ID: 1092447034

View in Genome Browser
Species Human (GRCh38)
Location 12:8567518-8567540
Sequence CAGTGACACTGTAACATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092447034_1092447041 17 Left 1092447034 12:8567518-8567540 CCCAAAATGTTACAGTGTCACTG 0: 1
1: 1
2: 0
3: 15
4: 201
Right 1092447041 12:8567558-8567580 TGCCTATGCAGACAAGTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 246
1092447034_1092447039 13 Left 1092447034 12:8567518-8567540 CCCAAAATGTTACAGTGTCACTG 0: 1
1: 1
2: 0
3: 15
4: 201
Right 1092447039 12:8567554-8567576 ATCCTGCCTATGCAGACAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092447034 Original CRISPR CAGTGACACTGTAACATTTT GGG (reversed) Intergenic
903891562 1:26573513-26573535 CCGTGACACTGTAGCATGTTAGG - Intronic
905601010 1:39251350-39251372 CACTCACACAGTTACATTTTGGG + Intronic
907469601 1:54664665-54664687 CAGTGTCACTGAAGGATTTTAGG + Intronic
907579100 1:55555900-55555922 CAGGGACAAGATAACATTTTGGG - Intergenic
910767862 1:90800558-90800580 CAGTGACACTATAACACTGAGGG + Intergenic
911016911 1:93343757-93343779 CAGTGACACTGTGACAACTTGGG + Intergenic
912324085 1:108741328-108741350 AGGTGACACTGAAACATGTTGGG - Intronic
915022621 1:152796070-152796092 CAGAGAGACTGAAACATTGTAGG - Intronic
915025927 1:152829521-152829543 CAGTGAAACAGTCAAATTTTTGG + Intergenic
916563795 1:165955733-165955755 CAGGGACACTGTCCCATTGTTGG - Intergenic
920027212 1:203007589-203007611 CAGGGGCGCTGAAACATTTTGGG + Intronic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
921141482 1:212311048-212311070 CAGCTCCACTGTAATATTTTGGG - Intronic
921514405 1:216072182-216072204 CAGTGACATTCTACTATTTTGGG - Intronic
922891230 1:229063126-229063148 CAGTGCCACCTTAACATTGTAGG + Intergenic
1062893324 10:1083107-1083129 AAATAACATTGTAACATTTTAGG - Intronic
1065880692 10:30035233-30035255 AAGTGATAGTGTAACATTTTTGG - Intronic
1067492904 10:46729223-46729245 CATTGGCACTATGACATTTTGGG - Intergenic
1067601760 10:47611169-47611191 CATTGGCACTATGACATTTTGGG + Intergenic
1067803620 10:49377516-49377538 CAGTGACACTGTACCCATTCTGG + Intronic
1068054791 10:51998292-51998314 CATTGACATTGTGTCATTTTGGG + Intronic
1070127787 10:73635852-73635874 CAGTGACACTGTAGCAGGTGGGG + Intronic
1070691901 10:78533260-78533282 TAGAGACACTGGAACATCTTTGG - Intergenic
1071026557 10:81121153-81121175 CAGTTACATTGTCACATTTTTGG - Intergenic
1071653286 10:87418756-87418778 CATTGGCACTATGACATTTTGGG + Intergenic
1072762305 10:98066815-98066837 CAGTGACACTCAGTCATTTTAGG + Intergenic
1072764661 10:98085567-98085589 CAGTGAGAATGTACCATGTTTGG + Intergenic
1072985026 10:100131881-100131903 CACAGATACTATAACATTTTTGG - Intergenic
1075813083 10:125241658-125241680 CAGTGACAGAATAAGATTTTTGG - Intergenic
1076196287 10:128520622-128520644 CAGTGATACTGCAGAATTTTAGG - Intergenic
1077260011 11:1612253-1612275 CAGCGTCACTGTGACATTATGGG + Intergenic
1077848413 11:6050503-6050525 CATTAACACTGGAACATGTTGGG + Intergenic
1084799544 11:71533610-71533632 CAGCGTCACTGTGACATTATGGG - Intronic
1085542142 11:77281587-77281609 CAGTGATAGTGTAGCATTTGGGG + Intronic
1087975973 11:104546990-104547012 CAGTACCACTTTAACATTTATGG - Intergenic
1090766861 11:129883841-129883863 CAGTGTCACTGTAACGATTAAGG + Intronic
1092071512 12:5635138-5635160 CGGTGACACAGTACCAATTTTGG + Exonic
1092447034 12:8567518-8567540 CAGTGACACTGTAACATTTTGGG - Intergenic
1095160759 12:38912290-38912312 CAGTGACACTGTGCCAATTCTGG - Intergenic
1098299929 12:69043595-69043617 CGGTGACACTGATACACTTTTGG - Intergenic
1099693577 12:85992039-85992061 CAAAGATCCTGTAACATTTTGGG + Intronic
1103289981 12:119837609-119837631 CAGGGACAGAGTTACATTTTTGG - Intronic
1104210277 12:126682278-126682300 CAGTGGCACTGGAACTTTTGGGG + Intergenic
1104266080 12:127233648-127233670 TAATGACACTGTGACATTTGTGG + Intergenic
1105025690 12:132847329-132847351 CTGTTACACTGGAACCTTTTGGG - Intronic
1105245797 13:18649026-18649048 CAGAGAAAATGTAAAATTTTAGG + Intergenic
1105517917 13:21106999-21107021 TAGTGACACTGAAATATTTATGG + Intergenic
1105554769 13:21436251-21436273 CTGTGTCATTATAACATTTTGGG - Intronic
1110433118 13:75448954-75448976 GAGTGTCACTTTCACATTTTAGG - Intronic
1111720603 13:91939012-91939034 CTTAGATACTGTAACATTTTAGG + Intronic
1116540463 14:46096033-46096055 CAGGGACACTTTTACATTGTTGG - Intergenic
1117808886 14:59524089-59524111 CAGTGACACTGTGTGACTTTGGG - Intronic
1119012561 14:71010205-71010227 CTGTGCCACTGTAAGATCTTCGG - Intronic
1120122419 14:80697828-80697850 CAGATACACTTCAACATTTTGGG + Intronic
1120522103 14:85535430-85535452 CAGTGTGAATGTAAAATTTTAGG + Intronic
1122613348 14:103000701-103000723 CAGGGACCCTGTAATATTTATGG + Intronic
1124938641 15:34196840-34196862 AAGTAAAACTGTAACAGTTTAGG - Intronic
1128730704 15:70018999-70019021 AAGTGACACTCCAACATCTTGGG + Intergenic
1128749962 15:70141751-70141773 CAGTGACACTGATAAGTTTTGGG - Intergenic
1129377582 15:75143924-75143946 CAAGGATCCTGTAACATTTTGGG - Intergenic
1130935379 15:88465982-88466004 CAGTGACATTGTAACATTTTTGG - Intronic
1130941833 15:88516768-88516790 CAGTGACACTGTACCTGATTGGG + Exonic
1135395830 16:22131074-22131096 CAGTGACATCCTCACATTTTAGG + Intronic
1139290498 16:65854018-65854040 ATAGGACACTGTAACATTTTTGG + Intergenic
1141212898 16:81997429-81997451 GAATGACACTGTGACATTTGAGG + Exonic
1143892598 17:10114228-10114250 CAGTGAGACTGTAGCATTGACGG - Intronic
1145194128 17:20872108-20872130 CAGTAAAACAGTATCATTTTAGG + Intronic
1145297912 17:21609052-21609074 CAGTAAAACAGTATCATTTTAGG - Intergenic
1145352348 17:22094345-22094367 CAGTAAAACAGTATCATTTTAGG + Intergenic
1145404492 17:22573759-22573781 CAGTAAAACAGTATCATTTTAGG + Intergenic
1146802162 17:35833957-35833979 CATTTCCACTGAAACATTTTGGG - Intronic
1149892711 17:60404174-60404196 AAGTGATACTGTTACATTTGAGG + Intronic
1154443120 18:14410632-14410654 CAGAGAAAATGTAAAATTTTAGG - Intergenic
1155818091 18:30341388-30341410 TGGTGAAACTGTAACATTTAAGG + Intergenic
1155874723 18:31071864-31071886 CAGTGACATTGTATAATGTTTGG - Intronic
1158889575 18:61860216-61860238 CAGAAACTCTGTCACATTTTTGG - Intronic
1159220562 18:65458417-65458439 CACTGATACTGTGACATTTTTGG - Intergenic
1160101800 18:75927284-75927306 TAGTGGCACTTTAACATTTCAGG - Intergenic
1160248429 18:77179854-77179876 CACTGACACTGTAACATCAATGG + Intergenic
1164803922 19:31101516-31101538 AATTGACTCTGTAACCTTTTTGG - Intergenic
1165887573 19:39089419-39089441 CAGGAACTCTGTAATATTTTTGG - Intronic
1166470312 19:43074227-43074249 CAGAATCACAGTAACATTTTTGG - Intronic
1166555397 19:43696402-43696424 AAGTGACACTGTGACAGTTCTGG - Intergenic
924963954 2:58480-58502 CAGAGATCCTGTAACATTTTGGG + Intergenic
925787657 2:7448493-7448515 CAGAGACCCTGGAACATTCTAGG - Intergenic
928745404 2:34408102-34408124 CAGAGATGCTGTAAAATTTTAGG - Intergenic
928782443 2:34840716-34840738 CAGTGACACTGAAACAGAATTGG - Intergenic
932411449 2:71550206-71550228 AAGGGACACTGTGGCATTTTAGG + Intronic
932874873 2:75441243-75441265 CAGTGACTTTGAAACATTTTTGG - Intergenic
932947739 2:76256954-76256976 CAGGGGCACTATAACATTCTGGG + Intergenic
933601057 2:84330736-84330758 CAGTGACTCTGTCTGATTTTTGG - Intergenic
935220345 2:101006696-101006718 CATTGACATCTTAACATTTTAGG + Intronic
936706843 2:115085612-115085634 CAGTGCCACTAGAACATGTTAGG + Intronic
937929732 2:127194752-127194774 CATTGACCCAGGAACATTTTGGG + Intronic
938642024 2:133291352-133291374 CAGAGTCACTGTTACATGTTTGG + Intronic
940972540 2:159909316-159909338 CATTGGCATTGTAAAATTTTTGG + Intergenic
941135734 2:161715947-161715969 CAGAAACACTTTTACATTTTTGG - Intronic
944503073 2:200381926-200381948 CAGTGGCTCTGTGACATTCTGGG - Intronic
944757372 2:202777467-202777489 CAGTGACAGTATTACATTCTGGG + Exonic
945308571 2:208284112-208284134 GAGTGATTCTGTAACATTTTAGG - Intronic
946064049 2:216970919-216970941 AAGTGACACTGTGCCAGTTTAGG - Intergenic
946538077 2:220652909-220652931 CAATGATACTATAGCATTTTGGG + Intergenic
947050822 2:226040754-226040776 CTGTGAAAATGTAACATTTAAGG - Intergenic
947406357 2:229781566-229781588 CAGTGACCCAGTATCCTTTTGGG - Intronic
1170030405 20:11938263-11938285 CAGGGACACTCCAACATTTAGGG - Intergenic
1171723790 20:28595771-28595793 CAGTGACATTGCCTCATTTTTGG - Intergenic
1171859562 20:30384153-30384175 CAGTGACATTGCCTCATTTTTGG + Intronic
1176452973 21:6880567-6880589 CAGAGAAAATGTAAAATTTTAGG + Intergenic
1176689894 21:9893513-9893535 CATTTACACTAAAACATTTTAGG - Intergenic
1176831146 21:13745615-13745637 CAGAGAAAATGTAAAATTTTAGG + Intergenic
1180297345 22:10954449-10954471 CAGTGACATTGCCTCATTTTTGG - Intergenic
1180411087 22:12609347-12609369 CAGTGACATTGATTCATTTTTGG + Intergenic
949789221 3:7774587-7774609 GAGTGACACTGTGGCAGTTTTGG - Intergenic
950272719 3:11631610-11631632 AAGTAAGACTGTGACATTTTTGG + Intronic
952943214 3:38458852-38458874 CCTTGACACTATTACATTTTGGG + Intronic
955586879 3:60488488-60488510 CAGTGACACTGTCAGCTTCTAGG - Intronic
955598018 3:60613002-60613024 TAATGACACTGTGACATTCTTGG - Intronic
956331376 3:68113860-68113882 AAGTGACAGTGTGACAGTTTGGG + Intronic
960062160 3:113334443-113334465 CAGTGACACTGATCCATTTCTGG + Intronic
960555676 3:119027499-119027521 AAGTGGCACTTTCACATTTTTGG - Intronic
963427287 3:145147982-145148004 CTGTGACACTGTAGGAGTTTTGG + Intergenic
963536032 3:146529460-146529482 CAGTGGCACTATAATATTTTGGG - Intronic
965040201 3:163498702-163498724 CACTGAGACTGTAACTTTTTGGG - Intergenic
967119098 3:186366873-186366895 CAGTGACACTGTAGAATTCCAGG - Intergenic
967197832 3:187044101-187044123 CAGTGACTCTGAAACTTTTTTGG - Intronic
967479097 3:189953913-189953935 CATTGACATCATAACATTTTTGG - Intergenic
970133541 4:12897001-12897023 CAAGGACACTGTAAGTTTTTGGG - Intergenic
971485908 4:27159993-27160015 CTGTGACAGGGTAACATTTAAGG - Intergenic
971948520 4:33313602-33313624 CAGTGAGAATGTAATATTTAAGG - Intergenic
972724375 4:41733490-41733512 CTGTTCCATTGTAACATTTTTGG + Intergenic
978336101 4:107671025-107671047 AATTGACACTGTATGATTTTAGG - Intronic
979455217 4:120919710-120919732 CAGTGAAAATGTGGCATTTTAGG - Intronic
980001898 4:127498942-127498964 CAGTGGCACTGTTGCATGTTTGG + Intergenic
980353302 4:131711448-131711470 CATTTACACTAAAACATTTTAGG - Intergenic
982510510 4:156276464-156276486 GAGTGTGACTGTAACATCTTTGG + Intergenic
985101927 4:186467036-186467058 CAGTTTCACTGTTACTTTTTAGG - Intronic
986113453 5:4744805-4744827 TAGTGAAACTGTCACATTCTGGG + Intergenic
986885783 5:12233728-12233750 CAGTGACTTTATCACATTTTTGG - Intergenic
989142708 5:38217908-38217930 GAGAGTCACTGTGACATTTTGGG + Intergenic
989307844 5:39977862-39977884 CAGTGACAGTCTTACTTTTTTGG + Intergenic
989823179 5:45820172-45820194 CAGTGACATTTTAGAATTTTGGG + Intergenic
990105721 5:52257048-52257070 CAATGACACATTAAAATTTTGGG + Intergenic
990648854 5:57876048-57876070 CAGTGACATAGTCATATTTTGGG - Intergenic
991434847 5:66587279-66587301 CAGTGATACTTTACCATTTGGGG + Intergenic
991576826 5:68113222-68113244 CAGTGTCTCTGTAAAATTTGAGG - Intergenic
992173602 5:74127772-74127794 CAGAGACACTGTCACATTCAGGG + Intergenic
993959600 5:94280682-94280704 TAGTGCCACTGTAATATTTCAGG + Intronic
994310921 5:98268885-98268907 CAGTAATGCTGTAACTTTTTTGG - Intergenic
994544684 5:101150022-101150044 CAGGGACACTGGAAAATTCTGGG - Intergenic
994989201 5:106978238-106978260 CAGTGATACAATAATATTTTTGG - Intergenic
996152982 5:120062786-120062808 CAGTGACAAGGTGACAGTTTTGG - Intergenic
997384416 5:133461336-133461358 CAGGGTGACTGTCACATTTTTGG + Intronic
1000914512 5:167064131-167064153 CTGTGACACTTTAAAATTGTAGG - Intergenic
1002393049 5:178930756-178930778 GTGTCACACTGTGACATTTTAGG + Intronic
1004123322 6:12847681-12847703 CTGTGCCACTGAAACATCTTGGG - Intronic
1007403490 6:41618242-41618264 AACTGACACTGCAACACTTTTGG + Intergenic
1009560951 6:65242565-65242587 TAATGCTACTGTAACATTTTTGG + Intronic
1009575816 6:65457692-65457714 CCGTGACAATGTAGCATATTAGG - Intronic
1012023536 6:93958440-93958462 CAGTGACAGAGAAACATGTTTGG - Intergenic
1012132871 6:95519061-95519083 CAGAGATACTGTAACACTATAGG - Intergenic
1013402886 6:109815745-109815767 CAGTTACACTGGCATATTTTAGG + Intronic
1014945797 6:127495773-127495795 CAATTACACTTTAAAATTTTTGG + Intronic
1015283099 6:131455122-131455144 CAGGCACAGTGTAGCATTTTTGG - Intergenic
1015874222 6:137806822-137806844 CAGTGACACTTTATTATGTTGGG - Intergenic
1017444370 6:154493958-154493980 CAGTGTCACTGGAACACATTAGG - Intronic
1017854497 6:158338554-158338576 CAGTGACCCTGTATCCTTTGCGG + Intronic
1020232399 7:6329535-6329557 AAGTGAAACTTAAACATTTTCGG - Exonic
1020411580 7:7897566-7897588 CAAAGACACTGAAACATTCTTGG + Intronic
1022368966 7:29752525-29752547 CAGTGTCTCTGTAAGGTTTTTGG + Intergenic
1025275131 7:57575780-57575802 CAGTAAAACAGTATCATTTTAGG - Intergenic
1027691224 7:81347922-81347944 AAGTGATAATGTAACATTATTGG + Intergenic
1030485841 7:110166171-110166193 CATTGACATTGTAGCCTTTTGGG + Intergenic
1034444971 7:151109352-151109374 CTGTGACACAGTAAACTTTTTGG - Intronic
1034867418 7:154654042-154654064 CTGTGATACTGTATCATTTAGGG - Intronic
1035234344 7:157486841-157486863 GAGTGACAGTGTGAGATTTTGGG + Intergenic
1037478347 8:19279323-19279345 CAGTGACATTGTATCAGTCTGGG - Intergenic
1038110704 8:24494129-24494151 AAATGTCACTGTAATATTTTTGG - Intronic
1038578519 8:28726561-28726583 CAGTGGCACAGTGACATTTTGGG + Intronic
1040448716 8:47522616-47522638 CAGTGACATTGTGTGATTTTGGG - Intronic
1044686280 8:94829041-94829063 CAGTTACACAGTAACACTTCAGG + Intronic
1045853019 8:106725683-106725705 CAGTCATTCTGTAAAATTTTAGG + Intronic
1046514282 8:115238480-115238502 CAGGGTCACTTTGACATTTTTGG - Intergenic
1048882745 8:138883893-138883915 CGGTGACACTGAACGATTTTAGG - Intronic
1050513617 9:6419711-6419733 CAGCCACAATGAAACATTTTGGG + Intronic
1050870077 9:10556405-10556427 CCATGACACTATATCATTTTAGG + Intronic
1051403632 9:16710373-16710395 CAATGCCACTGTAATATTTCTGG - Intronic
1051461900 9:17328059-17328081 AAATCACACTGTAACATTTCAGG + Intronic
1053153855 9:35760309-35760331 CAGTGACACTGTTAACATTTTGG + Intergenic
1053725812 9:40999278-40999300 CAGTGACATTGCCTCATTTTTGG + Intergenic
1053779367 9:41587962-41587984 CATTTACACTAAAACATTTTAGG + Intergenic
1054167325 9:61798203-61798225 CATTTACACTAAAACATTTTAGG + Intergenic
1054340128 9:63852589-63852611 CAGTGACATTGCCTCATTTTTGG - Intergenic
1054670219 9:67782697-67782719 CATTTACACTAAAACATTTTAGG - Intergenic
1057260324 9:93579358-93579380 CAGGGAAACTGTACCATTTTTGG - Intronic
1058688361 9:107498462-107498484 TAGTGACACTGAAATATTTTGGG - Intergenic
1058761150 9:108133659-108133681 TAGTGACACTTTAATATATTTGG + Intergenic
1202804367 9_KI270720v1_random:37398-37420 CAGTGACATTGCCTCATTTTTGG - Intergenic
1203516208 Un_GL000213v1:3948-3970 CAGAGAAAATGTAAAATTTTAGG - Intergenic
1203449001 Un_GL000219v1:92696-92718 CAGTGACATTGCCTCATTTTTGG - Intergenic
1186261735 X:7787336-7787358 AAGTCATACTGGAACATTTTTGG + Intergenic
1189020492 X:37332698-37332720 CATTGAAACAGTATCATTTTAGG - Intergenic
1189283409 X:39835090-39835112 GAGTGATACTGCAAGATTTTTGG + Intergenic
1189912776 X:45828023-45828045 ATGTGACACTGTAACACTTAGGG - Intergenic
1190006504 X:46744714-46744736 CAGAGACACTGCAACCTTTGGGG - Intronic
1190655545 X:52609118-52609140 CAGTGGCTCTGAAATATTTTCGG + Intergenic
1192170283 X:68850407-68850429 CAGTAACAATGAAAAATTTTTGG + Intergenic
1193596561 X:83452469-83452491 CAGTGATTTTGTAACATTTTTGG - Intergenic
1193787201 X:85773633-85773655 GGGTTACACTGTTACATTTTAGG - Intergenic
1195964144 X:110414896-110414918 CAGTCACACAGTACTATTTTTGG + Intronic
1197100093 X:122642733-122642755 CTGAGGCACTGTAACATTTAGGG - Intergenic
1197690165 X:129491009-129491031 CAGTAACACTGTAACTTACTGGG + Intronic
1197997093 X:132389304-132389326 CAAGGACACAGTACCATTTTTGG - Intronic
1199109150 X:143909924-143909946 AACTGACACTCTCACATTTTGGG + Intergenic
1201796787 Y:17904858-17904880 CAGGACCACAGTAACATTTTGGG + Intergenic
1201804766 Y:18001127-18001149 CAGGACCACAGTAACATTTTGGG - Intergenic
1202027386 Y:20539017-20539039 TGGTGAGACTGTAACATCTTTGG + Intergenic
1202358166 Y:24073920-24073942 CAGGACCACAGTAACATTTTGGG + Intergenic
1202512612 Y:25596193-25596215 CAGGACCACAGTAACATTTTGGG - Intergenic