934518-38934540 AGGGAGGGAGAGAAGGGGGAGGG - Intronic
929401874 2:41592232-41592254 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
929878991 2:45820447-45820469 AAGGAAGGGCAGAATGAGAAAGG + Intronic
930622514 2:53658867-53658889 AGGGAGGGAGGGAGTGAGGAGGG + Intronic
930654205 2:53992091-53992113 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
931115142 2:59157865-59157887 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
931121627 2:59226391-59226413 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
931121649 2:59226452-59226474 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931330080 2:61271689-61271711 AAGGAGGGGAAGAAGGGGGAAGG + Intronic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932128155 2:69163593-69163615 ATGCAGGGGTTGAATGAGGGAGG - Intronic
932285503 2:70528498-70528520 AGGGAAGGGTAGAACGATGTGGG + Intronic
932464042 2:71902012-71902034 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
932577109 2:72968723-72968745 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
932736760 2:74259866-74259888 AGAGTGTGGTAGATTGAGGAGGG - Intronic
933211785 2:79579199-79579221 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
933234550 2:79850402-79850424 AGGGAGGGAGAGAAGGAGAAAGG - Intronic
933475857 2:82789990-82790012 AGGGAGGGGAGGGATGGGGATGG - Intergenic
933626261 2:84603964-84603986 AGTGCGGGGTAGAATGAGAATGG - Intronic
934072339 2:88395990-88396012 AGGGAGGGGTTGAATTAGACTGG + Intergenic
934124181 2:88870619-88870641 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
934325233 2:92007697-92007719 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
934517781 2:94999514-94999536 AGGCAGGCGCAGAATGAGGCAGG + Intergenic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
934903090 2:98176478-98176500 AGGGAGGGGAAGACCGAAGAAGG - Intronic
935405107 2:102700433-102700455 AGGGAGGGTGAGAAGGAGGTTGG + Intronic
935570077 2:104650335-104650357 GGGGAGGGGAAGGAAGAGGAGGG + Intergenic
935570154 2:104651235-104651257 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
935761292 2:106322959-106322981 GGGGAGGGGCAGGAGGAGGAGGG + Intergenic
936034838 2:109102689-109102711 GGGGAGAGGGAGGATGAGGAAGG + Intergenic
936039750 2:109141236-109141258 ACAGAGGGGAAGAGTGAGGAAGG - Intronic
936246209 2:110829668-110829690 AGGCAGGGGAAGAAGGAGGAAGG + Intronic
936379399 2:111970725-111970747 AGGGAGGAGTAGGGGGAGGAAGG - Intronic
936523303 2:113226093-113226115 AGGGAGGGAGAGAAAGAGGGAGG - Intronic
936679817 2:114757220-114757242 AGGGTGGGGAAGAGGGAGGAAGG + Intronic
936919192 2:117670313-117670335 AGGTAGGGGTAGTAAGAAGAGGG + Intergenic
936964687 2:118116226-118116248 AGGCAGGGGAAGAATGGGCATGG + Intergenic
936989741 2:118349978-118350000 ATGCAGGGATAGAATGAAGAAGG + Intergenic
937024976 2:118690407-118690429 AGGGAGGGAAAGAAGGAGGGAGG + Intergenic
937233598 2:120417010-120417032 AGGGAGGGAGAGGATGCGGAAGG - Intergenic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
937311340 2:120905218-120905240 AGGGAGGGAGAGAAGGAGGAGGG + Intronic
937433479 2:121860692-121860714 AGGAAGGTGATGAATGAGGACGG + Intergenic
937573360 2:123390992-123391014 GGGGAGGAGGAGAATGAAGAAGG - Intergenic
937609739 2:123846414-123846436 AGGGATGACTAGAAGGAGGATGG + Intergenic
937818716 2:126283655-126283677 AGTGAGTGGTAGAAATAGGAGGG + Intergenic
937819925 2:126298500-126298522 AGGGAGGGATGGAAGGAGGGAGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
937921821 2:127136612-127136634 GGGGTGGGGAGGAATGAGGAAGG + Intergenic
938188354 2:129253258-129253280 TGTGAGGGGCAGAATGAGGTCGG - Intergenic
938671161 2:133588309-133588331 AGGGAGGGGAGGAAGGGGGAGGG - Intergenic
938671213 2:133588470-133588492 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
939216431 2:139244578-139244600 TGGGAAGGGTGGAATGGGGAGGG - Intergenic
939379357 2:141414274-141414296 AGGGAGGGGGAGAGGGAGGCAGG + Intronic
939395901 2:141629247-141629269 AAGGAGGGGTACAAGGAAGATGG + Intronic
939456948 2:142449579-142449601 AGTAAGGGGTAGAATTAGGGAGG - Intergenic
939472387 2:142640138-142640160 AGGAAGGGAGAGAAGGAGGAAGG - Intergenic
939969572 2:148644644-148644666 AGGGAGGGGAAGGGAGAGGAAGG + Intronic
940894240 2:159064911-159064933 GGGGAGGGGAGGAATGAGGACGG - Intronic
942043230 2:172084660-172084682 AGGGAGGGGGAGGAGGAGGAAGG + Intergenic
942398588 2:175577625-175577647 AGGGAGGTGTAGTCTGAGAAAGG - Intergenic
942535030 2:176954326-176954348 AGGGAGGGTGAGAGAGAGGAAGG + Intergenic
942618074 2:177815554-177815576 TGGGAGGGAAAGAAGGAGGAAGG - Intronic
942629388 2:177939354-177939376 AAGGAGGGAGAGAGTGAGGAAGG + Intronic
942893596 2:181021607-181021629 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
943132037 2:183865868-183865890 AGGAATGGCTAAAATGAGGAAGG - Intergenic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943338397 2:186646608-186646630 AAGAAAGGGAAGAATGAGGAAGG - Intronic
943775163 2:191757516-191757538 AGGAAATGGTAGGATGAGGATGG + Intergenic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
945462329 2:210123533-210123555 AGGGTGGGGGAGAATGGGGATGG + Intronic
945911205 2:215651509-215651531 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
945958227 2:216105967-216105989 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
946149624 2:217755489-217755511 GGGTAGGGGTAGAAGGTGGAGGG - Intronic
946162996 2:217847471-217847493 AGGAAGGGGTAGAAGGAGTCAGG + Intronic
946235897 2:218324110-218324132 AGGAAGGGGTAGAGGGAGGCAGG - Intronic
946292967 2:218759564-218759586 AGGGAGGGGTAGACTGTAGAGGG + Intergenic
946380621 2:219346267-219346289 AGGGAAGGGAAGAAGGAGAAAGG - Intergenic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946523953 2:220497568-220497590 AGGCTGGGGTAGAGTGAGCAGGG + Intergenic
946538379 2:220657259-220657281 AGGGAGGGGGAGCATGCAGAAGG + Intergenic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
947996631 2:234533534-234533556 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
948080329 2:235200338-235200360 AGGGAGGGAGGGAAGGAGGAGGG + Intergenic
948558571 2:238835275-238835297 AGGGAGAGGGAGAAGGAGAAGGG - Intergenic
948570868 2:238916426-238916448 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
948716314 2:239865654-239865676 AGGGAGGGATGGATTGAGGATGG - Intergenic
948815838 2:240510053-240510075 AGGGAGGGCAAGAATGGGGAAGG - Intronic
948858541 2:240741914-240741936 AGGGAGTGGTAGACAGAGGTGGG - Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949016853 2:241718344-241718366 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1168749331 20:271056-271078 AGGGAGGGAAAGAAAGAGGGAGG + Exonic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169125933 20:3126616-3126638 AGGGAGGGAGTGAAGGAGGAAGG + Intronic
1169277824 20:4245433-4245455 AGGCAGGGAGAGAAAGAGGAAGG + Intronic
1169505758 20:6209384-6209406 AGGGAGGGAAAGAGGGAGGAAGG - Intergenic
1169507910 20:6233063-6233085 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1169544328 20:6635246-6635268 AGGGAGGGATAGAGGAAGGAAGG - Intergenic
1169922782 20:10753197-10753219 AGGGAGGGAAAGAAGGAGGGAGG + Intergenic
1170041595 20:12045251-12045273 AGGGAGGGGAGGGGTGAGGAGGG - Intergenic
1171010849 20:21508732-21508754 AGAGAGGGGAAGAAGGAGAAGGG - Intergenic
1171012054 20:21514149-21514171 AGGGAGGGAAAGAAAGAGGGAGG + Intergenic
1171151922 20:22834947-22834969 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1171190391 20:23155011-23155033 AGGGAGGGAGGGAAGGAGGATGG + Intergenic
1171435587 20:25120589-25120611 GGGCAGGGGTGGAATGGGGAAGG + Intergenic
1171810472 20:29742143-29742165 AGGGCGGGGGCGGATGAGGAGGG + Intergenic
1171816559 20:29790627-29790649 AGGGAGGGAGAGAAAGAAGAAGG - Intergenic
1171901796 20:30865364-30865386 AGGGAGGGAGAGAAAGAGGAAGG + Intergenic
1171999088 20:31758090-31758112 AGGGAGGGGTGGCAGGAGGGAGG - Intronic
1172035533 20:32008102-32008124 AGGGAGGGGAAGGAAGAGGAAGG + Intergenic
1172125262 20:32621795-32621817 AGGGAGGGCTCGGAGGAGGAGGG + Intergenic
1172204557 20:33153768-33153790 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1172399133 20:34634018-34634040 AGGGGTGGGAAGAAAGAGGAAGG + Intronic
1172638036 20:36423065-36423087 ATGGGGGGCTTGAATGAGGACGG - Intronic
1172788654 20:37487205-37487227 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1172905243 20:38364276-38364298 AAGTAGGGGAAGAAGGAGGAGGG - Intronic
1172970807 20:38871683-38871705 AGGGAGGGAAAGAAAGGGGAAGG + Intronic
1173113464 20:40217951-40217973 AGAGAGGGGGAGAAAGAGAAAGG + Intergenic
1173144193 20:40510764-40510786 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1173277803 20:41599549-41599571 AGGGAGGGGGAGAATCGAGAGGG - Intronic
1173427827 20:42958246-42958268 AGGAAGGGAGAGAGTGAGGAAGG + Intronic
1173605330 20:44327211-44327233 TGGGAGGGCAAGGATGAGGAGGG + Intergenic
1173706869 20:45116361-45116383 AGGGAGGGGTGGAGGGAGGGAGG - Intergenic
1173706877 20:45116377-45116399 AGGGAGGGGTGGAGGGAGGGAGG - Intergenic
1173871527 20:46345034-46345056 ATGGAGGGGTAGATGGATGAAGG - Intergenic
1173896471 20:46554868-46554890 AGGGAGGAGGAGCATGGGGAGGG - Intergenic
1173976279 20:47189020-47189042 AGGGAGGGGAAGAAGGACAAAGG + Intergenic
1173981229 20:47225576-47225598 AGGGAGGGGAAGGAAGGGGAAGG + Intronic
1174265130 20:49325770-49325792 AGGGAGGGCAAGAAGGAGGAGGG - Intergenic
1174473352 20:50777911-50777933 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1174692081 20:52516086-52516108 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1175130072 20:56782253-56782275 AGGGAGGGAAAGAAGGAGGGAGG + Intergenic
1175237733 20:57525638-57525660 GGGGAGGGGTGGAATGAGGGGGG + Intronic
1175237741 20:57525658-57525680 GGGGAGGGGTGGAATGAGGCGGG + Intergenic
1175237806 20:57525833-57525855 GGGGAGGGGTGGAATGAGGAGGG + Intergenic
1175237934 20:57526184-57526206 GGGGAGGGGTGGAATGAGGAGGG + Intergenic
1175237996 20:57526353-57526375 GGGGAGGGGTGGAATGAGGAGGG + Intergenic
1175273911 20:57754495-57754517 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
1175356761 20:58374990-58375012 AGAGAGGGGTATAATGTGGGAGG - Intergenic
1175480010 20:59304067-59304089 AGGGAGGGGGAGAGGGAGGGAGG - Intronic
1175633043 20:60558077-60558099 AGGGAGAGGAAGAAAGAGCAAGG - Intergenic
1175674563 20:60935622-60935644 AGGGAAGGGGAGAAGGAGGAAGG - Intergenic
1175685931 20:61029001-61029023 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175685947 20:61029049-61029071 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175685953 20:61029065-61029087 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175685959 20:61029081-61029103 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175685965 20:61029097-61029119 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175685975 20:61029131-61029153 AGGGAGGGGGAGAGAGAGGGAGG - Intergenic
1175983974 20:62755157-62755179 GTGGAGGGATAGAAGGAGGAAGG - Intronic
1175984061 20:62755445-62755467 AGGGAGGGATGGAGGGAGGATGG - Intronic
1176520195 21:7818475-7818497 AGGGAGGAGTGGAAGGCGGAAGG + Exonic
1176594659 21:8681510-8681532 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1176697330 21:9995236-9995258 AAGGAGGGGGAGAAGGAAGAAGG + Intergenic
1176788848 21:13294342-13294364 AGGGAGGAGTAGTAAGAGGTAGG - Intergenic
1176892296 21:14332501-14332523 AGGGAGGGAGGGAAGGAGGAGGG + Intergenic
1176893362 21:14345994-14346016 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1177076853 21:16586876-16586898 AGGGAAGGGAAGAATGAAAAAGG - Intergenic
1177304301 21:19292857-19292879 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1177457192 21:21355508-21355530 AGGGAGGGAGAGAGGGAGGAGGG + Intronic
1177988011 21:28002483-28002505 AGGGAGGAGTAGTAAGAGGTAGG - Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178259470 21:31085567-31085589 AGGGAGGGATAGACAGAGGGAGG + Intergenic
1178275635 21:31234325-31234347 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1178337854 21:31759838-31759860 AGGGAGGGGAGGGAAGAGGAAGG - Intergenic
1178420986 21:32443015-32443037 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
1178439896 21:32590309-32590331 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
1178471606 21:32898631-32898653 GGGGAGTGGTACAATGAGGTAGG - Intergenic
1178654221 21:34448487-34448509 AGGGAGGAGTGGAAGGCGGAAGG + Intergenic
1178666031 21:34547317-34547339 AGGGAGGGGGAGAAAGGTGAGGG - Intronic
1178922999 21:36751646-36751668 AGGGAGTGGTGGAAGTAGGAAGG - Exonic
1178974718 21:37210899-37210921 AGGGAGGGGGAGGGGGAGGAAGG + Intergenic
1179237912 21:39563609-39563631 AGGGAGGGAGGGAACGAGGAAGG - Intronic
1179520662 21:41942251-41942273 ACAGAGGGGCAGCATGAGGAGGG + Intronic
1179915379 21:44474280-44474302 GGCGAGGGGCAGAATCAGGAGGG + Intergenic
1180277511 22:10658639-10658661 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1180316822 22:11283557-11283579 AGGGAGGGAAAGAAAAAGGAAGG + Intergenic
1180320021 22:11311221-11311243 AGGGAGGGAGAGAAAGAAGAAGG - Intergenic
1180335169 22:11571306-11571328 AGGGAGGGAGAGAAAGAGGAAGG + Intergenic
1180786493 22:18550618-18550640 AGCGAGGGGAAGAGAGAGGATGG + Intergenic
1180794435 22:18595134-18595156 AGGGAGGGAGAGAATGGGGCTGG + Intergenic
1180872493 22:19154564-19154586 GGGGAGGGGGAGGAAGAGGAAGG - Intergenic
1181227304 22:21400186-21400208 AGGGAGGGAGAGAATGGGGCTGG - Intergenic
1181243413 22:21490171-21490193 AGCGAGGGGAAGAGAGAGGATGG + Intergenic
1181251346 22:21534653-21534675 AGGGAGGGAGAGAATGGGGCTGG + Intergenic
1181267754 22:21640921-21640943 GGGGAGGGGTAGTTTGAGGGCGG + Intergenic
1181439163 22:22926989-22927011 AGGGAGGGGCAGCCAGAGGAAGG - Intergenic
1181441499 22:22938216-22938238 AGGGAGGGAAAGAAGGAGGGAGG + Intergenic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1181815405 22:25432703-25432725 AGGGAGGGATGGAAGGAGGGAGG + Intergenic
1181844762 22:25698203-25698225 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1181963282 22:26638402-26638424 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1182033230 22:27176511-27176533 AGCGTGAAGTAGAATGAGGACGG - Intergenic
1182116790 22:27761341-27761363 AGGGAGGGGGAGAAGGAGAGAGG - Intronic
1182597613 22:31434215-31434237 TGGGATGGGCTGAATGAGGAAGG + Exonic
1182641148 22:31768777-31768799 AGAGAGGGGTAGAGAGAGGGAGG - Intronic
1182754433 22:32667279-32667301 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1182862166 22:33569651-33569673 AAAGAGGGGGAGAATGTGGATGG - Intronic
1182864545 22:33592065-33592087 AGGGAGGGGAGGAGAGAGGAGGG + Intronic
1182894880 22:33850820-33850842 AGGCAGGGATAGAATTAGAATGG - Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1182931470 22:34178292-34178314 AGGGAGGGGGAGGAGGAGGGAGG - Intergenic
1183085436 22:35483885-35483907 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1183299054 22:37049593-37049615 AGGGAGGGAAAGAAAGAGGGAGG - Intergenic
1183301629 22:37061652-37061674 AGGGAGGGGTGGAGCGAGGAGGG + Intronic
1183375861 22:37464664-37464686 AGGGAGGAATGGAATGAGAATGG - Intergenic
1183381245 22:37491588-37491610 AGAGAGGGGGAGAAGGAGGGGGG + Intronic
1183482017 22:38070428-38070450 AGGGAGGGGGAAATTCAGGAAGG - Intronic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183698824 22:39438236-39438258 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1183724427 22:39580616-39580638 AGGGAGGGGTTTAGTGAGGCTGG + Intronic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1184012841 22:41762319-41762341 GGGGAGGGGAAGTAAGAGGAAGG - Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184318084 22:43714331-43714353 AAGGAAGGATAGAAGGAGGAAGG + Intronic
1184420320 22:44378381-44378403 AGGTAGGGGAAGATAGAGGAAGG - Intergenic
1184537112 22:45094696-45094718 AGGGGGGGGAAGAGGGAGGAAGG - Intergenic
1184877061 22:47282696-47282718 AGGGAGGGGAAGAGTGAGCCTGG - Intergenic
1185135796 22:49071415-49071437 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
949161395 3:887192-887214 AGGGAGGGAAAGAAGAAGGAAGG - Intergenic
949535016 3:4988852-4988874 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
949576814 3:5346135-5346157 AGGGAGGGAGAGCATCAGGAAGG + Intergenic
949620094 3:5801094-5801116 AGGGAGGGAGAAAAAGAGGAAGG - Intergenic
949956102 3:9269878-9269900 AGGGAGGGACAGAGGGAGGAAGG + Intronic
950094324 3:10319931-10319953 AGGGAGGGGGAGAGAGAGAAAGG + Intronic
950180747 3:10911511-10911533 AGGGAGGGGAGGAGTGAGGGAGG - Intronic
950198458 3:11026204-11026226 AGGGAGGGGTGGGGTGAGGAGGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950582134 3:13869488-13869510 AGGGAGGGAAAGAGAGAGGAAGG + Intronic
950621968 3:14213035-14213057 AGGGAGGTATAGGATGAGCAGGG - Intergenic
950622710 3:14218763-14218785 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
950635515 3:14311670-14311692 AGGGAGGGATGGAAGAAGGAAGG - Intergenic
950678354 3:14568223-14568245 GGGGAGGGACAGACTGAGGAGGG + Intergenic
950871283 3:16231753-16231775 AGGGAGGGAGAGAGAGAGGAAGG - Intronic
950881356 3:16325351-16325373 AGGGAGGTGGAGGATTAGGAAGG + Intronic
951289421 3:20856347-20856369 AGAGAGGGAAAGAAAGAGGAAGG - Intergenic
951336257 3:21425716-21425738 AGGGAGGGAGAGAAGGAGGTGGG + Intronic
951526498 3:23657773-23657795 AGGGAGGGAGAGAAGAAGGATGG + Intergenic
951742688 3:25941795-25941817 AGAGAGGGGCAGAAAGAGAAAGG - Intergenic
951760975 3:26147178-26147200 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
952037546 3:29221035-29221057 AGTAAAGGGTAGAATGAGAAAGG - Intergenic
952107544 3:30087602-30087624 GGGGAGGGGGAGGAGGAGGAGGG - Intergenic
952164619 3:30733632-30733654 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
952345124 3:32476638-32476660 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
952520627 3:34153120-34153142 AGGTGGGGGAAGAATGAGGGAGG + Intergenic
952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG + Intronic
953141790 3:40235817-40235839 AGGAAGGGGATGAATGGGGAAGG + Intronic
953170193 3:40500164-40500186 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
953365412 3:42340440-42340462 GGGGAGGGGGAGTAGGAGGAGGG + Intergenic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
954000106 3:47549898-47549920 TGGGAGGGGGAGGAGGAGGAAGG - Intergenic
954361203 3:50123804-50123826 GGGGAAGGGAAGACTGAGGAAGG + Intergenic
954411471 3:50373018-50373040 TGGGAGGGGTGGGAAGAGGAGGG + Intronic
954573499 3:51661772-51661794 AGGGAGGGAGAGAAAGAAGAAGG - Intronic
954911093 3:54110624-54110646 AGGGAAGGGGAGGAAGAGGAAGG - Intergenic
954962110 3:54575804-54575826 AGGCAGGGAGAGAAGGAGGAAGG + Intronic
955106558 3:55904521-55904543 AAAAAGGGGTAGAATGAGGTTGG - Intronic
955114563 3:55984571-55984593 AGGGAAGGGTGGGATGGGGAAGG - Intronic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955755699 3:62223043-62223065 AGGGTGTGGAAGAATGAGGCTGG + Intronic
955874654 3:63476403-63476425 AGGGAGGGAGAGAAGAAGGAAGG + Intronic
955927993 3:64026545-64026567 AGGAAGTGGTAGAAGCAGGAAGG - Intergenic
956162050 3:66365609-66365631 AGGGTGGGGGAGAAAGAGGCAGG + Intronic
956432427 3:69200609-69200631 AGGAAGGAGTAGAATTAGGGAGG - Intronic
956440926 3:69279752-69279774 GGGGAGGAGGAGAAGGAGGAGGG - Intronic
956468672 3:69542720-69542742 GGGGAGGGGGAGAGGGAGGAAGG + Intergenic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
956788324 3:72661092-72661114 AGGATGGGGCAGAAGGAGGAGGG + Intergenic
956864654 3:73357086-73357108 AGGGAGGGTCAGAAGAAGGAAGG - Intergenic
958117109 3:89234763-89234785 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
958117152 3:89234932-89234954 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958869094 3:99536027-99536049 AGGAATGGGTAGAATTAGAATGG - Intergenic
959623937 3:108428424-108428446 AGGGAGGGGAAGAAATGGGAGGG - Intronic
959687941 3:109167801-109167823 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
959754295 3:109878380-109878402 AGACAGGGGAAGAATGAAGAAGG + Intergenic
959934144 3:112012271-112012293 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
960018804 3:112925446-112925468 AGGGAGGAATAGAAAGAGCAAGG + Intronic
960902424 3:122565554-122565576 AGGGAGGGAAAGAAGGAAGAAGG + Intronic
961276590 3:125732081-125732103 AGGGAAGGGCACAGTGAGGAGGG - Intergenic
961279476 3:125754672-125754694 AGGGAGGGGCACAGTGAGCAGGG - Intergenic
961532430 3:127547697-127547719 GGGGAGGGGAAGGAAGAGGAGGG - Intergenic
962072167 3:132044611-132044633 AGGGAGGGGATGAAGGGGGAGGG + Intronic
962318771 3:134374588-134374610 AGGGAGCGGGAGAAGGCGGAGGG - Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962585654 3:136840513-136840535 AGGGAGGGAGAGAGAGAGGAAGG - Intronic
962619917 3:137167997-137168019 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
962619926 3:137168021-137168043 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
962619935 3:137168045-137168067 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
963204015 3:142614376-142614398 AGGCAGTGAAAGAATGAGGATGG + Intronic
963534703 3:146513154-146513176 AGGAAGGGGGAGAAGGAGGGAGG - Intergenic
963742977 3:149097961-149097983 AGGGAGGGGGAGGAGGGGGAGGG + Intergenic
964374419 3:156035537-156035559 AAGGAGGGGGAGGAAGAGGAAGG - Intergenic
965026858 3:163313525-163313547 AGGGAGGGAGAGAAAGAGGGAGG - Intergenic
965085374 3:164089048-164089070 TGGGAGGGGAAGAATGCAGATGG - Intergenic
965524555 3:169702190-169702212 AAGGAGGGGTGGAATGTAGATGG - Intergenic
965679181 3:171232862-171232884 AGGGAGGAGTTGAAGGAGTAGGG - Intronic
966272644 3:178126296-178126318 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
966381283 3:179347531-179347553 AGGGAGGGGAAGAAGTTGGAAGG + Intergenic
966396327 3:179507405-179507427 AAGGAAGGGAAGAAGGAGGAAGG + Intergenic
966683790 3:182671703-182671725 GGGGAGGGGTAGAAGGAGCAGGG + Intergenic
966854790 3:184186478-184186500 AGGGCGTGGTAGAACGAGGAAGG - Intronic
966861547 3:184233480-184233502 AGGGATGGGAAGGGTGAGGAAGG + Intronic
966959137 3:184915978-184916000 AGGGAGGGATAGAAGGAGGGAGG - Intronic
967332820 3:188308966-188308988 AGGGAGGAGGAGAAGGAGAAAGG - Intronic
967768773 3:193311546-193311568 GGGGAGGGAAAGAAGGAGGAAGG + Intronic
967964735 3:194951995-194952017 AGGGAGGGAGGGAGTGAGGAAGG + Intergenic
968126380 3:196163584-196163606 AAGGACGGGTAGAAGGAAGAGGG - Intergenic
968163310 3:196444618-196444640 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968940104 4:3633314-3633336 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969308070 4:6336792-6336814 AGGGAGGGATGGAAGGAGGGAGG - Intronic
969507056 4:7594602-7594624 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
969519554 4:7667954-7667976 AGGGAGGTGTGGCATGAGGCTGG - Intronic
969581896 4:8070753-8070775 AGGGAGTGGTTGACTGGGGAAGG + Intronic
969602249 4:8183228-8183250 AACGAGGGGGAGGATGAGGACGG - Intronic
969607827 4:8211273-8211295 CGGGAGGGGGAGAAGGAGGGAGG - Intronic
969607839 4:8211306-8211328 CGGGAGGGGGAGAAGGAGGGAGG - Intronic
969661759 4:8534161-8534183 AGGCAGGGGTGGAAGGAGGCAGG + Intergenic
969787068 4:9466833-9466855 AGGGAAGGGAACAATGAGCAGGG - Intergenic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
969842630 4:9893555-9893577 ACGGAGGGAGAGAATGAGGGAGG + Intronic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
969960841 4:10943547-10943569 CAGGAGGGGTAGAAGGAAGAGGG - Intergenic
970304642 4:14718785-14718807 AGGGAGGGCTAGCAGGAGGGTGG + Intergenic
971168049 4:24204495-24204517 AGGGAGGGGAAGAGAGGGGAGGG + Intergenic
971375171 4:26050399-26050421 TCAGAGGGGTAGAAAGAGGAAGG - Intergenic
971394314 4:26214494-26214516 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
971394322 4:26214514-26214536 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
971574540 4:28256593-28256615 AGGGAGGAGGAGGAGGAGGAGGG - Intergenic
971973175 4:33647693-33647715 ATGGTGGGGGAGAATGATGAAGG - Intergenic
971989452 4:33872674-33872696 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
972055552 4:34797417-34797439 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
972107213 4:35504155-35504177 AGGGAGGGATACAGAGAGGAAGG - Intergenic
972618485 4:40723191-40723213 TGCAGGGGGTAGAATGAGGATGG - Intergenic
972753284 4:42014915-42014937 TGGGAGGTGGAGAGTGAGGATGG + Intronic
973061783 4:45735451-45735473 AGGGAGGGAAAGAGAGAGGAAGG - Intergenic
973544353 4:51966080-51966102 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
973596035 4:52490762-52490784 AGGGAGGGAGGGAATGAGGGAGG + Intergenic
973739080 4:53901877-53901899 AGGGAGGGGTTGAGGGAGGGAGG + Intronic
973779059 4:54271569-54271591 AGGGAGGGAGAGAAGAAGGAAGG - Intronic
973849305 4:54945539-54945561 AGGGAGGGAGAGAAAGAGAAGGG + Intergenic
974020519 4:56688225-56688247 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
974083706 4:57237763-57237785 AGGGAGGGGTAGAGGGATGATGG + Intergenic
974099726 4:57403424-57403446 AGGGAGGGGAAGAATAGAGATGG + Intergenic
974318932 4:60318348-60318370 AGGGGTGGGAAGAATGGGGAGGG + Intergenic
974319588 4:60329561-60329583 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
974513272 4:62873545-62873567 AGAGGAGGGAAGAATGAGGAGGG + Intergenic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
975430270 4:74281716-74281738 AGGGAGGGAAAGAGAGAGGAAGG - Intronic
975646829 4:76554103-76554125 AGGGAAGGGTAGGATGAATATGG - Intronic
975702082 4:77075984-77076006 AGGGAGGGGAAGAGAGGGGAAGG + Exonic
975863664 4:78703774-78703796 AGGAGGGGGTAGTTTGAGGAAGG + Intergenic
975933365 4:79553856-79553878 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
975986443 4:80204968-80204990 AGGGAAGAGTAGAAAGAGGAGGG - Intergenic
976145949 4:82043239-82043261 AGGGCGGGGTAGAAAGACAAAGG + Intronic
976526041 4:86090097-86090119 AGGGAGGGGCAAAATGGGGAAGG + Intronic
976574298 4:86651382-86651404 AGGAAGGGATGGAAGGAGGAAGG - Intronic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
976873161 4:89821273-89821295 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
976892341 4:90065119-90065141 GGGTATGGGTAGGATGAGGAAGG + Intergenic
977115751 4:93025143-93025165 AGAGAGGGAGAGAAAGAGGAAGG + Intronic
977307299 4:95341561-95341583 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
977370401 4:96127136-96127158 AGGGAGGGAGAGAGGGAGGAGGG - Intergenic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
978157777 4:105509333-105509355 AGGGAGGGGAAGAAAAGGGAGGG + Intergenic
978240854 4:106514634-106514656 AGTGAGGGGTAGAATTTTGAGGG - Intergenic
979481094 4:121218593-121218615 AGGGACGGGGAGAAGGAGGAAGG - Intronic
979548993 4:121969214-121969236 AGGGAGGGAAAGAAGGAGGGAGG - Intergenic
979698541 4:123640925-123640947 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
979779936 4:124637939-124637961 AGCGAGGAAGAGAATGAGGATGG + Intergenic
980650897 4:135713727-135713749 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
980795759 4:137680482-137680504 AGGGAGGGGGAGAAAGTGAAGGG + Intergenic
980896968 4:138869084-138869106 AGAGAAGGGGAGAAGGAGGAGGG + Intergenic
981015972 4:139974855-139974877 AAGGACGGGTAGAATGTGAAAGG + Intronic
981086549 4:140689668-140689690 AGGGAGGGGAGGAAGGAGAAAGG - Intronic
981434428 4:144703472-144703494 ATGAAGGGGTAGGATGAGAAGGG + Intronic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
982946443 4:161630104-161630126 GGGGAGGGGAAGAAGGAGTAAGG - Intronic
983180003 4:164636517-164636539 GGGGAGGGATAGCATGGGGAGGG + Intergenic
983576489 4:169266634-169266656 GGGGAGGGGTAGCAGGGGGAGGG + Intronic
984014052 4:174405075-174405097 AGAGAGGGGGAGGAAGAGGAGGG - Intergenic
984703736 4:182833870-182833892 AGGGGAGGGGAGAAGGAGGAGGG - Intergenic
984762848 4:183377361-183377383 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
984830912 4:183972081-183972103 GGGAAGGGAGAGAATGAGGACGG - Intronic
984881386 4:184412737-184412759 AGGGAGGAAGAGAATGACGATGG - Intronic
984952738 4:185019098-185019120 GGGGTGGGGTAGAGAGAGGAGGG + Intronic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
985446529 4:190023825-190023847 AGGGAGGGAGAGAAGGAGGAGGG - Intergenic
985487267 5:158593-158615 AGGACGGAGTAGAACGAGGAGGG - Intronic
985487314 5:158721-158743 AGGAAGGAGTAGAACGAGGAAGG - Intronic
985756632 5:1723376-1723398 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
985774106 5:1831753-1831775 AGGGAGGGGCACAGAGAGGATGG - Intergenic
985800257 5:2001155-2001177 AGGGAGGGGGAGGAGGATGAAGG + Intergenic
985851589 5:2392474-2392496 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
985895929 5:2750160-2750182 AGGGAGGGGAAGAGGGAGTAGGG - Intronic
985957473 5:3276172-3276194 AGGGAGGGGAGGAAGGAGGGGGG + Intergenic
985957522 5:3276315-3276337 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
985957529 5:3276331-3276353 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
985957536 5:3276347-3276369 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
985957564 5:3276427-3276449 AGGGAGGGGAGGAAGGAGGGAGG + Intergenic
986087980 5:4471438-4471460 AGGGAAGGGTGCAATGAGGCTGG + Intergenic
986283988 5:6346549-6346571 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
986294018 5:6422598-6422620 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
986557301 5:9024864-9024886 AGGGAGGGGAAGAAAGAGAAAGG - Intergenic
986879040 5:12147657-12147679 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
986879048 5:12147681-12147703 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
987109529 5:14672348-14672370 TGGGAGGGCCAGACTGAGGAAGG - Intronic
987306258 5:16640588-16640610 AGGGAGGGGAGGGATGAGGAGGG + Intergenic
987388182 5:17350252-17350274 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
987920378 5:24272665-24272687 AGGGAGGGGGACAAGGTGGATGG - Intergenic
988171740 5:27666363-27666385 TGGAAGGGGTGGAGTGAGGAGGG + Intergenic
988623199 5:32844535-32844557 TGTGAGGTATAGAATGAGGAGGG + Intergenic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
988833051 5:35005602-35005624 AGGGAGGGATAAAATGGGCAAGG - Intronic
988855597 5:35225341-35225363 AGGGTGGGGGAGAAGGAAGAGGG + Intronic
989189393 5:38655321-38655343 AGGGAGGGAAGGAATGGGGAAGG - Intergenic
990180673 5:53156986-53157008 AGGGAAGAGTAGAATAAGGTTGG - Intergenic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990597898 5:57329627-57329649 AGGGAAGGGAAGAAGGAGAAGGG + Intergenic
991337640 5:65566750-65566772 AGGGAGGGAAAGAAAGACGAAGG - Intronic
991337648 5:65566791-65566813 AGGGATGGAGAGAATGAGGGAGG - Intronic
991433600 5:66573413-66573435 AGGGAGGGAGGGAGTGAGGAAGG + Intergenic
991605437 5:68396135-68396157 AGACAGTGGAAGAATGAGGAAGG + Intergenic
991606782 5:68410369-68410391 AAAGGGGGTTAGAATGAGGATGG - Intergenic
992052911 5:72956800-72956822 AGGGGTGGAAAGAATGAGGAAGG - Intronic
992067013 5:73118534-73118556 GGGGAAGGGAAGAATGAGTAGGG + Intergenic
992218436 5:74548047-74548069 AAGAAGGGGGAGATTGAGGAAGG + Intergenic
992226037 5:74620489-74620511 AAGGAGGGGTAGCATGCAGATGG + Intergenic
993283542 5:85959900-85959922 AGGGAGGGATGGAAGGAGGGAGG - Intergenic
993375062 5:87141086-87141108 AGGGAGGGGGAGAGGGAGGGAGG + Intergenic
993477000 5:88378562-88378584 AGGAAGGGAAAGAAAGAGGAAGG + Intergenic
993503260 5:88684864-88684886 AGGGAGGGGGAGAGGGAGAAAGG + Intergenic
993513756 5:88803633-88803655 AGGAAGAGGTATAATAAGGATGG - Intronic
993725977 5:91366897-91366919 GGGGAGTTGTAGAATGAGAAGGG - Intergenic
994198855 5:96949911-96949933 AGGGAGGGAGGGAAGGAGGACGG - Intronic
994240600 5:97415986-97416008 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
994356949 5:98803360-98803382 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
994367696 5:98934109-98934131 AGGCAGGGTTAGGAGGAGGAGGG + Intergenic
994439342 5:99783207-99783229 AGGGAGGGGGAGAAGGAGGGAGG - Intergenic
994731026 5:103490620-103490642 AGGGAGGGAGGGAAGGAGGAGGG - Intergenic
995105629 5:108374704-108374726 AGGGAGGTGAGGAAAGAGGAGGG + Intronic
995324495 5:110875198-110875220 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
995748405 5:115428118-115428140 AGGAAGGGTGAGACTGAGGAGGG + Intergenic
996853353 5:127977623-127977645 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
997554760 5:134786372-134786394 AGGCAGGGGAAGAGGGAGGAGGG - Intronic
997763320 5:136472384-136472406 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
997799251 5:136843389-136843411 AGGGACGGGGAGAAGGAGAAGGG - Intergenic
997877079 5:137559091-137559113 AGGGAGGGAGAGAAGGAGGGAGG + Intronic
998015600 5:138729509-138729531 AAGGAGGTGGAGAATGAGGGAGG + Intronic
998079384 5:139261959-139261981 AGGGAGGGAAGAAATGAGGAAGG + Intronic
998153057 5:139768199-139768221 GGGGAGGGGGAGGAAGAGGAGGG + Intergenic
998505439 5:142668456-142668478 AGGGAGGGGTGTCAAGAGGATGG - Intronic
999065660 5:148683119-148683141 AGAGAGGGGGAGAATGAGGGGGG + Intergenic
999231487 5:150064741-150064763 AGGGAGGGGATCAAGGAGGATGG + Intronic
999710525 5:154314428-154314450 ACTGAGGTCTAGAATGAGGAGGG - Intronic
999758536 5:154682906-154682928 AGGGCGGGGTAAAAGGAGGCGGG - Intergenic
999812809 5:155144005-155144027 AGGGAGGGAGAGAGGGAGGAGGG - Intergenic
999884434 5:155905414-155905436 AAGGAGGCTTAGAAAGAGGATGG + Intronic
1000422294 5:161052617-161052639 AGGAAGTAGTAGAATCAGGATGG - Intergenic
1000444177 5:161299617-161299639 AGGGAGAGAAAGAAAGAGGAAGG - Intronic
1000628726 5:163567774-163567796 AGGAAGGAAGAGAATGAGGAAGG - Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000951565 5:167489527-167489549 AGGGAGGGAGAGAATGCTGAAGG - Intronic
1000976816 5:167774183-167774205 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1000984891 5:167855840-167855862 AGGGAGGGAAGGAATGAGGGAGG + Intronic
1000984912 5:167855896-167855918 AGGGAGGGAGGGAATGAGGGAGG + Intronic
1000992935 5:167929216-167929238 AGGGAGGGATGGAGGGAGGAAGG + Intronic
1000997626 5:167974422-167974444 AGGGAGGGGTGGAGGAAGGAGGG + Intronic
1001003810 5:168031798-168031820 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
1001079097 5:168653858-168653880 GGGGTGGAGTAGGATGAGGAAGG - Intergenic
1001099683 5:168803999-168804021 AGGGAGGGAGAAAATGATGAAGG + Intronic
1001203549 5:169741248-169741270 AGGGAAGGGATGAATTAGGAAGG + Intronic
1001253352 5:170165374-170165396 AGGGAGGGAGAGCAGGAGGAAGG - Intergenic
1001648801 5:173301218-173301240 AGGGAGGGGAAGGGAGAGGAGGG - Intergenic
1001774711 5:174320516-174320538 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1001774720 5:174320540-174320562 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1001774734 5:174320580-174320602 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1001774741 5:174320600-174320622 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1001774755 5:174320640-174320662 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1001774764 5:174320664-174320686 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1001774791 5:174320746-174320768 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1001774800 5:174320770-174320792 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1001774809 5:174320794-174320816 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1001963604 5:175895078-175895100 TGGGAGGGGTAGAATAGGCAGGG - Intergenic
1002054255 5:176589637-176589659 AGGGAGGGGTAGGAAGAACAGGG + Intronic
1002154427 5:177265482-177265504 AGGGAGGGAGAGAGAGAGGAAGG + Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002458288 5:179358574-179358596 AGGGAGGGAGGGAATGAGGGAGG - Intergenic
1002559190 5:180070076-180070098 GTGGAAGGGTAGAAAGAGGAAGG - Intronic
1002566743 5:180116437-180116459 AGGGAGGGAAGGAAGGAGGAAGG - Intronic
1002697011 5:181098391-181098413 AGGGAGGGGAGGGGTGAGGAGGG + Intergenic
1002697044 5:181098461-181098483 AGGGAGGGGAGGGGTGAGGAGGG + Intergenic
1002773239 6:307262-307284 AGGGAGGGGAGGAAGGAGAAGGG - Intronic
1002917695 6:1542138-1542160 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1002921023 6:1573506-1573528 AGGAAGGGATACAATGAGGTAGG + Intergenic
1002943747 6:1741327-1741349 AGGGATGGGTGGAAAGAGGCTGG - Intronic
1003004266 6:2366414-2366436 AAGGAAGGGAAGAAAGAGGAAGG + Intergenic
1003067818 6:2918476-2918498 GGGGATGGGTAAAATGAGGCTGG + Intergenic
1003208732 6:4039827-4039849 AGGGAGGGGTGGGGTGGGGAGGG - Intronic
1003311340 6:4972116-4972138 AGGGAAGCGTGGAATGAGGGAGG + Intergenic
1003387141 6:5679349-5679371 AGGGAAGGGTAGAAGGAGGCTGG - Intronic
1003551306 6:7104494-7104516 GGGGAGAGGTGGAAAGAGGAGGG + Intergenic
1003604824 6:7549768-7549790 AGGGAGAGATGGAAAGAGGAAGG + Intronic
1003708784 6:8565616-8565638 AGGCAGGTGGAGATTGAGGAGGG + Intergenic
1003709851 6:8577046-8577068 AGGGAGGGGTAGGGCGAGGAGGG - Intergenic
1003746051 6:9003955-9003977 AGGGAGAGGGAGGAAGAGGAGGG - Intergenic
1003893839 6:10588119-10588141 AGAGAGGGACAGAAAGAGGATGG + Intronic
1004001487 6:11600841-11600863 AGGGAGGTCTGGAAGGAGGACGG - Intergenic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004239593 6:13907984-13908006 AGGGAGGAAGGGAATGAGGAAGG - Intergenic
1004322073 6:14639740-14639762 AGGGAGGGGTAGAAAAATGTGGG + Intergenic
1004359388 6:14957527-14957549 AGGGAGGGGTGGTATGATGTTGG + Intergenic
1004475832 6:15970250-15970272 AGGTAGGGGAAGAATAAGCAGGG - Intergenic
1005081924 6:21965306-21965328 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081929 6:21965321-21965343 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081934 6:21965336-21965358 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081939 6:21965351-21965373 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081944 6:21965366-21965388 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081949 6:21965381-21965403 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005290698 6:24375879-24375901 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1005419127 6:25630996-25631018 TGGGAGAGGTGGAGTGAGGAAGG + Intergenic
1006105543 6:31714111-31714133 AGGGAGGGGGAGGAGTAGGAGGG - Intronic
1006110637 6:31742787-31742809 GGAGAGGGGTAGGAAGAGGAGGG + Intronic
1006169166 6:32083201-32083223 AGGGAGGGGCAGAACCAGGGAGG - Intronic
1006387484 6:33739410-33739432 GGGAAGGGGCAGAAGGAGGAGGG + Intronic
1006437763 6:34035084-34035106 TGTGAGGGGTAGATGGAGGAGGG + Intronic
1006445992 6:34080051-34080073 AGGCAGGGGCAGAATGAGTGAGG - Intronic
1006520857 6:34570345-34570367 AGCGAGGGGGTGAAGGAGGAGGG - Intergenic
1006616151 6:35328493-35328515 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1006716342 6:36123113-36123135 AGGGAGGGAAGGAAAGAGGAAGG + Intergenic
1006789098 6:36686913-36686935 AGGGATGGGGTGGATGAGGAAGG - Exonic
1006944763 6:37777918-37777940 AGGGGGTGGTAGAAGGAGAAGGG + Intergenic
1007076652 6:39072611-39072633 AGAGAAGGATAGAATGTGGATGG + Intronic
1007275380 6:40669473-40669495 TGGGAGGGGTTGAGTCAGGAGGG + Intergenic
1007553451 6:42746944-42746966 AGGGCAGGGAAGAAAGAGGAAGG - Intronic
1007594311 6:43042080-43042102 AGGGAGGGAGAGAAGGAGGGAGG + Intronic
1007594526 6:43043346-43043368 AGGGAGGGGAAGGATGGGGATGG + Intronic
1007747328 6:44051275-44051297 AGGGAGGGCTGGCATTAGGATGG + Intergenic
1007823429 6:44579318-44579340 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1008047984 6:46871391-46871413 TGGGAGAGGAGGAATGAGGAAGG + Intronic
1008376442 6:50796996-50797018 AGAGTGGGGATGAATGAGGATGG + Intergenic
1008548667 6:52605974-52605996 AGGGAGGGGAACAAAGGGGAGGG - Intergenic
1008558345 6:52697602-52697624 AGGGAGGGGTAGGACATGGAAGG - Intergenic
1008558825 6:52703440-52703462 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1008930361 6:56932516-56932538 AGGGTGGGAGAGAAGGAGGAGGG + Intronic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009782879 6:68293066-68293088 AGGAAGAGGAAGAATGGGGAGGG + Intergenic
1009860665 6:69326840-69326862 AGGGAGGATAAGGATGAGGAGGG + Intronic
1009948359 6:70366066-70366088 AAGGAGGGATAGAGGGAGGAAGG + Intergenic
1010168159 6:72941495-72941517 AGGGAGGGAGAGAAAAAGGAAGG - Intronic
1010168179 6:72941566-72941588 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1010386365 6:75284853-75284875 AGGGAGGGAGAGAGGGAGGAGGG + Exonic
1010922789 6:81704753-81704775 AGGGAGGGAGGGAAAGAGGAAGG + Intronic
1010951992 6:82048246-82048268 AGTGAGGGTTAGAAGGGGGAAGG - Intergenic
1011152151 6:84286303-84286325 AGGGAGAGAGAGAAAGAGGAAGG - Intergenic
1011195747 6:84777523-84777545 AGGAAGTGGCAGGATGAGGAAGG - Intergenic
1011254390 6:85405892-85405914 GAGTAGGGGGAGAATGAGGATGG - Intergenic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1012170860 6:96015738-96015760 AGGGTAGGGTAGAAGGAGGGCGG + Intergenic
1012329087 6:97961815-97961837 AGGGAGGGAGGGAGTGAGGAAGG - Intergenic
1012362557 6:98400982-98401004 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1012697668 6:102408613-102408635 AGGGAGGGAGGGAATGAAGAAGG - Intergenic
1012945512 6:105461467-105461489 TGGGAGGGGTAGCATGCAGACGG - Intergenic
1013123276 6:107159314-107159336 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013424443 6:109998262-109998284 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1014433089 6:121392043-121392065 TGGGAGGGGTAGAGGAAGGATGG + Intergenic
1014743099 6:125169010-125169032 AAGCAGGGGTAGAGAGAGGAAGG - Intronic
1014964532 6:127730513-127730535 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1015112468 6:129609085-129609107 ATGGAGGGAAAGAATGAGGGGGG + Intronic
1015424413 6:133049321-133049343 AGGGAGGGAAAGAAGAAGGAAGG - Intergenic
1015424431 6:133049369-133049391 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
1016124015 6:140376602-140376624 AGGGAGGGGGAGAAAGAGAAAGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1016573961 6:145546825-145546847 TTGAAGGGGTAAAATGAGGAGGG - Intronic
1016890863 6:149005598-149005620 AGGGAGGGAGAGAAGAAGGAAGG - Intronic
1017140044 6:151182196-151182218 AGGGAGGGGAGGTAAGAGGAGGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017538389 6:155373157-155373179 AGGGAGGGAGAAAAGGAGGAAGG - Intergenic
1017685163 6:156906131-156906153 AGGGAGTGGCATCATGAGGAGGG + Intronic
1017770101 6:157638298-157638320 AGGAAGGAGTAGGAGGAGGACGG - Intronic
1017870381 6:158481699-158481721 AGGGAGGGGTAGGAGGCTGAAGG - Intronic
1017880077 6:158556482-158556504 AGGGAGGTATAGAAAGATGAAGG + Intronic
1017887566 6:158611596-158611618 AGGGATTGGTAGGATGTGGAGGG + Intronic
1017988701 6:159467509-159467531 GGGGAGGGGAGGAAGGAGGAAGG + Intergenic
1018012675 6:159685966-159685988 ATGGAGGCGTAGAAGAAGGAGGG - Intronic
1018038080 6:159898665-159898687 AGGGAGGAGGAGGAAGAGGAAGG - Intergenic
1018352537 6:162975825-162975847 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1018577109 6:165270546-165270568 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
1018779149 6:167046325-167046347 AGGGAGGGAGAGAAGGAGAAAGG + Exonic
1018813862 6:167316685-167316707 GGGGAGGGGGAGGAAGAGGAAGG - Intergenic
1018978414 6:168582939-168582961 AAGGAGGGGGAGATTGAGGGAGG - Intronic
1019110652 6:169709529-169709551 AGGGAGGGGCAGACAGAGGGAGG + Intronic
1019144841 6:169969959-169969981 AGTGAGAGGTAGAAGGAGGCTGG + Intergenic
1019158259 6:170052909-170052931 AGGGAGGGATAGAGGGGGGAGGG - Intergenic
1019273944 7:166192-166214 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1019315533 7:382563-382585 AGGGAGGGAGGGAAGGAGGAGGG + Intergenic
1019334920 7:478533-478555 AGGGAGGGAGAGAAGGAAGAAGG + Intergenic
1019511027 7:1417352-1417374 AGGAAGGGGCAGAAAGGGGATGG - Intergenic
1019563811 7:1670140-1670162 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1019908591 7:4083640-4083662 AGGGAGGGGTGGAGGAAGGAAGG - Intronic
1019947688 7:4343052-4343074 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1019968832 7:4523908-4523930 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
1020125794 7:5531866-5531888 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1020126247 7:5533957-5533979 AGGGAGGGGCAGTGTGAGGCAGG - Intronic
1020454602 7:8357489-8357511 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1020745779 7:12076172-12076194 AGGGATGGGTGGAATGGGGAAGG + Intergenic
1020756592 7:12211265-12211287 GGGGAGGGGTAGGATAACGACGG - Intronic
1021258230 7:18421370-18421392 AGGGAGGGATGGAAGGAGAAAGG + Intronic
1021417375 7:20403761-20403783 AGGGAGGGAAGGAAGGAGGAAGG + Intronic
1021899389 7:25268484-25268506 ACGGAGGGGTTGAAGGAGGTTGG + Intergenic
1022108973 7:27216321-27216343 AAGGAGGGGTAGAGGGAGGTGGG + Intergenic
1022208898 7:28189251-28189273 TGGGACGGGGAGAGTGAGGATGG - Intergenic
1022282462 7:28924980-28925002 AGGGAGGGGAGGAAGAAGGAAGG + Intergenic
1022291254 7:29005786-29005808 AGGGAAGGAGAGAATGAGGATGG - Intronic
1022323875 7:29312296-29312318 AGGGAGGGAGAGAATGAGGTAGG - Intronic
1022327009 7:29341571-29341593 AGGGAGGGACAGAAAGAGGGAGG + Intronic
1022441097 7:30434057-30434079 AGAATGAGGTAGAATGAGGAGGG + Intronic
1022629494 7:32071466-32071488 AGGGAGGGAGGGAATGAGGGAGG - Intronic
1023148227 7:37174123-37174145 AAGTTGGGGTAGAATGGGGAAGG - Intronic
1023356588 7:39373256-39373278 AGAGAGGGGTACAAAGAAGATGG + Intronic
1023403917 7:39811813-39811835 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1023565705 7:41522006-41522028 AGGGAGGGAGAGAAGGAGGAAGG + Intergenic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1023611949 7:41980653-41980675 AGGAAAGGGAAGAATAAGGAAGG + Intronic
1023747587 7:43336056-43336078 AGGGAGGGGAAGAAAGAGAGAGG - Intronic
1023823775 7:43995103-43995125 AGGGTGGGGAAGACTGGGGATGG + Intergenic
1023991681 7:45132528-45132550 AGGGAGGGAAAAAAGGAGGAAGG + Intergenic
1024507022 7:50170399-50170421 AGGGAGGGATGGAAGGAGGGAGG + Intergenic
1024507031 7:50170423-50170445 AGGGAGGGAAAGAGGGAGGAAGG + Intergenic
1024586966 7:50850215-50850237 GGAGAGGGGGAGAATGTGGAAGG - Intergenic
1024630771 7:51244998-51245020 AAGGAGGTGTGGAAAGAGGAAGG - Intronic
1024731127 7:52254965-52254987 ATGGAGGGGTAGAAAGAAAAAGG + Intergenic
1024833378 7:53487690-53487712 AGGGAGGGAAAGAAGAAGGAAGG - Intergenic
1024999560 7:55303691-55303713 GGGGAGGGGAAGGAAGAGGAGGG + Intergenic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1026002962 7:66577054-66577076 AAGGAGGGAATGAATGAGGAAGG + Intergenic
1026011814 7:66642249-66642271 AGGCAGAGGTAAAATAAGGAAGG - Exonic
1026133116 7:67636715-67636737 AGGGAGGGAAAAAAGGAGGAAGG - Intergenic
1026178235 7:68016417-68016439 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026238016 7:68545739-68545761 GGGGAGGGGGAGGAGGAGGAGGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026589032 7:71680307-71680329 AGGAAGGGATAGAGGGAGGAAGG - Intronic
1026589150 7:71680713-71680735 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1026605910 7:71815747-71815769 AGGGAAGGAAAGAAGGAGGAAGG - Intronic
1026837648 7:73649100-73649122 AGGGAGAGAGAGAAAGAGGAGGG - Intergenic
1026917778 7:74132524-74132546 AGGGAGGGCGGGAAGGAGGAAGG - Intergenic
1027348712 7:77288506-77288528 GTGTAGGGGTAGACTGAGGAAGG - Intronic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1027528139 7:79296733-79296755 AGGAGAGGGGAGAATGAGGAAGG + Intronic
1027545203 7:79519115-79519137 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1027688962 7:81317673-81317695 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1028052753 7:86206728-86206750 AGGGAGGGGAAGGGTGGGGAAGG + Intergenic
1028052794 7:86206816-86206838 AGGGAGGGGAAGGAAGGGGAAGG + Intergenic
1028096216 7:86764217-86764239 AGGGAGAGGTAGTGGGAGGATGG + Intronic
1028284436 7:88978779-88978801 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1028476938 7:91264251-91264273 AGGGCGGGGTAGGAGGAGGCGGG - Intergenic
1028531041 7:91839140-91839162 AGGTAGGGGGAAAATTAGGAGGG - Intronic
1029141674 7:98415180-98415202 AGGGAGGGGGAGAGAGAGGAGGG + Intergenic
1029158880 7:98537082-98537104 AGGGAGGGGGAAAGGGAGGATGG + Intergenic
1029162024 7:98559359-98559381 AGGGAGGGAAAGAAAGAAGAAGG - Intergenic
1029178711 7:98683890-98683912 AGGGAGGGAGAGAGAGAGGAAGG - Intergenic
1029374610 7:100170257-100170279 TGAGAGGGAGAGAATGAGGATGG + Exonic
1029375083 7:100172222-100172244 AGGGAGGGAGAGAAAGAGAAAGG + Intronic
1029584862 7:101463825-101463847 AGGGAGGGAAGGAAGGAGGAAGG - Intronic
1029642854 7:101832123-101832145 AAGGCGGGCTAGAGTGAGGAGGG + Intronic
1029661690 7:101966650-101966672 AGGGAAGGATAGAAAGAGCATGG + Intronic
1029745109 7:102512281-102512303 AGGGATGGGTAGAGAGAGAAAGG + Intronic
1029745132 7:102512353-102512375 AGGGAGGGGCAGAAAGGGAAGGG + Intronic
1029745172 7:102512473-102512495 AGGGAGGGGGAGAGAGAGGGAGG + Intronic
1029745183 7:102512519-102512541 AGGGAGGGGGAGACTGAGTGAGG + Intronic
1029745255 7:102512769-102512791 AGGGAGGGGGAGACTGAGTGAGG + Intronic
1029745280 7:102512843-102512865 AGGGAGGGGGAGACTGAGGGAGG + Intronic
1029752042 7:102548516-102548538 AGGGTGGGGAAGACTGGGGATGG + Intronic
1029763101 7:102611442-102611464 AGGGATGGGTAGAGAGAGAAAGG + Intronic
1029763124 7:102611514-102611536 AGGGAGGGGCAGAAAGGGAAGGG + Intronic
1029763164 7:102611634-102611656 AGGGAGGGGGAGAGAGAGGGAGG + Intronic
1029763175 7:102611680-102611702 AGGGAGGGGGAGACTGAGTGAGG + Intronic
1029763221 7:102611822-102611844 AGGGAGGGGGAAACTGAGGGAGG + Intronic
1029769994 7:102647610-102647632 AGGGTGGGGAAGACTGGGGATGG + Intronic
1029873455 7:103721210-103721232 AAGGAAGGGTGGAAGGAGGAAGG - Intronic
1030035320 7:105403846-105403868 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1030035518 7:105405310-105405332 AGGGCAGGGGAGAAGGAGGAGGG + Intergenic
1030365499 7:108641358-108641380 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1030745537 7:113161094-113161116 CTGGAATGGTAGAATGAGGATGG - Intergenic
1030902040 7:115136738-115136760 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1030952799 7:115813031-115813053 GGGGAGGGGTGGAGGGAGGAGGG - Intergenic
1031168465 7:118260678-118260700 AGGGAGGGAGAGAAGGAGGGAGG - Intergenic
1031214838 7:118877201-118877223 GGGGAGGGGAAGAAGGAGAAGGG + Intergenic
1031697283 7:124874031-124874053 AGGGAAGCGGAGAATAAGGATGG - Intronic
1031745733 7:125495533-125495555 AGGGAGGTGCAGAATTACGAGGG - Intergenic
1031854629 7:126907299-126907321 AGGGAGGAGGAGGAAGAGGAAGG + Intronic
1032566404 7:132951326-132951348 AGGGAGGGGTGCAAGGAGAAGGG + Intronic
1032949897 7:136895690-136895712 AGCGAGGAGTAGGGTGAGGAGGG - Intronic
1032996115 7:137448556-137448578 AGGGAGGGAGAGAAGGAGGAGGG + Intronic
1033002558 7:137523092-137523114 AGGAAGGGAGAGAATGAGGGAGG + Intronic
1033098857 7:138453690-138453712 GGGGAGGGGAAGACTGGGGAGGG + Intergenic
1033137652 7:138798249-138798271 TGGGAGGGAAAGAAGGAGGAGGG + Intronic
1033263675 7:139865872-139865894 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033785400 7:144723983-144724005 AGGGCAGGGTAGAATGAGGTAGG - Intronic
1034214840 7:149397544-149397566 AGAGAGGGGAAGAGAGAGGAGGG - Intergenic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422289 7:150996196-150996218 TGGGACGGGGAGAAGGAGGAAGG - Intronic
1034538829 7:151743162-151743184 AGGGAGGGGCTGAAAAAGGAAGG + Intronic
1034720748 7:153290119-153290141 AGGGCGGGGGAGGAGGAGGAGGG + Intergenic
1035226765 7:157438121-157438143 GGGGAGGGGAAAGATGAGGAGGG - Intergenic
1035226772 7:157438141-157438163 GGGGAGGGGAAAGATGAGGAGGG - Intergenic
1035226779 7:157438161-157438183 GGGGAGGGGAAAGATGAGGAGGG - Intergenic
1035331868 7:158101844-158101866 AGGGTGGGCCAGAATGAAGAAGG - Intronic
1035470642 7:159106736-159106758 AGGGAGGGGCAGAGAGAGGCTGG + Intronic
1035552075 8:536164-536186 ACTGAAGGGTAGAATGATGAGGG - Intronic
1035673069 8:1434847-1434869 AGGGAGGGGAGGAAGGATGAAGG - Intergenic
1035722044 8:1799288-1799310 AAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1036546097 8:9771349-9771371 AGGGAGGGAGAGAGAGAGGAAGG + Intronic
1036546121 8:9771460-9771482 AGGGAGGGAGAGAAGAAGGAAGG + Intronic
1036743798 8:11389978-11390000 AGGGATGGGTGGGAGGAGGATGG + Intergenic
1036767302 8:11557003-11557025 AGGGAGGGTGAGAAACAGGAGGG + Intronic
1037045712 8:14300373-14300395 AGGGAGGAAGGGAATGAGGAAGG + Intronic
1037462948 8:19131504-19131526 AGAGAGGAGTAGAGGGAGGAAGG + Intergenic
1037474041 8:19238758-19238780 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1037757354 8:21719763-21719785 AGGGAGGGGAAGGGTGGGGAGGG - Intronic
1037878477 8:22561175-22561197 AGGGAGGGAAGGAATTAGGAGGG - Intronic
1037888582 8:22608695-22608717 AGGGAGAGTGAGACTGAGGAAGG - Intronic
1037930656 8:22878215-22878237 AGGGAGGGGGAGAGGGAGGGAGG + Intronic
1038252421 8:25917744-25917766 GGGGAGGGGAAGGATGGGGAAGG - Intronic
1039048092 8:33468293-33468315 AGGGAGAGGGAGGAGGAGGAGGG - Intronic
1039124329 8:34184091-34184113 AGGGAGGTCTAGAATGATAATGG + Intergenic
1039125036 8:34191798-34191820 AGGGAGGGGAAGGAAGGGGAGGG - Intergenic
1039598527 8:38812752-38812774 ATGAAGGGGAAAAATGAGGATGG - Intronic
1039691292 8:39867639-39867661 AAGGAGGGGGAGGAGGAGGAAGG - Intergenic
1040079814 8:43275033-43275055 AGAGAGGGGAAGCAGGAGGAGGG - Intergenic
1040575430 8:48647407-48647429 AGTGAGGGGTGGTGTGAGGATGG + Intergenic
1040624660 8:49133323-49133345 AAGGAGGGGGATAAGGAGGAAGG + Intergenic
1041242926 8:55863671-55863693 AGGGAGGGGAGGGAAGAGGAGGG + Intergenic
1041291170 8:56310133-56310155 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041291181 8:56310165-56310187 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041570112 8:59328378-59328400 AAGGAGGGGAAGGAGGAGGAAGG - Intergenic
1042191235 8:66189646-66189668 AGGGAGGGGTGGTATGGGGTGGG - Intergenic
1042602191 8:70509973-70509995 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1042758206 8:72241746-72241768 AGAGAGGGAGAGAAAGAGGAAGG + Intergenic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1043058110 8:75466493-75466515 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1043094240 8:75946411-75946433 AGGGAGGGATAGAGGAAGGAAGG - Intergenic
1044821940 8:96160867-96160889 CGGGAGGGGAGGAATGGGGAGGG + Intergenic
1044983244 8:97736375-97736397 AGGGAGGGGGAGGAGGGGGAGGG + Intergenic
1045130012 8:99140624-99140646 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1045423885 8:102043718-102043740 AGGGAGGGGGAGGAGGAGGATGG + Intronic
1045554932 8:103206774-103206796 AGGGAGGGAGAGAAGCAGGATGG + Intronic
1045972587 8:108096028-108096050 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1046023908 8:108699216-108699238 AGGGAGGGAGAGAAGGAGGGAGG - Intronic
1046588478 8:116176558-116176580 AGGGAGGGAGAGAGAGAGGAAGG + Intergenic
1046612909 8:116445311-116445333 GGGGAGGGGCAGAAGGTGGAGGG + Intergenic
1046776007 8:118164096-118164118 AGGGAGGAGTAGGAAGAGGAGGG + Intergenic
1047043059 8:121020262-121020284 AAGGATGGGTATAATGAGGGTGG + Intergenic
1047061837 8:121235728-121235750 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1047069286 8:121324857-121324879 AGGGAGGGAGAGAAAGAGGGAGG - Intergenic
1047126326 8:121965200-121965222 ATAGAGGGCTAGCATGAGGAGGG - Intergenic
1047481233 8:125285410-125285432 AGGGAGGGGAGGAGGGAGGAAGG - Intronic
1047779527 8:128100114-128100136 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
1047879012 8:129171827-129171849 AGGGAGGGAAAGAGGGAGGAAGG - Intergenic
1047927643 8:129697012-129697034 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
1047928609 8:129704441-129704463 AGGGAGGGGCAGAAGGAAAAAGG - Intergenic
1048007638 8:130432027-130432049 AAGGAGGGGGAAAATGAGGTGGG + Intronic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048155889 8:131950566-131950588 AGCTAGGGGTAGAATGAGAGAGG - Intronic
1048224487 8:132571538-132571560 AGGGAGGGGAAGAAGGAGCAGGG + Intergenic
1048363159 8:133715348-133715370 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1048524031 8:135184821-135184843 AGGGAGGAATAGAATGTGCAAGG - Intergenic
1048833554 8:138497744-138497766 AGGGAGAGGAAGATTGGGGAGGG + Intergenic
1049311768 8:141937353-141937375 AGGGAAGGGAAGAGGGAGGAGGG - Intergenic
1049331698 8:142058008-142058030 AGGAAGGGGAAGAAGGAAGAGGG + Intergenic
1049440464 8:142607239-142607261 AGGGAGGGGAAGAGAGGGGAGGG + Intergenic
1050121933 9:2316946-2316968 AGGGAAGGGAAGCATGAGAAGGG - Intergenic
1050312787 9:4370342-4370364 AGGGAAGGGTAGGAGGAGCAGGG - Intergenic
1050357777 9:4799101-4799123 AGGGAGGGAGAAAAAGAGGAAGG - Intronic
1050368097 9:4891195-4891217 AGGGAGGGAGGGAAGGAGGAAGG - Intergenic
1050610270 9:7344828-7344850 AGGGAGGGGTGGAGGAAGGAGGG + Intergenic
1050707207 9:8414906-8414928 AGGGAGGGGGAGAGAGAGGGAGG + Intronic
1051039634 9:12791622-12791644 AGGGCGGGGGAGAATGAGAAAGG - Intronic
1051216409 9:14802978-14803000 AGGGAGGGAGGGAAAGAGGAAGG - Intronic
1052087505 9:24286404-24286426 AGGGAGGGGAAGAGAGGGGAAGG - Intergenic
1052161558 9:25266957-25266979 AGGGAGGGGTAGAGAGAGAGAGG + Intergenic
1052452121 9:28644524-28644546 AGGGAAGGGTAGTAGGGGGAGGG + Intronic
1052465012 9:28819338-28819360 GGGGAGGGGAAGAAGGATGATGG - Intergenic
1052473612 9:28930689-28930711 AGGGAAGGATACAAGGAGGAAGG + Intergenic
1052638726 9:31136321-31136343 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1052903767 9:33817125-33817147 AGGGAGGGAGAGAGGGAGGAGGG - Intergenic
1052976781 9:34417030-34417052 GGGAAGGGGAAGAAGGAGGAGGG - Intronic
1053041537 9:34877866-34877888 AGGGAGGGGGAGATAGGGGAGGG - Intergenic
1053361023 9:37486592-37486614 AGGGAGTGTCAGAATGGGGATGG - Intronic
1053472254 9:38355199-38355221 AGGGAGGGGGAGAAGGAGGGAGG + Intergenic
1053485919 9:38456202-38456224 AGGCAGGGGAAGGGTGAGGAGGG + Intergenic
1053540619 9:38970082-38970104 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1053553347 9:39107367-39107389 AGGGAGGGAGAGAAAGAGGGAGG + Intronic
1053580526 9:39399388-39399410 AGGGAGGGAAGGAAAGAGGAAGG - Intergenic
1053771430 9:41482418-41482440 AAGGAGGGGGAGAAGGAAGAAGG - Intergenic
1053845022 9:42227466-42227488 AGGGAGGGAAGGAAAGAGGAAGG - Intergenic
1054102113 9:60958193-60958215 AGGGAGGGAAGGAAAGAGGAAGG - Intergenic
1054107710 9:61071195-61071217 AGGGAGGGAGAGAAAGAGGGAGG + Intergenic
1054450653 9:65401975-65401997 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1054584246 9:66948670-66948692 AGGGAGGGAAGGAAAGAGGAAGG + Intergenic
1054613147 9:67259930-67259952 AGGGAGGGAGAGAAAGAGGGAGG - Intergenic
1054625520 9:67393824-67393846 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1054868866 9:70030842-70030864 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1054935828 9:70686742-70686764 AGGGAGGGAGAGAAGGAGGAAGG - Intronic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055713096 9:79086905-79086927 AGGGAGGGAGAGAAGGAGGGAGG + Intergenic
1055778345 9:79790937-79790959 AGGGTGGGGCAGGATGAGGGTGG + Intergenic
1055786951 9:79881521-79881543 AGGGAGGGAAAGGATGGGGAGGG - Intergenic
1056004709 9:82256636-82256658 AGGGAGGGGTAGAAAAGAGAAGG - Intergenic
1056045238 9:82707848-82707870 AGGGAGGGCTAGCATAAGCAGGG + Intergenic
1056292528 9:85158085-85158107 AGGGAGGGAGGGAAAGAGGAGGG - Intergenic
1056381772 9:86062686-86062708 AGGGAGGGGAGGCAGGAGGAAGG + Intronic
1056455300 9:86753905-86753927 AGTGTGGGATTGAATGAGGAAGG - Intergenic
1056523155 9:87418746-87418768 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1056523173 9:87418826-87418848 AGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1056587944 9:87940396-87940418 CGGGAGGGGTAAAAAGAGGGTGG + Intergenic
1056589027 9:87951036-87951058 TGGGTGGGGGAGACTGAGGAGGG + Intergenic
1056666179 9:88582623-88582645 AGGGAGGGGAGGAGGGAGGAAGG - Intronic
1056672547 9:88642827-88642849 AGGGAGGGGGAGAAGGAGAAGGG - Intergenic
1056851355 9:90087176-90087198 AGGGAGAGATGGAAGGAGGAAGG + Intergenic
1056882333 9:90408202-90408224 TTTGAGGGGTAGAAAGAGGAAGG + Intergenic
1056897562 9:90565255-90565277 AGGGAAGGGGAGAAGGAGGAGGG - Intergenic
1056954577 9:91072069-91072091 AGGGAGGGAGAGAGTGAGGGAGG + Intergenic
1057013890 9:91633134-91633156 GGGGAGGGGAAGAAAGGGGAGGG + Intronic
1057023991 9:91722227-91722249 AGGGAGGGGGTGAAAGAGAATGG - Intronic
1057459428 9:95246266-95246288 AGGGTGGGGTAGAGTGAGGGAGG + Intronic
1057565023 9:96159966-96159988 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1057822745 9:98344985-98345007 AGGCAGGTGTGGAATGAGAATGG - Intronic
1058330605 9:103755605-103755627 ATGGAATGGTAGAATGAGGTAGG - Intergenic
1058669270 9:107346920-107346942 AGGGAAGGGAGGAAGGAGGAAGG + Intergenic
1058774954 9:108273879-108273901 AGGGAGGGGCTGAACCAGGATGG - Intergenic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1058960478 9:109988625-109988647 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1059072427 9:111152831-111152853 AGGGAGGAGGAGGAAGAGGAAGG + Intergenic
1059075730 9:111191986-111192008 AAGGAAGGGTAGAGTAAGGAAGG + Intergenic
1059352891 9:113678107-113678129 AGGGAGGGAAAGAAAGAAGAAGG - Intergenic
1059431205 9:114251406-114251428 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1059733068 9:117075497-117075519 GGGGAGGGGGAGGAGGAGGAGGG + Intronic
1060720936 9:125976874-125976896 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1060878853 9:127103638-127103660 AGGGAGGGGGAGCATGATGTTGG + Intronic
1060977931 9:127776364-127776386 GGGTGGGGGTGGAATGAGGAGGG + Intronic
1061078375 9:128355373-128355395 AGGGAGGGGCCGGATGAGGCAGG - Intronic
1061246165 9:129402165-129402187 AGGGTGGGGAGGAGTGAGGAGGG - Intergenic
1061282020 9:129602885-129602907 GAGGAGGGGGAGAATGAGGGAGG + Intergenic
1061524703 9:131149777-131149799 GGGCAGGGGTAGAGTCAGGAAGG - Intronic
1061650389 9:132043405-132043427 GGAGAGAGGGAGAATGAGGAGGG + Intronic
1061853550 9:133429442-133429464 ATGGAGGGGTGGATGGAGGAGGG - Intronic
1061916175 9:133755642-133755664 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1061959201 9:133979448-133979470 AGGCAGGGGCTGCATGAGGACGG + Intronic
1062071489 9:134557491-134557513 AGGGAGGTTTTGAATGAGCAAGG + Intergenic
1062080858 9:134622650-134622672 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062080889 9:134622751-134622773 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062080920 9:134622850-134622872 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062153256 9:135032318-135032340 AGGGCGGGGGAGGAGGAGGAGGG - Intergenic
1062185757 9:135217646-135217668 AGACAGAGGTAGAAGGAGGAGGG - Intergenic
1062449099 9:136608137-136608159 AGGGAAGGAGAGAAGGAGGAGGG + Intergenic
1062449116 9:136608183-136608205 AGGGAAGGAGAGAAGGAGGAGGG + Intergenic
1062596165 9:137300761-137300783 AGGGAGAGGGAGAAGGAGGGAGG + Exonic
1062703970 9:137924372-137924394 AGGGAGGGAAGGAAGGAGGAGGG - Intronic
1203490551 Un_GL000224v1:100867-100889 AGGAAGGAGGAGAATGTGGAAGG + Intergenic
1203503174 Un_KI270741v1:42746-42768 AGGAAGGAGGAGAATGTGGAAGG + Intergenic
1185504936 X:625066-625088 AGGGAGGGAGAGAAGGAGGGAGG - Intronic
1185582422 X:1220939-1220961 ATGGAGGGGTAGATAGATGATGG + Intergenic
1185627589 X:1493386-1493408 AGGGAGGGAGGGAAGGAGGAAGG + Intronic
1185640738 X:1588333-1588355 AGGGAGGGGAAGGGAGAGGAGGG - Intergenic
1185640906 X:1588679-1588701 AGGGAGGGGAAGGGAGAGGAGGG - Intergenic
1185641128 X:1589148-1589170 AGGGAGGGGAAGGGAGAGGAGGG - Intergenic
1185641160 X:1589218-1589240 AGGGAGGGGAAGGGAGAGGAGGG - Intergenic
1185680083 X:1881295-1881317 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1185683786 X:1910431-1910453 AGGGAGGGAGAAAGTGAGGAAGG - Intergenic
1185688344 X:1948492-1948514 AGGAGAGGGTAGAAGGAGGAGGG + Intergenic
1185688622 X:2134014-2134036 AGGAGAGGGTAGAAGGAGGAGGG + Intergenic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1185777559 X:2817092-2817114 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1185883818 X:3764105-3764127 AGGGAGGGGTAAATTGATGGTGG - Intergenic
1186019187 X:5235081-5235103 AGGGAGGGAGAAAAGGAGGAAGG - Intergenic
1186020100 X:5245333-5245355 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1186079322 X:5912969-5912991 AGGGAGGGAGAGCAGGAGGAAGG + Intronic
1186145642 X:6621643-6621665 AGGAAGGGAAAGAAGGAGGAAGG + Intergenic
1186226599 X:7405593-7405615 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1186490731 X:9970272-9970294 AGGGAGGGATGGAATGAAGGAGG - Intergenic
1186541908 X:10409589-10409611 AGGCTGGGGTGGAGTGAGGATGG - Intergenic
1186838443 X:13460948-13460970 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1186897343 X:14017206-14017228 AGCGAGTGGTAGAGTGAGGCTGG + Intronic
1187258467 X:17662333-17662355 TGTAAGGGGTAGTATGAGGAGGG - Intronic
1187364076 X:18652100-18652122 AGCTAGGGGGAGAATGGGGAGGG - Intronic
1187791800 X:22958351-22958373 AGGGAGGGGGAAAATAGGGAAGG + Intergenic
1188277286 X:28215998-28216020 AGGGAGGGAAAGAGGGAGGAAGG - Intergenic
1188909707 X:35831634-35831656 ACAGAGTGGTAGAATGAGGAAGG - Intergenic
1189229796 X:39443354-39443376 AGGCAGGGGGACAATGGGGAGGG + Intergenic
1189274238 X:39773182-39773204 AGGGGAGGGGAGAATGAAGAGGG - Intergenic
1189352249 X:40284486-40284508 AGGGGAGGGAATAATGAGGAGGG - Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189543011 X:42012256-42012278 AGGGTAGGGTACAATTAGGAAGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189778558 X:44492139-44492161 TGGGAAGGGTGGAATCAGGAGGG - Intergenic
1189938708 X:46098166-46098188 AGGGAGGCTTAGTATGAGCATGG - Intergenic
1190058119 X:47193935-47193957 GGGGAGGAGGAGAAGGAGGAGGG + Exonic
1190198072 X:48336701-48336723 AGGGAGGGGGAGGAAGGGGAGGG + Intergenic
1190248813 X:48707370-48707392 AGGGAGGGGGAGAAGGAGGGAGG - Intronic
1190751833 X:53368865-53368887 AGGGAGGGAGGGAAAGAGGAAGG + Intergenic
1190953137 X:55165519-55165541 AGGGAGGGAGGGAAAGAGGAAGG - Intronic
1192097820 X:68231782-68231804 AGGTAGAGGTAGAAGGAGGGAGG + Intronic
1192150982 X:68712251-68712273 AGGGAGGACTATAATGAGCATGG + Intronic
1192176209 X:68887159-68887181 AGGGAGGGAAAGAAGGAGGGAGG - Intergenic
1192353161 X:70373295-70373317 AAGGAGGGGGAGAACGGGGAGGG + Intronic
1192415461 X:70976094-70976116 AGAGATGGGTAGAATCAGGGAGG + Intergenic
1192553092 X:72069394-72069416 AGGGAGGGGGAGAGAGAGGGAGG + Intergenic
1193059583 X:77190865-77190887 GGGAAGGGATTGAATGAGGAGGG - Intergenic
1193101213 X:77614853-77614875 AGGGAGGGATAGAGAGAGGTTGG - Intronic
1193218990 X:78899936-78899958 TGGGAGGGAGAGAATGAGGGAGG + Intergenic
1194141823 X:90218130-90218152 AGGGAGGGGTATTTCGAGGATGG + Intergenic
1194217910 X:91154072-91154094 AGAGAGGGATAGAGGGAGGAGGG + Intergenic
1194769346 X:97882140-97882162 TGGAAGAGGTAAAATGAGGATGG - Intergenic
1194940482 X:100003598-100003620 AGGGAGGACCATAATGAGGATGG - Intergenic
1195282756 X:103352700-103352722 AGGGAGGGATAGTCAGAGGAAGG + Intergenic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195379347 X:104256050-104256072 AGGGAGGGGGAGGAGGAAGAAGG - Intergenic
1195618407 X:106930628-106930650 AGGGAGGGGTAGGAGAGGGATGG - Exonic
1195908033 X:109864782-109864804 AGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1195990295 X:110675750-110675772 AGGGAGGGAGGGAGTGAGGAGGG + Intronic
1196135171 X:112200914-112200936 AGGGAAAGGAATAATGAGGAAGG + Intergenic
1196194741 X:112827858-112827880 AGGTAGGGGCAGAATGTGGGAGG - Intronic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1196657330 X:118232199-118232221 GGGGAGGGGGAGGAAGAGGAAGG + Intergenic
1196887573 X:120262634-120262656 AGGGAGGGAGAGGAGGAGGAAGG - Intronic
1196939454 X:120761048-120761070 AGGGAAGGGAAGAAGAAGGAAGG - Intergenic
1197196746 X:123710006-123710028 AGGGAAGGGCAGAAAGAGAAAGG + Intronic
1197250348 X:124209452-124209474 AGGGAGGGAGGGAAGGAGGAAGG - Intronic
1197390632 X:125859450-125859472 AAGAAGTGGTAGATTGAGGAAGG + Intergenic
1197462456 X:126759164-126759186 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1197823578 X:130565574-130565596 AGGGAGGGGTAGATCATGGAGGG + Intergenic
1198166782 X:134065413-134065435 GGGGAGGGGTAGGATGGGAAGGG - Intergenic
1198323994 X:135548884-135548906 AGGCGGGGGGAGAAGGAGGAAGG + Intronic
1198383366 X:136105025-136105047 AGGGAGGGAAAGAACGAGGCAGG + Intergenic
1198383386 X:136105098-136105120 GGGGAGGGATGGAGTGAGGAAGG + Intergenic
1198457906 X:136835585-136835607 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1198554629 X:137779935-137779957 AGGGTGGGGCAGAGTGGGGATGG - Intergenic
1198757405 X:139995856-139995878 AGGGAGAGGTAGATTTAGAATGG + Intergenic
1198963847 X:142207722-142207744 AGGAAGGGCTAGAAGGAGGCAGG - Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199673159 X:150163425-150163447 AGGGATGGGAAGGATGATGATGG - Intergenic
1199782943 X:151080181-151080203 GGGGATGGATAGAATGAGGGAGG - Intergenic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1200328339 X:155265853-155265875 GGGGAGGGATAGCATTAGGAGGG + Intergenic
1200487584 Y:3787242-3787264 AGGGAGGGGTATTTCGAGGATGG + Intergenic
1200554416 Y:4617857-4617879 AGAGAGGGATAGAGGGAGGAGGG + Intergenic
1200710457 Y:6479885-6479907 AGGGAGGGAGAGAAGGAAGAAGG + Intergenic
1200783796 Y:7240846-7240868 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
1201023480 Y:9682109-9682131 AGGGAGGGAGAGAAGGAAGAAGG - Intergenic
1201225537 Y:11815109-11815131 AGGGGTTTGTAGAATGAGGAAGG - Intergenic
1201269337 Y:12239271-12239293 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1201411427 Y:13702976-13702998 AGGGGAGGGTAGAAGGAGTAAGG - Intergenic
1201452977 Y:14136179-14136201 AGGGAGGGATGGAAGGAGGGAGG - Intergenic
1201538902 Y:15084739-15084761 AGGGAGGGAGGGAAGGAGGAAGG + Intergenic
1201549990 Y:15209417-15209439 GGGGAGGGGAAGGAAGAGGAGGG + Intergenic
1201550069 Y:15210240-15210262 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1201739331 Y:17306743-17306765 AGGGAGGGAAGGAAGGAGGAAGG + Intergenic
1201939952 Y:19448745-19448767 AGGCAGGGGTACAAGGAGGTGGG - Intergenic
1202107801 Y:21388334-21388356 AGGGAGGGAGGGAATAAGGAAGG + Intergenic
1202273687 Y:23094792-23094814 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1202292340 Y:23325889-23325911 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
1202386949 Y:24335471-24335493 AGGGAGGGAAAGAAGGAGCAAGG - Intergenic
1202426683 Y:24728537-24728559 AGGGAGGGATGGAGGGAGGAAGG + Intergenic
1202444106 Y:24941549-24941571 AGGGAGGGATGGAGGGAGGAAGG - Intergenic
1202483837 Y:25334657-25334679 AGGGAGGGAAAGAAGGAGCAAGG + Intergenic